Skip to main content
BMC Women's Health logoLink to BMC Women's Health
. 2022 Nov 24;22:471. doi: 10.1186/s12905-022-02075-4

Association study of Bif-1 gene expression with histopathological characteristics and hormone receptors in breast cancer

Kazhaleh Mohammadi 1, Mahdieh Salimi 2,, S Abdolhamid Angaji 3, Arthur Saniotis 4,5, Foroozandeh Mahjoobi 2
PMCID: PMC9701003  PMID: 36434659

Abstract

Background

Breast cancer is a heterogeneous disease that has various clinical outcomes. Bax-interacting factor-1 (Bif-1) is a member of the endophilin B family that generates the pro-apoptotic BCL2-Associated X (BAX) protein in response to apoptotic signals. Lack of Bif-1 inhibits the intrinsic pathway of apoptosis and enhancements the risk of tumor genesis. The present study aimed to investigate the relationship between hormone receptors (ER, PR, and HER2) status and different levels of Bif-1 gene expression in breast cancer patients.

Methods

Bif-1 gene expression was evaluated in 50 breast cancer tumors and 50 normal breast mammary tissues using the SYBR Green real-time RT-PCR technique. Multivariate and univariate analyses were used to appraise the relationship between the prognostic significance of the Bif-1 gene using SPSS software. In this study, the Bif-1 was selected as a candidate for a molecular biomarker and its expression status in breast cancer patients with hormone receptors (ER, RR, and HER2) compared to patients without these hormone receptors.

Results

The study showed that the relative expression of the Bif-1 gene in tissues of patients with hormone receptors in breast cancer compared to those without hormone receptors was not statistically significant. The expression levels of the Bif-1 gene in different groups were evaluated for hormone receptor status. No significant relationship was found between the Bif-1 gene expression and hormone receptors (ER, PR, and HER2) (p > 0.05).

Conclusion

Bif-1 gene expression may be a useful prognostic marker in breast cancer.

Keywords: Breast cancer, Bif-1, Gene expression, Real-time PCR, Biomarker

Background

Breast cancer (BC) is a complex heterogeneous disease due to a combination of genetic and epigenetic factors that eventually alter molecular and cellular processes consisting of proliferation, apoptosis, and angiogenesis [1, 2]. Breast cancer is the major cause of cancer death in women worldwide, with an estimated 2 million new cases diagnosed in 2018 [3]. As a consequence, BC is a major universal challenge [4].

Several studies have announced that BC is often triggered by an over-expression of biomarkers that are most commonly defined by estrogen-receptor (ER), progesterone receptor (PR), and Human Epidermal growth factor Receptor 2 (HER2) status. Estrogen-receptor and PR markers have been demonstrated to be important prognostic factors for endocrine therapy [5, 6], whereas, the HER2 gene facilitates the onset, growth, and metastasis of breast cancer [7]. There are several factors involved in cancer, containing tumor suppressor oncogenes and genes. Any variation from their normal activity may lead to unnecessary cell division and apoptotic evasion. Amongst these tumor suppressor genes is the BCL2-Associated X (BAX) interacting factor-1 (Bif-1) gene. The Bif-1 gene can induce autophagy, a process that can protect normal cells by conserving intracellular homeostasis [8]. This process of autophagy involves the interaction of Bif-1 with the protein Beclin-1 via the facilitation of Ultraviolet irradiation resistant-associated gene (UVRAG) that controls phosphatidylinositol 3-kinase complex 3 (PI3KC3) [9]. Contemporary therapies rely on the expression of ER and HER2 receptors for the treatment of Triple Negative Breast Cancer. Unfortunately, these have proven to be ineffectual for the treatment of metastatic carcinoma. Hence, there is a need for the development of new therapies based on molecular biomarkers that will be discussed. In the present study, Bif-1 was selected as a candidate for a molecular biomarker and its expression status in breast cancer patients with hormone receptors (ER, PR, HER2) compared to patients without these hormone receptors. Patients with breast carcinoma mostly have elevated sensitivity to hormone-based therapy if they have high PR and ER [10]. Researchers have long sought to develop primary diagnostic methods for recognizing cancer. Advances in the use of biomarkers have been effective in the diagnosis and treatment of breast cancer and have led to the application of some of these markers in patients. Popular methods for measuring biomarkers such as immunohistochemistry, immunocytochemistry, and ELISA are widely accepted and repeated methods in various laboratories [11]. However, the non-quantitative results and the innumerable and lengthy workflows are limitations of these techniques. Consequently, this has prompted researchers to search for alternative molecular methods such as Quantitative Real-Time PCR (Q-RT-PCR) that detect DNA amplification [1216]. The Q-RT-PCR technique is a rapid, cost-effective, and high-specificity assay for the assessment of gene expression [12]. Q-RT-PCR technique has significant potential in biomarker detection relating to mammaglobin (MGB) and metastasis of the lymph nodes [17]. For example, it has been recently shown that RT-PCR had a considerable diagnostic prediction for detecting mammaglobin biomarkers for lymph node metastasis in breast cancer patients [17].

