Telomere organization and the interstitial telomeric sites involvement in insects and vertebrates chromosome evolution

Abstract

Telomere has a central role in chromosomal stability events. Chromosome ends organized in telomere-loop prevent activation of DNA damage response (DDR) mechanisms, thus keeping the chromosome structure organized. On the other hand, free chromosome ends, dysfunctional telomeres, and interstitial telomeric sequences (ITS) can trigger chromosome rearrangements. Here, the telomere organization, function, and maintenance mechanisms, in addition to ITS types and their involvement in chromosome changes, were revisited. Despite a general (TTAGGG)_n sequence being present in vertebrate telomeres, insects show more diversification of their telomere motif. The relation between ITS and chromosome rearrangements was observed in insects and vertebrates, demonstrating different types of genome organization and distribution. Some ITS cannot be considered relicts of chromosome rearrangements because probable they were inserted during a double-strand break repair mechanism. On the other hand, the involvement of telomere sequences participating or triggering chromosome rearrangements or organizing satellite DNA components in several species groups is evident. The genomic assembling advances and applying other methodologies over ITS, and their flanking regions, can help to understand the telomere participation in the chromosomal evolution in species groups with highly diversified karyotypes.

Telomeres organization and function

Telomere motifs

Telomeres are DNA regions at the end of eukaryotic chromosomes and are essential to their stability and integrity maintenance (Pisano et al., 2008; O’Sullivan and Karlseder, 2010; Galati et al., 2013; Lazzerini-Denchi and Sfeir, 2016). In most organisms, the telomeres consist of tandemly repeated motifs (usually 5 - 8 bp) with telomeric proteins attached to them, capping and protecting the telomeric region (Zakian, 1995). In vertebrates, the hexamer (TTAGGG)_n is present (Figure 1A, B), but a considerable variation in the length of the repeated region has been reported (Zakian, 1995).

Figure 1 -. FISH mapping of telomeric repeats (red) in two vertebrates and seven species of insect, belonging to orders Orthoptera, Blattodea, Hemiptera, Hymenoptera, Lepidoptera, Coleoptera, and Diptera. In (A, B) it was used as probe the (TTAGGG)_n motif, in (C-I) it was used as probe the “insect” telomere motif (TTAGG)_n largely present in multiple groups, and in (G) it was mapped the HeT-A retrotransposon. (A) Apareiodon affinis fish, mitotic metaphase (2n = 54); (B) Glossophaga soricina bat, mitotic metaphase (2n = 32); (C) Cyclopltiloides americanus, mitotic metaphase from male embryo (2n = 12AA + X₁X₂); (D) Nauphoeta cinerea, spermatogonial mitotic metaphase from male (2n = 36AA + X); (E) Mahanarva spectabillis male, late diplotene (2n = 9AA + X); (F) Atta sexdens female, mitotic metaphase from brain larvae (2n = 22AA); (G) Helicoverpa armigera male, pachytene bivalents (n = 31); (H) Conoderus malleatus male, pachytene (n = 8 + X); (I) Drosophila melanogaster male, mitotic metaphase from brain larvae (2n = 6AA + XY). The chromosomes were counterstained with DAPI (in blue). The sex chromosomes were indicated in some metaphases. Bar = 5 μm.

In other organisms, the size and organization of the telomeric motifs can be distinct. In insects, the presence of the called “insect” telomeric motif (TTAGG)_n is common (Figure 1C-F, and H-I), seems to be ancestral, and it is also shared by other arthropods (Frydrychová et al., 2004; Vítková et al., 2005). Although the structure of the telomeric motif could be quite variable within several insect groups because it can be lost or replaced by alternative mechanisms for maintaining telomere, making the study of the telomere structure and evolution of this class of animals interesting. Examples of the occurrence of non-canonical “insect” telomeric motif are observed in Coleoptera (beetles), with the description of the motif (TCAGG)_n on chromosome termini in representatives of Tenebrionidae (Mravinac et al., 2011) and Cleridae (Prušáková et al. 2021), and the recently discovered motif (TTGGG)_n on the Geotrupidae Anoplotrupes stercorosus (Prušáková et al., 2021). Remarkably among Diptera, the transposition of the non-long terminal repeat (non-LTR) retrotransposon was co-opted to maintain the telomere of Drosophila (Mason and Biessmann, 1995; Pardue and DeBaryshe, 2003; Figure 1G), and in basal dipterans, as chironomid midges, the recombination of long terminal repeats (LTR), i.e., satellite DNAs, maintains the telomeres (Nielsen and Edstrom, 1993).

Interestingly, in Bombyx mori (Lepidoptera; Fujiwara et al., 2005), Myzus persicae (Hemiptera; Monti et al., 2013), Pediculus humanus (Phthiraptera), and Tribolium castaneum (Coleoptera; Osanai et al., 2006), the (TTAGG)_n is interspersed with inserted non-LTR retrotransposable elements. This condition could be putatively an intermediate state between the canonical insect telomere and retrotransposon-based ones (Mason et al., 2016). In the honeybee (Apis mellifera, Hymenoptera), the telomere is also exceptionally non-canonical, forming a mosaic composed of TTAGG interspersed with TCAGGCTGGG, TCAGGCTGGGTTGGG, and TCAGGCTGGGTGAGGATGGG (Garavís et al., 2013). Finally, in some other groups of insects, the (TTAGG)_n is facultatively present, as in Hemiptera, Odonata, Hymenoptera, Neuroptera, and Coleoptera. While, in other few orders, including Ephemeroptera, Dermaptera, Raphidioptera, Siphonaptera, and Mecoptera, until now, the (TTAGG)_n was not evidenced, but no alternative telomeric motif was detected, deserving additional investigation, as just a few species were investigated (revised by Kuznetsova et al., 2020).

Based on genomic data, i.e., chromosome-level assemblies of 180 species of insects belonging to 8 orders, Lukhtanov (2022) added important data about the diversity of telomeres in this group. He confirmed some previous information about the insect-telomere structure and noticed new variations. In general, it was observed: (i) short repeats (the canonical telomeres); (ii) mononucleotide telomeres that consist of a long array of (A)_n and (T)_n at 5’and 3’ends, respectively; (iii) main short repeats with variants of short repeats; (iv) main short repeats interspersed with telomere-specific non-LTR retrotransposon (TRAS, SART families or both); (v) long repeats; (vi) long repeats in one telomere and arrays of short repeats (TTAGGTCTGGG)_n at the other end; (vii) non-LTR retrotransposons, including the HeT-A, TAHRE, and TART families (Lukhtanov, 2022).

Telomere organization

In most cases, the telomere organization has the 5’ cytosine (C)-rich at the end of one strand, while the 3’ strand end is guanine (G)-rich (Lazzerini-Denchi and Sfeir, 2016; Aksenova and Mirkin, 2019). The G-rich single-strand results from the inability of DNA polymerase to replicate chromosome ends (Watson, 1972; Lazzerini-Denchi and Sfeir, 2016). DNA replication requires a primer containing a free 3’ -OH group to start the DNA synthesis (Watson, 1972; Olovnikov, 1973). During the replication (which must occur in the 5’→3’ direction), the telomeres generated by continuous strand synthesis have blunt ends or small 5’ protrusions (Lazzerini-Denchi and Sfeir, 2016). The end of the discontinuous strand has a 3’ single-strand end, which comprises the segment from the removal of the RNA primer, referring to the beginning of the Okazaki fragment (Lazzerini-Denchi and Sfeir, 2016). The DNA polymerase inability to synthesize the end of chromosomes is named the end replication problem (Watson, 1972; Olovnikov, 1973).

According to the end replication problem mechanism, each discontinuous strand replication event leads to an 8-12 bp gap on the 3’ termini, resulting in a DNA shortening at each cell cycle (Makarov et al., 1997; Blackburn et al., 2006). The telomerase enzyme repairs the chromosome ends length in some specific cells by adding telomeric repeats in the 3’ G-rich strand as an important mechanism of damage prevention (Makarov et al., 1997; Blackburn et al., 2006). In addition to its participation in telomerase action, the G-rich strand end has an essential role in telomere organization. This strand is prone to form stable secondary structures, including quadruplex DNA (G4-DNA structures) (Sundquist and Klug, 1989; Williamson et al., 1989) that impair the replication machinery as it progresses through telomeric DNA (Lazzerini-Denchi and Sfeir, 2016). In this way, G4-DNA protects the chromosome ends and inhibits the telomerase action (Zahler et al., 1991; Smith et al., 2011).

Besides the G4-DNA structures, the telomeres can also organize a structure called a telomere loop (t-loop) (Griffith et al., 1999). Telomeres end with a single-stranded G-rich overhang that can invade the preceding double-stranded region to generate a particular lariat-like structure, the t-loop (Griffith et al., 1999; Figure 2). In the t-loop generation, the G-rich single-strand extension invades a precedent segment containing the duplex telomeric repeats and forms a displacement loop (d-loop) (Griffith et al., 1999; Figure 2). The d-loop binds telomeric proteins capping the chromosome ends (van Steensel et al., 1998; de Lange, 2005). The proper telomere capping depends on the interaction of some proteins with telomeric repeats, called the shelterin complex (Pisano et al., 2008; Galati et al., 2013; Lazzerini-Denchi and Sfeir, 2016).

Figure 2 -. Schematic representation of the T-loop organization. The telomere DNA loops back on itself, forming the T-loop. The 3’ G strand extension invades the duplex telomeric repeats and forms a D-loop. During the organization, the telomeric DNA is bound by the specialized shelterin complex and packaged into a t-loop configuration. The shelterin complex is organized by TRF1, TRF2, TIN2, RAP1, TPP1, and POT1. The six-subunit proteins protect the chromosome ends from the DNA damage signaling pathway and DNA repair mechanisms.

Telomeric proteins complex

Shelterin organizes a specialized multiprotein complex on telomeric region composed of six distinct proteins: telomere repeat-binding factor 1 (TRF1), telomere repeat-binding factor 2 (TRF2), protection of telomere 1 (POT1), telomere protection 1 (TPP1), TRF1-interacting nuclear factor 2 (TIN2), and repressor activator protein 1 (RAP1) in vertebrates (Pisano et al., 2008; Galati et al., 2013; Lazzerini-Denchi and Sfeir, 2016; Figure 2), besides variants forms presented in some organisms. The shelterin complex is essential to telomere length maintenance and protects the chromosome ends (Ichikawa et al., 2015; Lazzerini-Denchi and Sfeir, 2016). TRFs 1 and 2 bind to the double-stranded DNA of telomeric sequences and organize the core of the shelterin complex (Court et al., 2005; Lazzerini-Denchi and Sfeir, 2016). In the t-loop organization, TRF1 attaches to an internal nucleosome site and induces the mobility and condensation of the telomeric DNA (Pisano et al., 2010; Ichikawa et al., 2015). The TRF2 protein also participates in the telomeric chromatin structure, reducing nucleosome density and increasing the spacing among telomeric nucleosomes (Ichikawa et al., 2015). In addition, TRF2 plays an important role as a t-loop facilitator, and its loss leads to an increase in DNA damage response (DDR) pathways, chromosomal end-fusions, and cell senescence (van Steensel et al., 1998; de Lange, 2005; Fouché et al., 2006). POT1 is the third DNA-binding component within shelterin (Wu et al., 2010; Lazzerini-Denchi and Sfeir, 2016). Telomeres recruits POT1 by interacting with TPP1 and coat the single-stranded part of the TTAGGG repeats with its oligonucleotide/oligosaccharide binding folds (Wu et al., 2010; Lazzerini-Denchi and Sfeir, 2016). TIN2 and RAP1 do not bind directly to telomeric repeats, although they interact with other shelterin in this region (Wu et al., 2010; Lazzerini-Denchi and Sfeir, 2016). In addition to shelterin, another protein complex called CST-complex (composed by Ctc1, Stn1, and Ten1 in humans) binds to telomeric G-rich single-stranded promoting telomere protection and telomerase recruitment (Gao et al., 2007; Rice and Skordalakes, 2016).

Telomeric RNA

Although telomeres are highly condensed and heterochromatic, they show a dynamic chromatin structure as they are considered transcriptionally active (Azzalin et al., 2007; Xu et al., 2010). In addition to telomeric repeats and shelterin, telomeres are also made up of non-coding RNA molecules of the type (UUAGGG)_n, called Telomeric Repeat-containing RNA (TERRA) (Azzalin et al., 2007; Xu et al., 2010). TERRA is transcribed from the C-rich telomere strand, interacts with some telomeric proteins, participates in the transitional states of euchromatin and heterochromatin, and regulates telomerase activity (Azzalin et al., 2007; Xu et al., 2010).

TERRA can also form stable DNA/RNA hybrids with the C-rich telomeric strand, thus resulting in the displacement of the G strand, giving rise to an R-loop structure (Chawla and Azzalin, 2008; Santos-Pereira and Aguilera, 2015). R-loops prevent DNA replication progress by causing replication-fork stalling, collapse, and double-strand breaks (DSBs) (Gómez-González et al., 2011; Balk et al., 2013). Studies also suggest that TERRA is involved in telomere heterochromatin formation (Deng et al., 2009; Maicher et al., 2014).

Function

Telomeres protect the chromosome ends against inappropriate recombination, exonuclease attacks, and oxidative damage, thus maintaining the integrity and stability of the chromosome (de Lange, 2002). Therefore, the telomeres avoid chromosome ends recognition as DSBs by the DNA repair machinery (Lazzerini-Denchi and Sfeir, 2016; Slijepcevic, 2016). At the same time, telomeres allow the correct anchoring of the chromosomes to the nuclear membrane, ensure the three-dimensional structure of the nucleus and the proper spatial distribution of the chromosomes during cell proliferation (Zakian, 1995; Luderus et al., 1996). On the other hand, the organization of a dysfunctional telomere generates unstable DNA sites, which behave as DSB regions, triggering chromosomal rearrangements (Perry et al., 2004; Slijepcevic, 2016; Bolzán, 2017).

X-rays were used as inducers of chromosomal aberrations and demonstrated that broken chromosomes usually fused with their sister chromatids, generating a Breakage Fusion-Bridge mechanism (McClintock, 1941, 1987). In this mechanism, the terminal regions at the fusion sites were always lost, thus evidencing that the broken chromosomes (without the intact terminal protective “caps” on telomeres, or t-loop) were subject to fusion events (McClintock, 1987). The McClintock studies were important landmarks in chromosomal instability proposal associated with chromosome ends. Interestingly, after irradiation and breaks the end of chromosomes can be healed by de novo telomere addition, as documented in some organisms, including the homopteran insect Planococcus lilacinus (Mohan et al., 2011).

Telomere length maintenance mechanisms

In each DNA replication round, naturally, telomeres lose a segment of their repetitive sequence (Watson, 1972). In the absence of mechanisms that prevent telomere shortening during cell proliferation, there would eventually be an excessive decrease in the terminal region and the activation of a DDR mechanism, leading to cellular senescence (de Lange, 2005). It is known that telomeric DNA has difficulties to replicates due to their repetitive organization, its ability to form secondary structures, as well as the presence of the shelterin complex (Sfeir et al., 2009; Bah et al., 2011; Lopes et al., 2011; Paeschke et al., 2011; Anand et al., 2012). Telomeric replication requires G4-DNA structures to relax and disassemble the t-loops, which demand specialized enzymes, such as several DNA helicases (Croteau et al., 2014; Vannier et al., 2014; Geronimo and Zakian, 2016; Mendoza et al., 2016; Poole and Cortez, 2016).

Telomeric sequences are added to chromosome ends in specific tissues by the telomerase enzyme action (Kolquist et al., 1998). Telomerase acts as an RNA-dependent DNA polymerase, a type of reverse transcriptase that uses an intrinsic RNA template to transcribe telomeric repeats at chromosome ends, avoiding telomere shortening (Greider, 1995). Telomerase has a catalytic subunit ribonucleoprotein complex called Telomerase Reverse Transcriptase (TERT) and an RNA template, the Telomeric RNA Component (TERC) (Chen and Lingner, 2013). The function occurs by adding telomeric repeats to the G-rich single-stranded end from the reverse transcription of the telomerase RNA template into DNA (Greider, 1995). The activity is controlled by CST-complex (Chen and Lingner, 2013), which after the G-rich strand extension, displaces telomerase, remove secondary structures, and recruit the DNA polymerase α/primase complex to synthesize the C-rich strand (Diede and Gottschling, 1999; Qi and Zakian, 2000; Aksenova and Mirkin, 2019). Thus, the absence of telomerase activity in somatic cells leads to a decrease in telomeric repeat number in each cell cycle, promoting cell senescence (Kolquist et al., 1998; Bolzán et al., 2000; Hines et al., 2005).