Final verification of this method for use in diagnostic laboratories requires numerous validations including housekeeping genes. Several large-scale gene expression studies have been accomplished in which hundreds of housekeeping genes have been identified [1820].

Dysregulation of Bif-1 expression in cancer cells compared to adjacent healthy tissue, in many types of cancer including colorectal cancer [21], prostate [22], pancreatic cancer [23], invasive bladder cancer [24], and stomach cancer [25] have been observed. Decreased expression of Bif-1 in epithelial cells in malignant gastric cancer compared to normal mucosal cells suggests that loss of Bif-1 expression may play a role in gastric tumorigenesis by inhibiting Bif-1 mediated apoptosis [25]. On the other hand, Takahashi et al. showed in a study in 2007 that suppressing Bif-1 in mice promotes tumor progression [26]. In a study on colorectal cancer, it was seen that patients with low levels of Bif-1 in stages I and II of the disease have a lower chance of survival. This suggests that Bif-1 protein expression may be a useful prognostic marker in the early stages of colorectal cancer. Loss of the Bif-1 tumor suppressor gene is involved in various types of tumors and cancers [27].

In this study, the Bif-1 gene was selected as a candidate for a molecular biomarker and its expression in normal individuals and breast cancer patients was evaluated. The Bif-1 gene was examined according to its histopathological characteristics (stage and grade status) in patients’ tumors, as well as the expression status of hormonal receptors (ER, RR, HER2) which have prognostic value.

This study aimed to confirm the role of the Bif-1 gene as a predictor of breast cancer for better and proper management of training. Moreover, our study of molecular biomarkers, including the Bif-1 gene, could pave the way for biomarkers with therapeutic value shortly; second, it could lead to the production of effective drugs for the treatment of breast cancer patients and especially those patients with Triple Negative Breast Cancer.

Methods

Patient information

Totally, 100 samples of breast cancer patients, fifty cases relevant to breast tumor tissues (during primary diagnosis and without chemotherapy or radiation therapy at the time of sampling) along with 50 adjacent normal tumor specimens, from Milad and Khatam al-Anbia Hospitals, Tehran, Iran, were selected by following ethical rules in Helsinki Experimental Medical Studies (Declaration of Helsinki (DoH)). All the patients signed informed consent. The ethics code number is IR.NIGEB.EC.1395.11.10. I. The average age of studied patients was 50.0 ± 10.5 in the 30–70 age range (years). The inclusion criteria were the TNM classification system and post-operative diagnosis of primary BC based on histopathology. The characteristics of our studied patients are shown in Table 1. Overall survival (OS) was defined as the length of time from the date of primary diagnosis for patients with BC to the date of death from any cause. Disease-free survival (DFS) for patients with BC was defined as the time from the date of primary diagnosis to the recurrence of the tumor or the date of death. Samples were transferred (Transferred to the tank containing liquid nitrogen) to the National Institute of Genetic Engineering and Biotechnology, Tehran, Iran, under the principles of transfer and maintenance. Then, all achieved samples were preserved in a freezer at − 70 °C for < 2 h.

Table 1.

Baseline characteristics of breast cancer patients

Characteristic Number (%)
Number of patients 100
Age (years, mean ± SD) 50 ± 10.57691
Range 30–70
Cancer type
 Ductal carcinoma 32 (64%)
 Lobular carcinoma 10 (20%)
 Ductal and lobular carcinoma 5 (10%)
 Unknown 3 (6%)
Lymph node status
 N0 3 (6%)
 N+ 27 (54%)
 Nx 20 (40%)
Pathological stage
 Stage I 9 (18%)
 Stage II 36 (72%)
 Stage III 5 (10%)
Hormone-receptor status (IHC)
 ER and/or PR positive 35 (70%)
 ER and/or PR negative 9 (18%)
 Unknown 6 (12%)
HER-2 status (IHC)
 HER-2 positive 23 (46%)
 HER-2 negative 21 (42%)
 Unknowna 6 (12%)
 Triple Negative Breast Cancer (HER-2, PR, ER) 5 (10%)

aIn 6 of the studied patients, breast cancer stage was determined based on the old TNM classification system (before 2018). In these patients, based on the primary tumor size (T), the regional lymph nodes status (N) were taken into consideration by the attending physician. For this reason, the status of hormone receptors in these patients was reported to be unclear

RNA extraction and cDNA synthesis

Total RNA was isolated from the breast tissue using TriPure Isolation Reagent (Roche) solution according to the manufacturer’s protocol. cDNA was synthesized following the manufacturer’s instructions (Revert AID First strand cDNA synthesis Kit) and stored at − 20 °C until analyzed. The housekeeping gene β-actin, generally used in gene expression studies in breast cancer, was selected as an internal control. The expression stability of the β-actin gene data was evaluated to normalize the Bif-1 gene expression data. The primer sequences for β-actin and Bif-1 genes were designed using primer 3 software (https://primer3.ut.ee/) and then blasted using https://www.ncbi.nlm.nih.gov/tools/primer-blast/. The information on designed primer sequences is presented in Table 2. The duplication efficiency of each primer was determined using the standard curve of one-tenth of the cDNA serial dilutions using SPSS (LinReg, Statistical Package for Social Science IL, USA, V.16, SPSS Inc., Chicago) software. The cDNA used for serial dilution of a mixture of 15 tumor samples was equal in proportion.

Table 2.

Characteristics of primers used in real time RT-PCR reaction

Gene name Primer sequence Product size (bp) Annealing temperature
Bif-1 F:5′CTAGAGGGAATCAGCAGTACACATG3′ 174 60.74
R:5′AGGTGTCACAGAAGTCTGATTGTTG3′ 61.20
β-actin F:5′ GAGACCTTCAACACCCCAGCC 3′ 161 62.93
R:5′ AGACGCAGGATGGCATGGG 3′ 62.41

Tumor tissue samples and the tissue adjacent to the tumor lesion from patients were tested using Real-Time PCR. In this step, for normalization, the β-actin gene was used. In all, the expression of the β-actin gene in the normal tissue around the tumor was investigated. This was conducted to obtain control for distinguishing normal expression from overexpression of this gene.

The Real-time RT-PCR was done following the manufacturer’s instructions (Roche Applied SYBR Green I Master Mix Kit Science 480). The Real-time RT-PCR amplifications were conducted in a final volume of 10 μl reaction mixture containing 1 μl of cDNA, 2 μl 5 × master mix green (FastStart Taq DNA Polymerase, reaction buffer. dNTP MIX (with dUTP instead of dTTP), SYBR dTTP, SYBR Green 1 dye and Mgcl2), 0.3 μl (10 pmol/μl) of each primer and 6.4 μl sterilized water, using the Rotor-Gene Q System (QIAGEN Hilden, Germany). Table 3 shows the Real-time RT-PCR cycling conditions.

Table 3.

Real-time RT-PCR cycling conditions for Bif-1 and β-actin gene

Step Cycle number Temperature (C°) Duration
Primitive denatured 1 95 10'
Denatured 95 20''
Connecting primers 40 62 15''
Expansion of primers 72 15''
Melting stage or temperature gradient of 72 to 95 (C°) 1 95 5"

For each data point, all experiments were repeated three times. For the amplification efficiency determination of each primer pair, the ultraviolet spectrophotometer was used for assessing the linear standard curve (from 0.1 to 1000 ng). The acceptable linearity and amplification (100%) were revealed via the standard curves.

Bif-1 Expression in tumor and adjacent normal tissues in breast cancer patients

Tumor immune estimation resource (TIMER) (http://cistrome.shinyapps.io/timer) [28] was adopted to infer the differential expression between the tumor and adjacent normal tissues for the Bif-1 gene in breast cancer. As for protein level, the cProSite database (Cancer Proteogenomic Data Analysis Site), was used to compare the protein abundance of Bif-1 between tumor and normal adjacent tissues.

Bif-1(SHEGLB1) Expression and ICI

Tumor immune estimation resource (TIMER) also was used to infer the immune cell infiltration (ICI) and its relations with Bif-1 in breast cancer patients.

Statistical analysis

The raw data from Real Time RT-PCR were analyzed by LinRrg software and reproduction efficiency and CT numbers were obtained for each reaction. Next, the expression changes of the studied genes were evaluated by LinReg software using LinReg output. To obtain the difference in expression of the target genes and the reference gene, the Livak 2−ΔΔCT method was used [29]. Finally, the data analysis and statistical analysis were accomplished via SPSS software version 16 was used and as well as using the Kolmogorov Smirnov test, the normality of the achieved data was checked. Since the data distribution was not normal nonparametric tests such as Kruskal Wallis and the Mann–Whitney U tests were used for numerical data and to compare the expression of genes with response to treatment and clinical symptoms Chi-square test was performed. The confidence interval was 95% in all experiments and P < 0.05 was considered significant.