Interestingly, in addition to maintaining the length of telomeres, telomerase can catalyze telomeric repeats synthesis to non-telomeric sites on chromosomes (Melek and Shippen, 1996; Aksenova and Mirkin, 2019). Thus, the telomerase repair activity can lead to chromosome instability and fragmentation when competing with DNA repair machinery on broken ends (Slijepcevic, 1998, 2016). Some proteins binding in the lesion point could prevent the telomerase attachment to DSBs (Slijepcevic and Al-Wahiby, 2005). As mentioned above, dysfunctional telomeres or DSBs appear to be repaired by DNA machinery, sometimes with telomere and telomerase action in chromosome rearrangements.

DNA repair mechanisms

Free chromosomal ends appear as DSBs and can be targeted for DNA repair if not adequately protected from the DDR machinery. The DNA lesion repair could occur through many pathways, such as Non-homologous End Joining (NHEJ); Microhomology-mediated End Joining (MHEJ), also called alternative NHEJ; Homologous Recombination (HR); Break-induced DNA Replication (BIR); and Single Strand Annealing (SSA) (Heyer, 2015; Ceccaldi et al., 2016; Lazzerini-Denchi and Sfeir, 2016; Rodgers and McVey, 2016; Kramara et al., 2018; Seol et al., 2018). Sometimes, the DNA repair mechanisms can cause chromosomal rearrangements, leading to unequal distribution of genetic material to daughter cells, thus evidencing the importance of an intact telomeric region during cell division (Slijepcevic, 1998, 2016; Bolzán, 2017; Aksenova and Mirkin, 2019).

NHEJ is the main DSB repair pathway in the cells (Lazzerini-Denchi and Sfeir, 2016). The mechanism receives this name because, during a DSB, the damaged region of DNA loses some nucleotides, generating non-complementary single-stranded ends subject to a complex repair mechanism (Figure 3). Thus, unlike the HR mechanism, the NHEJ does not require DNA strand homology to guide repair. There are two NHEJ pathways, classical NHEJ and alternative NHEJ (revised in Lazzerini-Denchi and Sfeir, 2016). Classical NHEJ (Figure 3A) repairs DSBs with minimal changes in the sequence, while alternative NHEJ (Figure 3B) can generate large segments possessing deletion or insertion (Lazzerini-Denchi and Sfeir, 2016). During the alternative NHEJ, a probable involvement of telomerase inserting telomeric motifs (Figure 3B) to perform DSB repair was verified, generating short ITS (Ruiz-Herrera et al., 2008; Lazzerini-Denchi and Sfeir, 2016). SSA has a similar alternative NHEJ mechanism and involves the annealing of homologous repeat sequences that flank a DSB, which causes a deletion rearrangement between the repeats (for a review, see Bhargava et al., 2016). On the other hand, the HR mechanism (Figure 4) has action in repairing DSBs without rescuing paralyzed or collapsed replication forks in chromosomal rearrangements, horizontal gene transfer, and meiosis (Pierce et al., 2001). Sometimes, this DNA repair pathway could occur between two lengths of DNA that have high sequence similarity but are not alleles in a mechanism called non-homologous recombination or non-allelic homologous recombination (Parks et al., 2015). This mechanism could promote a concerted evolution of the repeat units and is a common mechanism for generating genome rearrangements (Parks et al., 2015; Barros et al., 2017; Glugoski et al., 2018).

Figure 3 -. Schematic representation of Non-homologous end joining mechanisms (NHEJ). In (A) classical-NHEJ (c-NHEJ), a free chromosome end generated by double-strand breaks (DSB) or dysfunctional telomere (DT) could be repaired with minimal sequence alterations. The mechanism is initiated with the Ku70/Ku80 heterodimer binding to free chromosome ends. Ku proteins recruit DNA-PKcs to promote phosphorylation. After, the terminal end-processing enzyme Artemis cleaves single-stranded overhangs, then DNA ligase 4 (LIG4) and the scaffold protein XRCC4 connect the free ends. In (B), the alternative-NHEJ (alt-NHEJ) can generate extensive nucleotide deletions or insertions during the DNA repair process. A series of proteins act in alt-NHEJ ends resection, among them poly(ADP-ribose) polymerase 1 (PARP1), MRN complex (MRE11-RAD50-NBS1), and CtBP-interacting protein (CtIP). After ends resection on lesion point, DNA polymerase θ (Pol θ) is recruited to promote end joining. In alt-NHEJ, sometimes in a differential way, the telomerase enzyme is proposed to perform telomere motifs addition to terminal ends after ends resection, thus generating short-ITS.

Figure 4 -. Homologous recombination repair is schematized in (A). After a DSB, the newly released DNA ends are processed to produce long stretches of 3’-terminal single-stranded DNA (ssDNA). Replication Protein A (RPA) binds to ssDNA ends, avoiding potential secondary structure formation and protecting the ssDNA degradation by nucleases. The RPA is replaced with Rad51 mediator help, and the ATP-dependent DNA-binding protein extends the strand at the end of the DNA, organizing the pre-homologous complex. The pre-homologous complex is responsible for finding a double-stranded DNA sequence (dsDNA). The 3’ end of presynaptic ssDNA can initiate the duplication using homologous dsDNA as a template. From this point, the mechanism can be directed to several different molecules that restore DNA. Sometimes, the repair mechanism could find the same DNA repeat region of the DSB point in a non-homologous chromosome (B) and use this dsDNA as a template called non-homologous recombination or non-allelic homologous recombination.

The Breakage-Induced-Replication (BIR), or recombination-dependent DNA replication, is a repair mechanism usually triggered when a single-stranded break in DNA occurs (Anand et al., 2013). Phosphodiester bond break in the polynucleotide strand is the primary type of spontaneous DNA damage. When the DNA duplication fork encounters one of these breaks, the single-stranded end formed needs to be repaired by HR. These breaks can also be detected at the chromosome ends in telomerase-deficient cells and trigger a BIR repair (Anand et al., 2013). The BIR mechanism begins with the invasion of the single-stranded to a homologous DNA sequence, which uses it as a template to replicate until the next duplication fork or the chromosome end (Anand et al., 2013).

In the telomeric region, the HR mechanism can occur in 3 main pathways: Telomere Sister Chromatid Exchange (T-SCE), T-loop Homologous Recombination (T-loop HR), and Alternative Lengthening of Telomeres (ALT). In some insects from the order Diptera that lost the telomerase, a retrotransposon-based mechanism (RM) is used to regenerate chromosomal ends (Mason et al., 2008).

T-SCE is a mechanism for exchanging telomeric sequences between sister chromatids. The mechanism has harmful consequences when unequal crossing-over occurs in the telomeric region, and, in this case, one of the daughter cells inherits a short telomere (Lazzerini-Denchi and Sfeir, 2016). In the T-loop HR, an extrachromosomal duplex or single-stranded circular DNA molecule composed of t-arrays (t-circle) is used in a rolling-circle mechanism (forming σ-form ‘tailed circles’), thus generating long extrachromosomal t-arrays (Tomaska and Nosek, 2009). In the ALT mechanism, the telomeres length maintenance depends on the strands’ recombination without telomerase action (Bryan et al., 1995; Henson et al., 2002; Muntoni and Reddel, 2005). It is believed that in ALT, the single-stranded telomeric termination invades double-stranded telomere sequence or, in the other way, anneals to single-stranded DNA and uses it as a template for the synthesis of a new telomeric DNA sequence (Cesare and Reddel, 2010). The template can come from the own telomere (t-loop formation), sister chromatid or another chromosome telomere, or extrachromosomal telomeric DNA copies (Bryan et al., 1995; Cesare and Reddel, 2010).

At least, in the RM pathway, a telomeric retrotransposon is transcribed and posteriorly translated in an element-encoded GAG-like protein. GAG binds the retrotransposon RNA, re-entry the nucleus, and attaches to a chromosome end. So, a reverse transcriptase uses the free 3′ hydroxyl group at the chromosome end as a primer to copy the RNA intermediate into the first DNA strand. Second strand synthesis occurs by DNA repair and completes the addition of a new HeT-A retrotransposon (for a review, see Mason et al., 2008).

In some cases, repairing telomere injuries appears harmful to the genome, leading to chromosome fusions and their subsequent breakage during cell proliferation, causing the unequal genetic material heritage among daughter cells.

Interstitial telomeric sequences

Interstitial telomeric sequences (ITS) are composed of telomeric motifs located in non-terminal regions of the chromosomes, as in pericentromeric and interstitial regions (between the centromere and telomere) (Meyne et al., 1990; Slijepcevic, 1998; Bolzán and Bianchi, 2006; Ruiz-Herrera et al., 2008). Originally, the ITS occurrence was related to chromosome fusions (Meyne et al., 1990). This kind of ITS located in chromosome fusion points was posteriorly called heterochromatic ITS (het-ITS), which confers chromosome fragility and contributes to genome evolution (Ruiz-Herrera et al., 2008; Bolzán 2012, 2017; Slijepcevic, 2016; Barros et al., 2017; Glugoski et al., 2018). However, different ITS distribution patterns, even in closely related species, reveal their dynamic nature in chromatin composition and epigenetic changes (Swier et al., 2012; Rovatsos et al., 2015).

According to their organization, location, and flanking sequences, ITS can be classified into four types: short-ITS, subtelomeric-ITS, fusion-ITS, and het-ITS. Short-ITS comprises chromosomal regions generally containing up to 20 TTAGGG tandemly repeated sequences (Azzalin et al., 2001; Nergadze et al., 2004). Based on mammalian genome data, short-ITS are grouped according to their organization and flanking sequences into five subclasses: (i) Class A: short-ITS flanked by the same repetitive element on both sides (Short Interspersed Nuclear Elements - SINEs, or Long Interspersed Nuclear Elements - LINEs, for example); (ii) Class B: short-ITS is flanked by repetitive units organized in the same direction, in both sides; (iii) Class C: short-ITS is flanked by single-copy DNA, in both sides; (iv) Class D: short-ITS is flanked by transposable elements in one side and single-copy DNA in another side; (v) Class E: short-ITS is located in the junction between two distinct repetitive elements (Azzalin et al., 2001).

Some theories explain short-ITS occurrence by insertion of telomeric repeats during the DSB repairs, being the ITS considered relics of an ancestral break (Nergadze et al., 2004; Ruiz-Herrera et al., 2008). As abovementioned, short-ITS can be added in a canonical NHEJ with telomerase involvement in this pathway (for a review, see Ruiz-Herrera et al., 2008). A second proposal for short-ITS origin involves the possibility of being remnants of a transposable element insertion (Azzalin et al., 2001; Nergadze et al., 2004). Still, the short-ITS may have been simply the birth of a microsatellite containing the telomeric repeat unit, and its expansion or shortening would occur by DNA slippage (Mondello et al., 2000).

The subtelomeric-ITS is composed of thousands of TTAGGG units tandem repeats degenerated into a 5’-3’ organization (head to the tail cluster), which are present in subterminal regions of human chromosomes, as also seen in other vertebrate species (Bolzán, 2017). The proposal for subtelomeric-ITS admits that this degenerate region was originally a true telomere. In this pathway, since a translocation event has established a new telomere, posteriorly, the former telomere sequences degenerate in subtelomeric-ITS (Bolzán, 2017).

The fusion-ITS is a terminology used to describe the TTAGGG repeats flanked by small subtelomeric sequences present at human chromosome 2q13. This fusion-ITS maintain the remnants of end-to-end fusion (or telomere-telomere fusion), related to the evolutionary origin of human chromosome 2 (Azzalin et al., 1997, 2001). Nowadays, fusion-ITS can be figured out in other organisms since genome assembling has expanded over numerous groups.

Het-ITS organize large blocks of telomeric repeats located into the heterochromatin, usually in some chromosomes’ centromeric or pericentromeric regions (Lin and Yan, 2008; Ruiz-Herrera et al., 2008). Telomeric proteins (TRF1, TRF2, and RAP1) could bind in the het-ITS, suggesting that the shelterin complex has an important role in these region’s organization and function (Zakian, 1995; Simonet et al., 2011). Yet, the het-ITS could be relicts of chromosome rearrangements (e.g., Robertsonian - Rb fusion or, pericentric inversion) with fundamental importance in chromosome evolution in some groups (Paço et al., 2013; Matoso Silva et al., 2016; Viana et al., 2016; Deon et al., 2020).

In the chromosome fusion model, het-ITS are consequences of end-to-end fusion between two dysfunctional telomeres located in ancestral chromosomes (usually in acrocentrics) and posteriorly inactivation of one centromere in the dicentric chromosome formed (Paço et al., 2013; Bolzán, 2017). Nevertheless, in vertebrate chromosomes were visualized that het-ITS are subject to TTAGGG units amplification by unequal crossing-over, DNA slippage, or gene conversion mechanisms, generating large het-ITS blocks in centromeric/pericentromeric chromosome regions (Meyne et al., 1990; Ruiz-Herrera et al., 2008; Schmid and Steinlein, 2016). Once ITS are frequently flanked by satellite DNA and transposable elements, a mechanism based on transposable elements insertion containing telomeric repeats was also proposed in the het-ITS origin (Bolzán, 2017).

Furthermore, subsequent chromosomal rearrangements (inversions, translocations, and fusions) may involve these repeated sequences and redistribute them internally in the chromosomes (Ruiz-Herrera et al., 2008). Finally, chromosomal fissions on ITS, which are naturally prone to breakage, can serve as a substrate for forming a new telomere and generating new acrocentric chromosomes in the genome (Ruiz-Herrera et al., 2008), contributing to karyotype evolution (Bolzán, 2017).

ITS in situ localization method

The usual methodology to detect canonical telomeres and ITS is the fluorescence in situ hybridization (FISH) with a telomeric sequence probe (see full method description in supplementary material S1). The general telomeric sequence of the vertebrates is easily amplified by polymerase chain reaction (PCR) using the oligonucleotides (TTAGGG)₅ and (CCCTAA)₅, and no template DNA (Ijdo et al., 1991, Figure 5). For insect telomeric motif, the oligonucleotide used is (TTAGG)₅ and (CCTAA)₅. In insects, the tyramide signal amplification procedure has been used to detect shorter ITS (Rego and Marec, 2003). In addition, in vertebrates, telomeric sequences detection has been performed using Peptide Nucleic Acid (PNA) probes, or less commonly, by the Primed in situ Labeling (PRINS) method (Azzalin et al., 1997, 2001; Ruiz-Herrera et al., 2008; Bolzán, 2017). A rigorous analysis of the chromosomal spreads is crucial in all methods due to the faint signals in some ITS/telomere chromosome markings.

Figure 5. Summary of steps to amplify the general telomeric sequence of the vertebrates (TTAGGG)_n by polymerase chain reaction (PCR) using the oligonucleotides (TTAGGG)₅ and (CCCTAA)₅, and no template DNA. In (A), a schematic representation of the primer auto annealing, providing a double-strand terminal with free OH; (B) representation of the amplicons with different sizes due to distinct points of telomere units pairing during the PCR; (C) agarose gel 1% showing a smear resulted from the PCR (L = ladder 100 bp; 1 = telomere amplicons with desired sizes, i.e., 100 - 600 bp. For a detailed method, please see Supplementary Material S1.

ITS and chromosomal remodeling in insects and vertebrates

Terminal telomeric sequences are naturally prone to breakage, leading to chromosome plasticity (Slijepcevic, 2016). In addition, telomere sequences could be considered hotspots for chromosomal breakage when organizing ITS (Slijepcevic et al., 1997). Some studies show that telomeric DNA damage can be irreparable, causing persistent DDR activation (Fumagalli et al., 2012) or remaining as fragile sites (Sfeir et al., 2009). Once ITS could act as an unstable chromosome site, in some animal groups it is noticed chromosome remodeling events as a consequence or cause of the ITS occurrence in their karyotypes.