Results

Bif-1 expression and clinic pathological features

Bif-1 mRNA Expression

The aforementioned institute adhered to all ethical guidelines relating to biological banks for the preservation and use of human specimens. ER, PR, and HER2/neu biomarkers were evaluated in 44 patients, with positive or negative biomarkers, which are listed in (Table 1).

All the data as mentioned were normalized using β-actin as an internal control and normalizer and then presented relative to the average expression level in normal control breast tissue using the formula 2−ΔΔCT. RNA expression with two times or more was considered as overexpression, between 0.5 and 2 times as normal, and 0.5 times and less as down expression. Finally, 68% of the data showed the down expression (˂ 0.5), 20% the normal expression (0.5˂–˂2), and 12% the overexpression (2≤–˂10). In breast cancerous tissues compared with normal control, the Bif-1 mRNA expression was significantly downregulated (P < 0.01). In cancerous tissues compared with normal control, the mean of Bif-1 relative expression was 0.71 ± 1.03 with a range of 0.0001 to 3.98. About 68% of cancerous samples showed a relative expression of < 0.5 which was considered downregulation. The low average expression in tumor tissue compared to the adjacent normal tumor confirms the tumor suppressor function of the Bif-1 gene.

Bif-1 expression in tumor and adjacent normal tissues

On other hand, the differential expression between the tumor and adjacent normal tissues for the Bif-1 gene across all TCGA tumors using the DiffExp module in TIMER (Tumor IMmune Estimation Resource) database was achieved. Bif-1 gene expression levels has been distributed using box plots, with the statistical significance of differential expression evaluated using the Wilcoxon test. The current findings also showed that Bif-1 gene mRNA in breast normal tissues compared to breast cancerous tissues comprised a higher level of expression (Fig. 1).

Fig. 1.

Fig. 1

The differential expression between tumor and adjacent normal tissues for the Bif-1 gene across all TCGA tumors based on the DiffExp module in TIMER (Tumor IMmune Estimation Resource).In Tumor IMmune Estimation Resource, normal data for some types of cancer has been displayed in gray columns are available. In breast cancer patients, the Bif-1 expression level is highest in normal tissue and least in cancerous tissues

Bif-1 protein expression

As for protein level, the cProSite database (Cancer Proteogenomic Data Analysis Site), was used to compare the protein abundance of Bif-1 between tumor and normal adjacent tissues. The Bif-1 protein abundance in BC tissues compared to normal adjacent tissues was lower level (p  < 0.05, Fig. 2).

Fig. 2.

Fig. 2

Bif-1 protein expression in tumor and adjacent normal tissues in breast cancer patients based on cProSite database. Bif-1 protein abundance in BC tissues is lower than the normal adjacent tissues

Based on the Human Protein Atlas database, immunohistochemical staining of clinical specimens has identified that the Bif-1 expression level in BC tissues compared to adjacent normal tissues is lower (Fig. 3a–d).

Fig. 3.

Fig. 3

IHC analysis of Bif-1(SH3GLB1) in Breast cancer. ad Bif-1 protein expression level in normal tissue and duct & lobular carcinoma tissue has been detected based on human protein atlas database

In the present study also, the expression levels of the Bif-1 gene in different groups were evaluated as hormone receptor status, disease stage, lymph node involvement, different types of breast cancer and, tumor size states. No significant differences showed between other demographical and clinic pathological characteristics of breast cancer patients and Bif-1 expression (P > 0.05), as shown in Fig. 4.

Fig. 4.

Fig. 4

Average expression of the Bif-1 gene in different tumor groups. All data were normalized using β-actin as an internal control and normalizer and presented relative to the average expression level in normal control breast tissue using formula was 2−ΔΔCT. (ER; estrogen receptor, PR; progesterone receptor, HER2; Human epidermal growth factor 2, TN; Triple Negative, non-TN non; Triple Negative)

The current findings showed that there was no statistically significant relationship between Bif-1 gene expression and disease stage (p > 0.05) and lymph node involvement in breast cancer patients (p > 0.05). Alternatively, there was no statistically significant relationship between Bif-1 gene expression and different types of breast cancer (ductal, lobular, and ductal & lobular carcinoma) (p > 0.05). Regarding tumor size, 32 patients (64%) had a tumor equal to or more than two centimeters, and 18 patients (36%) had a tumor size less than two centimeters. According to the results of linear regression, there was no significant relationship between gene expression and tumor size in breast cancer patients (P > 0.05). Concerning hormone receptor status, our findings indicate that the expression of Bif-1 was increased in patients who have at least one hormone receptor. However, expression of the Bif-1 gene was reduced in patients with triple-negative hormone receptors. There was no statistically significant relationship between Bif-1 gene expression and all three hormone receptors (ER, PR, HER2) (P > 0.05).