Insects

Insects present extreme variability of karyotypes, chromosome number and morphology, and types of sex chromosome systems (Kaiser and Bachtrog, 2010; Blackmon et al., 2017) due to chromosomal rearrangements, like fusions, fissions, translocations, and inversions. However, only a few ITS cases containing loci of (TTAGG)_n were detected (see references below), even in species with highly rearranged karyotypes. They are limited to few species, representatives of orders Lepidoptera (Rego and Marec, 2003), Hemiptera (Chirino et al., 2017), and Orthoptera (López-Fernández et al., 2004; Jetybayev et al., 2012, 2017; Camacho et al., 2015; Grzywacz et al., 2019; Buleu et al., 2020; Warchałowska-Śliwa et al., 2021).

In Lepidoptera, ITS were detected only in Ephestia kuehniella mutants with fused chromosomes induced from radiation (diploid number - 2n = 59) and in Orgyia antiqua, a species with 2n reduction (2n = 28) occasioned by multiple fusions (Figure 6A). Besides typical telomere on chromosome termini in both species, the hybridization signal for (TTAGG)_n probe is observed. For O. antiqua, the ITSs are probably remnants of multiple chromosomal fusions, but in E. kuehniella although the ITS are present in multiple chromosomes, they are not on fused ones (Rego and Marec, 2003).

Figure 6 -. Selected chromosomes showing the occurrence of ITS on insect chromosomes (arrowheads) in addition to regular telomeric signals on the end of chromosomes (in red). In (A), a pachytene bivalent from female stained by TSA-FISH (FISH with Tyramide Signal Amplification, see Carabajal Paladino et al., 2014) from the Lepidoptera Orgya antiqua (for details see Marec and Rego, 2003); In (B), Schistocerca gregaria (Orthoptera), a small mitotic chromosome from female embryo (for details see Camacho et al., 2015). In all images, the probe used was (TTAGG)_n. Bar = 5 μm.

In hemipterans, ITS motifs were documented in the representatives of giant water bugs Belostoma (Belostomatidae). Striking macro-chromosomal variability is observed in this genus as a result of fragmentations and fusions involving autosomes-autosomes and autosomes-sex chromosomes (Chirino and Bressa, 2014; Gallo et al., 2017). Chirino et al. (2017), through chromosomal mapping of (TTAGG)_n on six species with a different number of autosomes (6, 14, and 26 chromosomes) and simple (XY/XX) and multiple (X₁X₂Y/X₁X₁X₂X₂) sex chromosome systems, revealed the incidence of ITS in the species with 2n reduction. Moreover, these species with reduced 2n presented larger chromosomes. This supported that telomere-telomere fusions were the major chromosomal rearrangement involved in karyotype evolution in Belostoma bugs from an ancestral karyotype of 2n = 26+XY/XX.

Among insects, Orthoptera is the group with most ITS cases described until now, with occurrence in more than 20 species. The ITS were noticed in species belonging to multiple groups, including representatives of Tettigoniidae, Pamphagidae, and Acrididae (López-Fernández et al., 2004; Jetybayev et al., 2012, 2017; Camacho et al., 2015; Grzywacz et al., 2019; Buleu et al., 2020; Warchałowska-Śliwa et al., 2021). In this last group, it was present on some representatives from subfamily Gomphocerinae and in Podisma pedestris (Cantatopinae), Eyprepocnemis plorans (Eyprepocneminae), and Schistocerca gregaria (Cyrtacanthacridinae) (Figure 6B). Interestingly, some Acrididae representatives with ITS have 2n = 23, X0 and acrocentric chromosomes, which are ancestral to the group (Husemann et al., 2022), with no apparent macro chromosomal rearrangement. According to Grzywacz et al. (2019), in P. pedestris (2n = 23), the occurrence of ITS could suggest rearrangements, like inversions, telomere fusion, unequal crossing over, or insertion of telomeric DNA on unstable sites.

A remarkable example of ITS occurrence in autosomes was observed on Gomphocerinae (Acrididae) representatives with the reduced 2n, i.e., 2n = 17. The ITS was reported in Chorthippus jacobsoni on the pericentric region of the biarmed pairs (pairs 1-3), revealing that the centric fusion between ancestral chromosomes that originated these pairs was not a Rb rearrangement but a true telomeric fusion that could generate true dicentric chromosomes. On Aeropus sibiricus, polymorphic occurrence of ITS was noticed on chromosome six, as a consequence of a paracentric inversion in which the breakpoint involved the true telomeric DNA block. In other species with 2n = 17, no ITS were observed on large metacentric rearranged chromosomes (Jetybayev et al., 2012). In the Tettigoniidae Gonatoxia helleri, the occurrence of ITS on all chromosomes seems to be in concordance with points of fusion and inversion rearrangements (Warchałowska-Śliwa et al., 2021).

Besides occurrence on autosomes, the ITS were reported on sex chromosomes of orthopterans as a result of chromosome rearrangements involved in the origin of the neo-XY sex chromosomes. On Pamphagidae, multiple species with neo-XY harbor ITS on the pericentromeric region of neo-X, as a consequence of chromosome fusion between an ancestral autosome and the X chromosome (Jetybayev et al., 2017), although pericentric inversions could also be involved in the posterior origin of the ITS (Buleu et al., 2020). ITS on ancestral X chromosome from X0/XX sex system was scarcely observed (Buleu et al., 2020; Warchałowska-Śliwa et al., 2021). Finally, in multiple species of Orthoptera with neo-sex system, although resultant of fusion chromosome rearrangements no ITS are noticed, suggesting that the Rb fusions involved the loss of telomeres, originated from double chromosome breaks or the ITS were eliminated later along sex chromosomes differentiation. Furthermore, the absence of ITS signals detection could be resulted by the low number copies of telomeric repeats (Palacios-Gimenez et al., 2013, 2015a, 2015b).

Fishes

In fish species, the ITS were classified into four categories: (i) telomeric DNA sequences located at the pericentromeric regions; (ii) ITS observed between centromeres and the telomeres located at terminal regions; (iii) telomeric DNA sequences that scatter along the nucleolar organizer regions (NORs); and (iv) telomeric DNA repeats interspersed with the entire chromosomes (Ocalewicz, 2013). These kinds of ITS were described in species into 12 fish orders (Ocalewicz, 2013). In some groups with chromosomal remodeling, most of the pericentromeric ITS was described as relicts of chromosome fusion events (Rocco et al., 2001, 2002; Chew et al., 2002; Harvey et al., 2002; Milhomem et al., 2008; Ocalewicz et al., 2009; Felippe and Foresti, 2010; Mota-Velasco et al., 2010; Scacchetti et al., 2011; Blanco et al., 2012, 2017; Errero-Porto et al., 2014; Favarato et al., 2016; Barbosa et al., 2017; Barros et al., 2017; Glugoski et al., 2018, 2022; Deon et al., 2022a) or as unstable sites triggering DSBs and chromosome rearrangements (Rosa et al., 2012; Deon et al., 2020, 2022b). In other cases, e.g., in some Characidium species, a conserved karyotype with ITS was proposed due to ectopic transposition or events of homologous and non-homologous recombination (Scacchetti et al., 2015; Oliveira et al., 2021a).

ITS considered vestiges of chromosome fusions were also proposed in the origin of the multiple sex chromosome systems in fishes (Cioffi and Bertollo, 2010; Cioffi et al., 2010; Blanco et al., 2017). In Erythrinus erythrinus and Hoplias malabaricus, the ITS are relicts of chromosome rearrangements on the X₁X₂Y sex chromosome system origin (Cioffi and Bertollo, 2010; Cioffi et al., 2010). Chromosome rearrangement with pericentromeric ITS maintaining was also described in the origin of the X chromosome in one Harttia lineage possessing XX/XY₁Y₂ sex chromosome system (Blanco et al., 2017; Deon et al., 2022a). The data reinforce the proposal of independent origin of multiple sex chromosome systems in some fish groups triggered by chromosome rearrangements without a previous simple sex chromosome system occurrence (Deon et al., 2020; Sassi et al., 2020).

Acipenseriformes species are characterized by a large number of chromosomes, of which the majority are microchromosomes (Fontana et al., 1998, 2004). In this group, scattered telomeric signals along all microchromosome extensions were reported (Fontana et al., 1998, 2004; Ocalewicz, 2013). Extensive amplification processes extending telomeric arrays to an extraordinary length ranging from 40 kb to 2 Mb, or even longer, were proposed to explain the entire microchromosomes possessing interspaced telomeric DNA sequences (Delany et al., 2000; Ocalewicz, 2013).

ITS are also collocated or adjacent to NORs, usually related to CMA₃-positive GC-rich heterochromatin in some fish species (Reed and Phillips, 1995; Ocalewicz et al., 2004; Pomianowski et al., 2012; Ocalewicz, 2013; Sember et al., 2015, 2018). Telomeric motifs scattered into NORs were detected in species from Anguilliformes, Mugiliformes, Salmoniformes, Syngnathiformes, and Cypriniformes (Reed and Phillips, 1995; Salvadori et al., 1995; Gornung et al., 2004; Ocalewicz et al., 2004; Rossi et al., 2005; Libertini et al., 2006; Pomianowski et al., 2012; Ocalewicz, 2013; Sember et al., 2015, 2018). The colocalization of ribosomal repeats and telomeric sequences was proposed to stabilize broken chromosomal ends (Pich et al., 1996; Liu and Fredga, 1999). On the other hand, consistent evidence of the association between 5S or 45 rDNA clusters and ITS (collocated or adjacent sites) organizing evolutionary breakpoint regions was proposed in some armored catfish genera (Rosa et al., 2012; Barros et al., 2017; Glugoski et al., 2018; Deon et al., 2020, 2022b). In some species of Rineloricaria and Ancistrus, the adjacent regions of ITS and 5S rDNA sites organize unstable chromosome sites (Rosa et al., 2012; Barros et al., 2017; Glugoski et al., 2018, 2022; Figure 7A). In addition, Harttia species possesses 5S and 45S rDNAs close to or inside ITS promoting extensive chromosomal remodeling in the lineage (Deon et al., 2020; Figure 7B).

Figure 7 -. Metaphases of distinct groups of vertebrate species submitted to FISH using (TTAGGG)_n probes, evidencing ITS markings (in red). (A) The fish species Rineloricaria sp. (Loricariidae) showed a polymorphic karyotype with 2n = 41 chromosomes, the arrowheads showed het-ITS, and the arrow evidenced a chromosome bearing the co-located het-ITS/5S rDNA (box). (B) Another fish species Harttia sp. (Loricariidae) (2n = 62) showed 8 het-ITS (arrowheads and arrows), the arrows indicated co-located het-ITS/45S rDNA sites, the chromosome pair bearing 45S rDNA is highlighted in the box. (C) The amphibian Boana faber (Hylidae) showed ITS blocks in all chromosomes in the centromeric regions, suggesting that the telomere motifs could compound the centromeric satellite DNA units. (D) The karyotype of the snake Eunectes murinus (Boidae) (2n = 36) showed ITSs (arrowheads). (E) The turtle Phrynops sp. (Chelidae) (2n = 58) presented ITS distributed in the centromeric and interstitial regions (arrowheads). (F) The bat species Sturnira lilium (Phyllostomidae) (2n = 30) showed 14 ITS in the chromosomes. Bar = 10 μm.

Amphibians

Amphibians are a diverse class of vertebrates, with most cytogenetic studies concentrated in species of the order Anura. Few species of the orders Caudata and Gymnophiona have been investigated cytogenetically, and most of the available data are limited to conventional karyotype descriptions and base-specific fluorochrome staining. To the best of our knowledge, we found only two reports of the chromosomal mapping of the telomeric motif in the karyotype of Caudata species. While the FISH with (TTAGGG)_n motif detected the terminal region of all chromosomes of Bolitoglossa paraenses (Silva et al., 2014), the chromosomal mapping experiments in Cynops pyrrhogaster did not detect any hybridization signal in the karyotype (Murakami et al., 2007). The absence of a hybridization signal with (TTAGGG)_n probe in chromosomes of Cynops pyrrhogaster suggests the need for future molecular characterization of terminal regions of these chromosomes to understand better these unexpected results (Murakami et al., 2007).

The occurrence of ITS has already been reported in more than 50 species of the order Anura (Schmid and Steinlein, 2016; Schmid et al., 2018; Teixeira et al., 2016; Zattera et al., 2019; Suárez et al., 2020) belonging to the families Centrolenidae, Dicroglossidae, Hylidae, Leptodactylidae, Pelodryadidae, Phyllomedusidae, Pipidae, and Strabomantidae. Despite most of these descriptions, the ITS occurrence could not be explained as a vestige of interchromosomal rearrangement events, but the case observed in Scarthyla is one interesting exception. The hypothesis of the 2n reduction from 2n = 24 to 2n = 22 by chromosome fusion event in Scarthyla is supported by a conspicuous signal of centromeric ITS in chromosome pair 3 (Suárez et al., 2013).

The ITS of Anura chromosomes are frequently associated with heterochromatic regions that suggest the (TTAGGG)_n sequences are an essential component of repetitive DNA of this group (Schmid and Steinlein, 2016). For example, the karyotype of Boana faber showed conspicuous centromeric heterochromatic blocks also FISH-positive with (TTAGGG)_n probe in all chromosome pairs (Schmid and Steinlein, 2016; Schmid et al., 2018; Figure 7C). These centromeric segments are AT-rich repetitive sequences and ITS signals, revealing the importance of the telomeric-like motifs to compose these heterochromatic portions (Schmid and Steinlein, 2016). However, large clusters of ITS detected in euchromatic chromosome regions represent a unique feature in some Anuran karyotypes (Schmid and Steinlein, 2016). For example, the karyotype of Boana boans showed conspicuous ITS in the non-heterochromatic chromosome region of the short arms of pairs 2 and 9 (Mattos et al., 2014; Schmid and Steinlein, 2016; Schmid et al., 2018). A similar condition was reported to Phyllomedusa vailantti (Bruschi et al., 2014) and in the Sphaenorhynchus lacteus (Suárez et al., 2013). Also, these chromosomal segments did not reveal heterochromatin features by C-banding or fluorochromes staining (Suárez et al., 2013; Bruschi et al., 2014; Mattos et al., 2014; Schmid et al., 2018).

The screening of karyotypes of natural hybrids of anuran reveals interesting contributions to the distribution and dynamic of ITS in these individuals. For example, Phyllomedusa distincta (2n = 26) hybridized with P. tetraploidea (2n = 52) in high frequency in one stable secondary contact zone in the Atlantic Forest of Brazil, originating a natural triploid population (3n = 39). Both parental species collected from the hybridization zone showed het-ITS accumulated on centromeric regions of the homologs of pairs 6, 7, and 11, cytogenetic markers present and stable all triploid individuals analyzed (Gruber et al., 2013). Curiously, populations of P. distincta collected outside of the hybridization zone showed an identical FISH signal of the homologs of pair 11 but differs by the absence of the het-ITS signal on pairs 6 and 7, and by the additional signal in the centromeric region of pair 8 (Bruschi et al., 2014), reveling an interpopulation variation. Cytogenetic studies of the triploid hybrid (3n = 36) from Dryophytes chrysosceli (2n = 24) and Dryophytes versicolor (4n = 48) also allow identifying sharing het-ITS from parental in the hybrid karyotype (Wiley et al., 1992). In this case, the polymorphic condition absence/presence of het-ITS in the long arm of chromosome pair 1 reveals interesting founds about the population dynamics of these chromosomal markers. Among individuals of the D. chrysoscel from hybridization zone is observed in heterozygous (+/-) and homozygous (+/+ and -/-) to the condition of chromosome pair 1 while in D. vesicolor, tetraploid species, exhibits individuals with complete absence of ITS signal (homozygous -/-/-/-) or with only two chromosomes of the 4 homologs with FISH-signal (heterozygous +/+/-/-) (Wiley et al., 1992). The karyotype of the natural triploid hybrid between this species exhibits only one chromosome 1 with ITS signal (Wiley et al., 1992).