Link between Bif-1 and ICIs

The correlation of Bif-1 gene expression with immune infiltration levels in breast cancer was achieved based on the Gene module in TIMER database (Fig. 5). The link between Bif-1 expression and ICIs was adjusted by purity, B cells, CD8+ T cells, CD4+ T cells, macrophages, neutrophils, and DCs and was studied by TIMER. In breast cancer, the results proved that Bif-1 expression was positively related to the infiltration of purity (r = − 0.176, 2.37e−08), B cells (r = 0.139, p = 1.32e−05), CD8+ T (r = 0.446, p = 8.65e−49), CD4+ T cells (r = 0.246, p = 1.13e−14), macrophages (r = 0.391, p = 2.57e−37), neutrophils (r = 0.399, p = 1.36e37), and DCs (r = 0.308, p = 2.43e−22).

Fig. 5.

Fig. 5

The link between Bif-1 expression and ICIs (B cells, CD8 + T cells, CD4 + T cells, macrophages, neutrophils, and DCs) in breast cancer patients based on TIMER databas

Discussion and conclusion

Cancer is the main cause of death in economically developed countries and the second cause of death in developing countries [30]. The World Health Organization estimates that cancer kills about seven million people worldwide every year [31]. Therefore, finding suitable treatment methods is one of the strategies of researchers to increase the survival of these patients, which is done by finding suitable markers to evaluate the results of treatment (prognostic factors) and also markers of response to treatment. In this study, Bif-1 gene expression (one of the genes involved in causing cancer) in breast cancer and its relationship with histopathological characteristics (stage) and tumor grade and hormone receptors (PR, ER, HER2) in patients with breast cancer, was investigated.

In the present study, the expression of Bif-1 at mRNA and protein levels was significantly decreased in BC tumors compared with normal control. Meanwhile, there was no association between the Bif-1 gene expression and lymphatic metastasis. In other hand, there was no statistically significant relationship between Bif-1 gene expression and estrogen(ER), progesterone(PR), and human epidermal growth factor receptor 2(HER2) hormone receptors.

Unfortunately, few studies have been conducted to quantitatively evaluate the expression of Bif-1, and some studies of Bif-1 gene activity, have been inconsistent. In addition, several studies have compared the expression of Bif-1 in patients' tumor cell lines with that of the control group [32]. We contend that this is not a tenable measure for evaluating both tumor tissue of patients and normal tissue samples. It should be noted that, for investigation, it is better to test the patient's tumor tissue sample and their adjacent normal tumor sample, and our results support this case.

To our knowledge, this study is the first to investigate the relationship between hormone receptor status (ER, PR HER2) and different levels of Bif-1 gene expression in patients with breast cancer. However, Bif-1 can also act as a tumor suppressor because of its role in regulating the BAX gene. Bif-1 accelerates BAX degradation directly by binding to BAX and enhancing apoptosis induction kinetics in response to innate apoptotic signals, thereby increasing the permeability of the mitochondrial outer membrane. Previous studies correspond with our findings, for example, Cuddeback et al. reported that the Bif-1 protein was silent in 17% (192.33 patients) of all prostate cancer patients. These findings indicate the activity of tumor suppression and pro-apoptotic Bif-1 [33]. Impaired expression of Bif-1 in cancer cells, compared to adjacent normal tissue, has been observed in various types of cancer, including colorectal cancer [21], prostate cancer [22], pancreatic cancer [23], invasive bladder cancer [24], and gastric cancer [25].

In another study, Coppola et al. found that Bif-1 lacked expression in approximately 45% of patients with malignant pancreatic cancer, but had a high level of expression in patients with benign pancreatic cancer [23]. Similarly, Fan et al., observed that patients with high Bif-1 expression compared to patients with low Bif-1 gene expression, had a shorter survival time, their study correlates Bif-1 expression to survival time [34].

Takahashi et al. showed that suppression of the Bif-1 gene in mice promoted tumor progression which corresponds with our study’s findings. In this study, it was observed that the Bif-1 gene expression decreased in patients with tumor size equal to or more than two centimeters, and vice versa, expression of this gene increased in patients with tumor size less than two centimeters. This result shows the induction function of the Bif-1 gene apoptosis [26].

As indicated before, having a reference method for examining the expression of this gene to study its role in the development of various cancers is necessary. Among the major methods of studying gene expression, the Real-Time RT-PCR technique provides the highest sensitivity and accuracy for determining the expression level. To study the expression of genes in clinical samples of patients, it is necessary to use a sensitive method (E.g. Real-Time RT-PCR technique), because the expression of genes in clinical samples is less than that of cell lines.

Conclusion

Until now, the information obtained from molecular markers has been inadequate, so identifying the convenient biomarkers in the evaluation of treatment response in patients with breast cancer is important. In all cancer cells, the Bif-1 gene has a low expression or is turned off (in 80% of cancers this gene has a low expression or is turned off) and Bif-1 has high expression in most normal cells. For this reason, the Bif-1 gene can be considered a promising target for the treatment of various types of cancer. Our findings note that the Bif-1 gene expression was downregulated in breast cancer patients and, its expression in both mRNA and protein levels. Therefore, the Bif-1 gene expression changes can be introduced as a strategic marker in breast cancer patients. Generally, increasing in the expression level of Bif-1 at the protein level is happen in line with the increase in mRNA level. In conclusion, our findings divulged that the Bif-1 gene expression change can be used as a clinically relevant prognostic indicator in breast cancer. Therefore, it is suggested that Bif-1 gene expression analyses may be important when making informed and individualized clinical decisions regarding the management of breast cancer patients. Considering the importance of this gene in breast cancer, it is expected that better and more favourable results can be obtained by using more samples. Therefore, more extensive research in this field with more samples as well as the examination of the expression of this gene in other tissues is suggested. In another way, to study the expression of genes in patients' clinical samples, it is necessary to use a sensitive method, since the expression of genes in clinical samples is less than in cell lines. Real-Time RT-PCR enables the highest sensitivity and accuracy for specifying the amount of expression. Therefore, due to the high sensitivity of the Real-Time RT-PCR method and in addition that the RNA and cDNA obtained from the cells can be stored and reused, it also seems to be faster and cheaper than the flow cytometry method. Consequently, an optimal way of evaluating Bif-1 gene activity at the mRNA level is to use Real-Time RT-PCR.

Acknowledgements

We thank all of the patients who used their tissue samples for this research and also the valuable contribution by Dr. Nafisi for providing patient tissue samples.

Author contributions

MS conceived of the presented idea. She developed the theory and performed the computations. SAA and KM verified the analytical methods. MS encouraged KM to investigate [investigation of the relationship between hormone receptors (ER, PR, HER2) status and different levels of Bif-1 gene expression] and supervised the findings of this work. FM contributed to sample preparation. MS, SAA and FM conceived and planned the experiments. KM experimented. KM developed the theoretical formalism, performed the analytic calculations, and performed the numerical simulations. MS, SAA, and KM contributed to the interpretation of the results. All authors discussed the results and contributed to the final manuscript. AS took the lead in writing the manuscript. KM and AS wrote the manuscript with support from MS, SAA, and FM. All authors read and approved the final manuscript.

Funding

None.

Availability of data and materials

All data used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

All the specimens were obtained by following ethical rules in Helsinki Experimental Medical Studies (Declaration of Helsinki (DoH). This study was approved by the ethics committee of the National Institute of Genetic Engineering and Biotechnology (NIGEB), IRAN (is IR. NIGEB.EC.1395.11.10. I). All the patients signed informed consent.

Consent for publication

Not applicable.

Competing interests

The authors declare that have no competing interests or other interests that might be perceived to influence the results and/or discussion reported in this paper.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Kazhaleh Mohammadi, Email: Kazhaleh.mohammadi@knu.edu.iq.

Mahdieh Salimi, Email: salimi@nigeb.ac.ir.

Arthur Saniotis, Email: arthur.saniotis@adelaide.edu.au.