Reptiles

The karyotype of non-avian reptiles exhibits complex chromosomal evolution scenarios and a recent accumulation of knowledge about ITS distribution. The Archosauromorpha included the turtle sister group of the crocodile+birds. The species of order Crocodylia show karyotype composed exclusively of macrochromosomes probably due to fusions between microchromosomes that resulted in the disappearance of all microchromosomes in this lineage, estimated around 230 Mya (Deakin and Ezaz, 2019). Currently, just six crocodilian species were analyzed by chromosomal mapping with (TTAGGG)_n probe: Crocodylus siamensis (Kawagoshi et al., 2008), Caiman latirostris, Caiman crocodiles crocodiles, Paleosuchus palpebrosus, Alligator mississippiensis, and Aligator sinensis (Oliveira et al., 2021b). The unique case of the ITS was reported in the karyotype of Caiman crocodilus crocodiles (FN = 60; 24t + 18m/sm) from the Amazon region, Brazil (Oliveira et al., 2021b), with (TTAGGG)_n signal on centromeric/pericentromeric part of pairs 14, 15, and 16. This karyotype differs from the specimens of C. crocodilos from the United States (FN = 62; 22t + 20m/sm), and the presence of ITS could be represented as the signature of the chromosomal rearrangements that occurred during the chromosomal evolution of C. crocodilos (Oliveira et al., 2021b).

Few turtle karyotypes have been reported with ITS. From 65 species cytogenetically analyzed (Clemente et al., 2020, 2021) with this chromosome marker, only ten showed hybridization signals of telomere-like motifs in interstitial regions of chromosomes (Clemente et al., 2020). Curiously, the non-telomeric repeats in turtles were majoritarian detected in the centromeric region of chromosomes (Cavalcante et al., 2018; Clemente et al., 2020; Figure 7D). The unique exception observed was in the karyotype of Elseya novaeguineae (Mazzoleni et al., 2020), in which an interesting heteromorphism male-specific was observed with (TTAGGG)_n probe, revealing richness of the telomeric-like motifs in the interstitial position of the chromosome Y. In sea turtles, the ITS were also observed on the microchromosomes (Machado et al., 2020a, 2020b). Despite the prevalence of centromeric ITS in turtle chromosomes, when the karyotypes were analyzed in the phylogenetic context, any occurrence of ITS could be assigned as interchromosomal rearrangements (Clemente et al., 2020). The optimization of chromosomal data on phylogenetic trees helped to understand the putative origins of the ITS in genomes, which discarded the “a priori” hypothesis of the intrachromosomal fusions.

Squamate reptiles include lizards, snakes, and amphisbaenian species. The karyotype of Squamata showed a high variation of macrochromosomes and microchromosomes numbers, including one lineage that showed karyotypes exclusively composed of macrochromosomes. Cytogenetic data were reported on more than 100 species with evidence of ITS in their karyotypes (Rovatsos et al., 2015; Clemente et al. 2020; Kostmann et al., 2020; Augstenová et al., 2021). The non-telomeric (TTAGGG)_n motifs are randomly distributed in the centromeric, pericentromeric, and interstitial chromosomes regions (Rovatsos et al., 2015; Figure 7E). They have revealed higher levels of chromosomal diversity predicted by classical cytogenetic studies in this group (Rovatsos et al., 2015).

Birds

FISH experiments detecting telomeric sequences in birds usually show just terminal signals (Nanda et al., 2002; Nishida et al., 2008; dos Santos et al., 2015, 2017; Rodrigues et al., 2017; Kretschmer et al., 2018), with the interesting finding that more prominent signals are observed in microchromosomes compared to macrochromosomes (Nanda et al., 2002; dos Santos et al., 2015, 2017). On the other hand, ITS are considered vestiges of chromosomal rearrangements that are particularly frequent in the chicken and primitive Palaeognathae birds (Nanda et al., 2002; Nishida et al., 2008), but also have been seen in other bird groups (Nanda et al., 2002; Derjusheva et al., 2004).

Some studies anchored in phylogenetic analyses showed that many ITS observed in Palaeognathae lineage due to ancestral fusions gradually disappeared along with the divergence of Palaeognathae and Neognathae (Nanda et al., 2002; Kretschmer et al., 2018). In some bird species, where ITSs were expected to be present due to tandem chromosome fusions or centric fusions occurrence, it has been proposed that the telomeric DNA was lost during the chromosomal rearrangements (Nanda et al., 2007; de Oliveira et al., 2008; Nishida et al., 2013).

Mammals

The organization causes and consequences of the ITS occurrence in the human genome are reasonably well understood, as abovementioned. Mammals generally show a vast quantity of studies discussing ITS causes and consequences in chromosome evolution. A concise description of ITS cases in mammal genomes is shown here. In several mammalian groups, the presence of ITS located in the centromere, pericentromere, or those found between the centromere and the telomere were classified into short-ITS, subtelomeric-ITS and het-ITS (Ijdo et al., 1991; Farré et al., 2009; Ventura et al., 2012; Dumas et al., 2016; Matzenbacher et al., 2022). ITS occurrence or het-ITS as a vestige of the chromosomal rearrangement is an usual condition in the main descriptions of mammalian species (Lee et al., 1993; Scherthan, 1995; Metcalfe et al., 1998, 2002, 2004; Zou et al., 2002; Hartmann and Scherthan, 2004; Ventura et al., 2006; Rovatsos et al., 2011; Nagamachi et al., 2013; Colomina et al., 2017; Mazzoleni et al., 2017; Matzenbacher et al., 2022, among others). Despite the het-ITS indicating a chromosome rearrangement, some studies also demonstrate the occurrence of telomeric repeats constituting a new component of the satellite DNA in the genomes (Faravelli et al., 2002; Rovatsos et al., 2011).

The Indian muntjac deer karyotype is differentiated by tandem fusion, a rare evolutionary chromosome rearrangement, leading to an extremely reduced karyotype of 6/7 (female/male) chromosomes (Lee et al., 1993; Frönicke and Scherthan, 1997). Posteriorly, Hartmann and Scherthan (2004) proposed that telomere and GC-rich satellite DNA sequences were involved during muntjac chromosome fusions. In addition to deer, ITS and chromosome changes were proposed in other mammalian groups: Chiroptera (Calixto et al., 2014), Perissodactyla (Danielak-Czech et al., 2013), marsupials (Metcalfe et al., 1998, 2002, 2004), primates (Dumas et al., 2016; Mazzoleni et al., 2017), and Rodentia (Ventura et al., 2006; Rovatsos et al., 2011; Nagamachi et al., 2013; Lanzone et al., 2015; Colomina et al., 2017).

In Phyllostomidae bats, the het-ITS were proposed as vestiges of Rb fusion during the chromosomal evolution (Calixto et al., 2014). Unstable chromosome regions with t(7;13)(q13;q46) reciprocal translocation showed an ITS as a relict of the chromosomal rearrangement in pigs (Danielak-Czech et al., 2013). In Australian marsupial, the distribution of the (TTAGGG)_n sequence into moderate and large centromeric heterochromatin blocks reflect its presence as a native component of satellite DNA rather than its involvement in past rearrangements (Metcalfe et al., 2004). On the other hand, in marsupial karyotypes with little heterochromatin, the ITS was proposed as relicts of chromosome rearrangements and 2n reduction (Metcalfe et al., 2007).

Subtelomeric-ITS and het-ITS have been proposed in some primate genomes (Meyne et al., 1990; Garagna et al., 1997; Go et al., 2000; Azzalin et al., 2001; Hirai, 2001; Ruiz-Herrera et al., 2002, 2005; Wijayanto et al., 2005; Mudry et al., 2007; Dumas et al., 2016; Mazzoleni et al., 2017). Among the Old World monkeys (Cercopithecini), a centromeric het-ITS in C. petaurista and C. guereza (Colobini) was described (Mazzoleni et al., 2017). ITS were not observed in Hylobates lar and Pongo pygmaeus, while Macaca fascicularis (Papionini), Pan paniscus, and Pan troglodytes (Hominoidea) have multiple het-ITS (Azzalin et al., 2001; Hirai, 2001; Hirai et al., 2005; Ruiz-Herrera et al., 2005; Mazzoleni et al., 2017). Pericentromeric het-ITS and many large telomeric/subtelomeric signals, presumably resultant of the amplification of telomeric sequences were described in Lemur catta (Mazzoleni et al., 2017). In other Lemuriformes, many interspersed telomeric sites (het-ITS) were observed in the karyotypes (Meyne et al., 1990; Garagna et al., 1997; Go et al., 2000; Mazzoleni et al., 2017).