References

  • 1.Mohammadi K, Salimi M, Angaji A, Mahjoobi F, Majidizadeh T. Bif-1 relative gene expression study in breast cancer tumor and normal adjacent tissues using real time PCR. SJIMU. 2017;25(3):138–146. doi: 10.29252/sjimu.25.3.138. [DOI] [Google Scholar]
  • 2.Harbeck N, Penault-Llorca F, Cortes J, Gnant M, Nehmat Houssami N, et al. Brain cancer. Nat Rev. 2019;5:66. doi: 10.1038/s41572-019-0111-2. [DOI] [PubMed] [Google Scholar]
  • 3.Matta M, Huybrechts I, Biessy C, Casagrande C, Yammine S, et al. BMC Med. 2021;19:81. doi: 10.1186/s12916-021-01952-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ferlay J, Colombet M, Soerjomataram I, Mathers C, Parkin DM, Piñeros M, et al. Estimating the global cancer incidence and mortality in 2018: GLOBOCAN sources and methods. Int J Cancer. 2019;144(8):1941–1953. doi: 10.1002/ijc.31937. [DOI] [PubMed] [Google Scholar]
  • 5.Mansouri H, Mnango LF, Magorosa EP, et al. Ki-67, p53 and BCL-2 expressions and their association with clinical histopathology of breast cancer among women in Tanzania. Sci Rep. 2019;9:9918. doi: 10.1038/s41598-019-46184-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Zhao X, Yang X, Fu L, Yu K. Associations of estrogen receptor, progesterone receptor, human epidemic growth factor receptor-2 and Ki-67 with ultrasound signs and prognosis of breast cancer patients. Cancer Manag Res. 2021;13:4579–4586. doi: 10.2147/CMAR.S276422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Shilova ON, Proshkina GM, Lebedenko EN, Deyev SM. Internalization and recycling of the HER2 receptor on human breast adenocarcinoma cells treated with targeted phototoxic protein DARPinminiSOG. Acta Naturae. 2015;7(3):126–132. doi: 10.32607/20758251-2015-7-3-126-132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gil J, Ramsey D, Szmida E, et al. The BAX gene as a candidate for negative autophagy-related genes regulator on mRNA levels in colorectal cancer. Med Oncol. 2017;34(2):16. doi: 10.1007/s12032-016-0869-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Eskandari E, Salimi M, Mahjoubi F. Up-regulation of Bax-interacting factor-1 in Iranian colorectal cancer patients. Basic Clin Cancer Res. 2018;10(2):25–32. [Google Scholar]
  • 10.Yan J, Liu XL, Han LZ, et al. Relation between Ki-67, ER, PR, Her2/neu, p21, EGFR, and TOP II-alpha expression in invasive ductal breast cancer patients and correlations with prognosis. Asian Pac J Cancer Prev. 2015;16(2):823–829. doi: 10.7314/APJCP.2015.16.2.823. [DOI] [PubMed] [Google Scholar]
  • 11.Manole E, Bastian A, Popescu I, et al. (2018). Immunoassay Techniques Highlighting Biomarkers in Immunogenetic Diseases. IntechOpen. b9135266486a147a2d2754a6c08f0b65f65b.pdf.
  • 12.Gheni N, Westenberg D. Quantitative real-time PCR assay with immunohistochemical evaluation of HER2/neu oncogene in breast cancer patients and its correlation with clinicopathological findings. Indian J Pathol Microbiol. 2020;63(Suppl S1):123–128. doi: 10.4103/IJPM.IJPM_136_19. [DOI] [PubMed] [Google Scholar]
  • 13.Look M, van Putten W, Duffy M, Harbeck N, Christensen IJ, Thomssen C, Kates R, Spyratos F, Fern M. Pooled analysis of prognostic impact of urokinase-type plasminogen activator and its inhibitor PAI-1 in 8377 breast cancer patients. Thromb Haemost. 2003;90:538–548. doi: 10.1160/TH-02-11-0264. [DOI] [PubMed] [Google Scholar]
  • 14.Foekens JA, Schmitt M, van Putten WL, Peters HA, Bontenbal M, Nicke JF, Klijn JGM. Prognostic value of urokinase-type plasminogen activator in 671 primary breast cancer patients. Cancer Res. 1992;52:6101–6105. [PubMed] [Google Scholar]
  • 15.Foekens JA, Peters HA, Look MP, Portengen H, Schmitt M, Kramer MD, Brünner N, Nicke JF, Gelder MEM-V, Henzen-Logmans SC. The Urokinase System of Plasminogen Activation and Prognosis in 2780 Breast Cancer Patients. Cancer Res. 2000;60:636–643. [PubMed] [Google Scholar]
  • 16.Benraad TJ, Geurts-Moespot J, Grøndahl-Hansen J, Schmitt M, Heuvel JJ, de Witte JH, Foekens J, Leake R, Brünner N, Sweep C. Immunoassays (ELISA) of Urokinase-type Masminogen Activator (u.PA): report of an EORTCIBIOMED-1 workshop. Eur J Cancer. 1996;32A(1371):81. doi: 10.1016/0959-8049(96)00118-9. [DOI] [PubMed] [Google Scholar]
  • 17.Monsalve-Lancheros A, Ibáñez-Pinilla M, Ramírez-Clavijo S. Detection of mammagloblin by RT-PCR as a biomarker for lymph node metastasis in breast cancer patients: a systematic review and meta-analysis. PLoS ONE. 2019;14(5):e0216989. doi: 10.1371/journal.pone.0216989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.de la Grange P, Dutertre M, Martin N, Auboeuf D. FAST DB: a website resource for the study of the expression regulation of human gene products. Nucleic Acids Res. 2005;33:4276–4284. doi: 10.1093/nar/gki738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Eisenberg E, Levanon EY. Humanhousekeeping genes are compact. Trends Genet. 2003;19:362–365. doi: 10.1016/S0168-9525(03)00140-9. [DOI] [PubMed] [Google Scholar]
  • 20.Hsiao LL, Dangond F, Yoshida T, Hong R, Jensen RV, Misra J, Dillon W, Lee KF, Clark KE, Haverty P. A compendium of gene expression in normal human tissues. Physiol Genomics. 2001;7:97–104. doi: 10.1152/physiolgenomics.00040.2001. [DOI] [PubMed] [Google Scholar]
  • 21.Coppola D, Khalil F, Eschrich SA, Boulware D, Yeatman T, Wang HG. Down-regulation of Bax-interacting factor-1 in colorectal adenocarcinoma. Cancer. 2008;113(2665):70. doi: 10.1002/cncr.23892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Coppola D, Oliveri C, Sayegh Z, Boulware D, Takahashi Y, Pow-Sang J, Djeu JY, Wang HG. Bax-interacting factor-1 (Bif-1) expression in prostate cancer. Clin Genitourin Cancer. 2008;6(117):21. doi: 10.3816/CGC.2008.n.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Coppola D, Helm J, Ghayouri M, Malafa MP, Wang HG. Down-regulation of Bax-interacting factor-1 (Bif-1) in human pancreatic ductal adenocarcinoma. Pancreas. 2011;40(433):7. doi: 10.1097/MPA.0b013e318205eb03. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kim SY, Oh YL, Kim KM, Jeong EG, Kim MS, Yoo NJ, Lee SH. Decreased expression of Bax-interacting factor-1 (Bif-1) in invasive urinary bladder and gallbladder cancers. Pathology. 2006;40:553–557. doi: 10.1080/00313020802320440. [DOI] [PubMed] [Google Scholar]
  • 25.Lee JW, Jeong EG, Soung YH, Nam SW, Lee JY, Yoo NJ, Lee SH. Decreased expression of tumour suppressor Bax-interacting factor-1 (Bif-1), a Bax activator, in gastric carcinomas. Pathology. 2013;38(312):5. doi: 10.1080/00313020600820880. [DOI] [PubMed] [Google Scholar]
  • 26.Takahashi Y, Coppola D, Matsushita N, Cualing HD, Sun M, Sato Y, Liang C, Jung JU, Cheng JQ, Mulé JJ, Pledger WJ, Wang HG. Bif-1 interacts with Beclin 1 through UVRAG and regulates autophagy and tumorigenesis. Nat Cell Biol. 2007;9(1142):51. doi: 10.1038/ncb1634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ko YH, Cho YS, Won HS, An HJ, Sun DS, Hong SU, Park JH, Lee MA. Stage-stratified analysis of prognostic significance of Bax-interacting factor-1 expression in resected colorectal cancer. Biomed Res Int. 2013;2013:329839. doi: 10.1155/2013/329839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Li T, Fan J, Wang B, et al. TIMER: a web server for comprehensive analysis of tumor-infiltrating immune cells. Can Res. 2017;77(21):e108–e110. doi: 10.1158/0008-5472.CAN-17-0307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Livak KJ, Flood SJ, Marmaro J, Giusti W. Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Appl J. 1995;4:357–362. doi: 10.1101/gr.4.6.357. [DOI] [PubMed] [Google Scholar]
  • 30.Pourhoseingholi MA, Zali MR. Colorectal cancer screening: Time for action in Iran. World Journal of Gastrointestinal Oncology. 2012;4:82. doi: 10.4251/wjgo.v4.i4.82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.American Cancer Society. Cancer facts & figures (2007). Retrieved on Apr 26, 2007.
  • 32.Coppola D, Khalil F, Eschrich S, Boulware D, Yeatman T, Wang H-G. Down Regulation of Bax-Interacting Factor-1 (Bif-1) in Colon Cancer. Cancer. 2008;113(10):2665–2670. doi: 10.1002/cncr.23892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Cuddeback SM, Yamaguchi H, Komatsu K, Miyashita T, Yamada M, Wu C, Singh S, Wang H-G. Molecular cloning and characterization of Bif-1. A novel Src homology 3 domain-containing protein that associates with Bax. J Biol Chem. 2001;276:20559–20565. doi: 10.1074/jbc.M101527200. [DOI] [PubMed] [Google Scholar]
  • 34.Fan R, Miao Y, Shan X, Qian H, Song C, Wu G, Chen Y, Zha W. Bif-1 is overexpressed in hepatocellular carcinoma and correlates with shortened patient survival. Oncol Lett. 2012;3(851):854. doi: 10.3892/ol.2012.562. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data used and/or analyzed during the current study are available from the corresponding author upon reasonable request.


Articles from BMC Women's Health are provided here courtesy of BMC

RESOURCES