Neotropical monkeys (Platyrrhini) characterized by highly derived karyotypes show no or few het-ITS, while species with less reshuffled karyotypes in terms of interchromosomal rearrangements present many het-ITS (Ruiz-Herrera et al., 2005; Mudry et al., 2007; Dumas et al., 2016; Mazzoleni et al., 2017). Some New World monkey species also have ITS in their karyotypes (Ruiz-Herrera et al., 2002, 2005; Dumas et al., 2016), sometimes without heterochromatin correspondence (Mazzoleni et al., 2017). Based on the ITS in situ localization in several primate groups, Mazzoleni et al. (2017) suggested a correlation between ITS and rearrangements in many species, thus correlating with chromosomal plasticity.

An extensive (TTAGGG)_n in situ localization demonstrated that pericentromeric het-ITS are a common feature in arvicolid rodents allied to examples of het-ITS amplification at non-pericentromeric regions, and some descriptions of short-ITS at the euchromatic regions (Rovatsos et al., 2011). In the same study, Rovatsos et al. (2011) proposed no direct correlation between the presence or absence of het-ITS and the genus or subgenus classification of the Arvicolinae, in which the variation and amplification of ITS occurred independently in each species. Yet, het-ITS have played a significant role in karyotypic variation and evolution of Arvicolinae species, but het-ITS cannot explain the rearrangements that occurred during the karyotype evolution of Chionomys, Arvicola, and Microtus (Rovatsos et al., 2011). In Cerradomys (Sigmodontinae), ITS accumulate at the breakpoints, although the possibility of resulting from old fusions was not ruled out (Nagamachi et al., 2013).

Het-ITS repeats and a satellite DNA (named CH5) located in centromeric heterochromatin were described in the chinese hamster (Faravelli et al., 2002). In other rodents, het-ITS have been localized within or at the margins of constitutive heterochromatin (Meyne et al., 1990; Vermeesch et al., 1996; Ono and Yoshida, 1997; Go et al., 2000). In arvicolids, a co-distribution for het-ITS and Msat-160 satellites has been proposed in centromeric heterochromatin’s organization and structure (Rovatsos et al., 2011).

In the African pygmy mice, Mus species, a large amplification of telomeric repeats was identified in the pericentromeric region of acrocentric and most metacentric chromosomes (Colomina et al., 2017). According to the authors, Mus musculus domesticus has a different Rb fusion mechanism than African pygmy mice. The number of telomere repeats in the ITS could be a signature of the Rb fusion age of formation (Colomina et al., 2017). Yet, the large amplification of TTAGGG repeats in pericentromeric regions of the acrocentric chromosomes in African pygmy mice were proposed to mediate the formation of Rb fusions (Colomina et al., 2017). At least, the occurrence of the ITS in the differentiation of the sex chromosomes was described in Arvicolinae species (Rovatsos et al., 2011) and in the sex-autosome fusion in African pygmy from the Mus genus (Colomina et al., 2017). All data presented here demonstrated the extensive ITS participation in mammal chromosome remodeling events.

Genomic instability, ITS, and chromosomal rearrangements

Although ITS do not organize functional telomeres and their functions are not entirely elucidated, many studies indicate that ITS plays a fundamental role in the genomic instability and chromosomal evolution in several groups (Perry et al., 2004; Ruiz-Herrera et al., 2008; Slijepcevic, 2016; Bolzán, 2017). Besides ITS presence in species possessing a highly rearranged karyotype, ITS also occurs in close relationship species showing a conservative chromosome structure, i.e., ancestral karyotypes (Nergadze et al., 2004; Swier et al., 2012). In general, the ITS are hotspots for chromosome breaks, recombination, chromosomal rearrangements, amplification sites, and thus, organizing genomic instability sites (Perry et al., 2004; Bolzán, 2017). The nucleotide sequence feature of the ITS contributes to genomic instability (Perry et al., 2004). The guanine-rich segment could organize DNA secondary structures prone to break, triggering chromosomal rearrangements (Salvati et al., 2010; Vannier et al., 2012).

It is known that het-ITS organize unstable genomic sites, while this role remains controversial in short-ITS (Ruiz-Herrera et al., 2008). Short-ITS are unable to bind telomere proteins or organize complex structures, a condition to prone DSB sites (Ruiz-Herrera et al., 2008). Nevertheless, a study proposed that even short-ITS possessing TTAGGG repetition in minus 100 bp interval are related to genomic recombination increase (Kong et al., 2010, 2013). Dysfunctional telomeres also are considered unstable genomic sites since the inactivation or telomere loss are characteristics for triggering Rb fusions (Slijepcevic, 1998, 2016; Bolzán, 2017).

Rb fusions are consequences of telomere shortening, centromere chromosome breaks, or telomere inactivation (Meyne et al., 1990; Slijepcevic, 2016; Bolzán, 2017). Still, there are three causes of loss of telomeric function without complete loss of telomere sequences: (i) telomeric proteins inactivation; (ii) loss of telomere function; and (iii) loss of telomerase function (Slijepcevic, 1998). Bolzán (2017) described chromatin conformation’s central role in ITS stability. The nucleosome organization in the telomeric chromatin is around 40 bp shorter than nuclear nucleosomes (Tommerup et al., 1994; Lejnine et al., 1995), and the high compacted regions in het-ITS results in DNA bents, unpaired segments, and DSBs (Rivero et al., 2004).

Chromatin changes related to epigenetic modifications significantly influence telomere and ITS stability (Gonzalo et al., 2006; Lin and Yan, 2008; Slijepcevic, 2016; Bolzán, 2017). Hypermethylation states help ITS stability, while demethylated or hypomethylated ITS tend to be unstable (Lin and Yan, 2008) favoring telomeric sequences recombination (Gonzalo et al., 2006). Still, the correct association of shelterin complex in ITS helps with chromatin stability, decreasing the unequal crossing-over events between telomeric sequences (Zakian, 1995; Mignon-Ravix et al., 2002; Yang et al., 2011; Bolzán, 2017) and, on the other hand, lacking one or more shelterin associations, the ITS instability increases (Slijepcevic, 2016; Lin and Yan, 2008).

Telomeres ensure the correct anchoring of chromosomes on the nuclear membrane internal surface, usually interacting with the nuclear lamin A/C protein, but ITS association with the nuclear matrix is unclear (Wood et al., 2014). On the other hand, ITS association with end chromosome telomere sequences described as Interstitial Telomeric Loops (ITLs) depend on the TRF2 and nuclear lamin A/C protein binding (Wood et al., 2015). The ITLs act in the telomere stability, gene expression regulation of closely located genes and ITL, and the interaction mechanism with the nuclear membrane (Robin et al., 2014, 2015; Wood et al., 2014, 2015; Robin and Magdinier, 2016).

The ITS/telomere interaction could result in chromosome rearrangements (Figure 8). This interaction was also proposed to cause terminal inversions, reshuffling the gene locations on the chromosomes, thus, promoting gene expression modifications (Robin et al., 2014, 2015; Wood et al., 2014, 2015; Robin and Magdinier, 2016; Bolzán, 2017). The ITLs organization far away from the chromosome ends also acts on the chromosome condensation during mitosis (Wood et al., 2014, 2015). Through all the features presented of the ITS/telomere association, it is evident that these structures are important for chromosomal remodeling (Wood et al., 2014, 2015; Bolzán, 2017).

Figure 8 -. Scheme representing the interstitial telomeric loop (ITL) interacting with interstitial telomere sequences (ITS). TRF2 could facilitate the association between ITL and ITS (yellow). This kind of interaction could generate DSBs, thus triggering chromosome rearrangements.

Perspectives

Characterizing the telomere motifs and structure is still necessary, mainly for several non-vertebrate groups. Advances in genome assembling in non-model organisms could figure out distinct telomeric motifs. In addition, the studies about chromosomal remodeling involving telomere sequences are incipient in lower vertebrates, besides a vast group of insects and other invertebrates. The participation of het-ITS in chromosome changes in these groups is emerging, but the data still need more robust information on DNA sequencing and epigenetic modifications. ITS trigger DSBs, transpositions, inversions, translocations, and Rb rearrangements in species groups with highly rearranged karyotypes, making the ITS and chromosome ends a central subject of the genomic instability. Thus, advances in ITS characterization are necessary. For that, the DNA sequence characterization over ITS segments, the recognition of telomeric proteins binding and loops formation between telomere and ITS, the evaluation of ITS types, and their epigenetic modifications, allied to in situ characterization, could illuminate the karyotype evolution in many groups.

Supplementary material

The following online material is available for this article: