Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Nov 1.
Published in final edited form as: Aquat Toxicol. 2022 Sep 23;252:106310. doi: 10.1016/j.aquatox.2022.106310

Symptomatic and asymptomatic domoic acid exposure in zebrafish (Danio rerio) revealed distinct non-overlapping gene expression patterns in the brain

Alia Hidayat 1,2,*, Kathi Lefebvre 3, James MacDonald 4, Theo Bammler 4, Neelakanteswar Aluru 2
PMCID: PMC9701550  NIHMSID: NIHMS1843337  PMID: 36198224

Abstract

Domoic acid (DA) is a naturally produced neurotoxin synthesized by marine diatoms in the genus Pseudo-nitzschia. DA accumulates in filter-feeders such as shellfish, and can cause severe neurotoxicity when contaminated seafood is ingested, resulting in Amnesic Shellfish Poisoning (ASP) in humans. Overt clinical signs of neurotoxicity include seizures and disorientation. ASP is a significant public health concern, and though seafood regulations have effectively minimized the human risk of severe acute DA poisoning, the effects of exposure at asymptomatic levels are poorly understood. The objective of this study was to determine the effects of exposure to symptomatic and asymptomatic doses of DA on gene expression patterns in the zebrafish brain. We exposed adult zebrafish to either a symptomatic (1.1 ± 0.2 μg DA/g fish) or an asymptomatic (0.31 ± 0.03 μg DA/g fish) dose of DA by intracelomic injection and sampled at 24, 48 and 168 h post-injection. Transcriptional profiling was done using Agilent and Affymetrix microarrays. Our analysis revealed distinct, non-overlapping changes in gene expression between the two doses. We found that the majority of transcriptional changes were observed at 24 hours post-injection with both doses. Interestingly, asymptomatic exposure produced more persistent transcriptional effects - in response to symptomatic dose exposure, we observed only one differentially expressed gene one week after exposure, compared to 26 in the asymptomatic dose at the same time (FDR <0.05). GO term analysis revealed that symptomatic DA exposure affected genes associated with peptidyl proline modification and retinoic acid metabolism. Asymptomatic exposure caused differential expression of genes that were associated with GO terms including circadian rhythms and visual system, and also the neuroactive ligand-receptor signaling KEGG pathway. Overall, these results suggest that transcriptional responses are specific to the DA dose and that asymptomatic exposure can cause long-term changes. Further studies are needed to characterize the potential downstream neurobehavioral impacts of DA exposure.

Keywords: Domoic acid, harmful algal bloom toxin, glutamate, excitotoxin

1. Introduction

DA is a potent neurotoxin naturally produced by some subspecies of the marine diatom Pseudo-nitzschia. DA accumulates in filter-feeders, including several commercially important shellfish, and can cause headache, disorientation, weakness, vomiting, diarrhea, and memory loss in human consumers (Perl et al., 1990). In very severe cases, exposure can lead to seizures, coma, and ultimately death (Perl et al., 1990). DA exerts its neuroexcitatory effect through high-affinity agonistic binding to kainate, AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid), and NMDA (N-methyl-D-aspartic acid) ionotropic glutamate receptors (Berman and Murray, 1997). This overstimulation results in excessive release of calcium ions, which can cause neuronal degeneration and brain damage. The combination of neuroexcitotoxic effects resulting from DA poisoning is called Amnesic Shellfish Poisoning (ASP), an illness that constitutes a significant public health concern. DA was first recognized as a seafood toxin in 1987 when consumption of contaminated mussels on Prince Edward Island, Canada caused 153 cases of acute intoxication and three deaths (Perl et al., 1990). DA poisoning also occurs in marine mammals and seabirds, resulting in recurring morbidity and mortality events (Bejarano et al., 2008; Goldstein et al., 2008; Scholin et al., 2000; Torres De La Riva et al., 2009; Work et al., 1993). In 2015, the North American west coast saw a record-breaking outbreak of Pseudo-nitzschia and losses of millions of dollars in subsequent fishery closures (McCabe et al., 2016). Since the first documented ASP event in 1987, seafood regulations have effectively minimized human risk of acute poisoning by limiting harvest of shellfish tissue to asymptomatic concentrations of < 20 μg DA/g tissue (Wekell et al., 2004). However, little is known about the long-term effects of chronic exposure to concentrations below regulatory limits. This knowledge gap is of particular concern for coastal and tribal communities that regularly consume shellfish containing low concentrations of DA (Ferriss et al., 2017; Lefebvre et al., 2019; Lefebvre and Robertson, 2010).

Effects of low-dose DA exposure have been demonstrated in various animal models. Recent studies in adult non-human primates (Macaca fascicularis) revealed that long term DA exposure at asymptomatic doses causes intentional tremors as well as changes in brain morphometry (Burbacher et al., 2019; Petroff et al., 2019). Studies in mice have demonstrated that long term low dose exposure to DA causes changes in activity and cognitive deficits (Lefebvre et al., 2017; Schwarz et al., 2014; Sobotka et al., 1996). However, the underlying gene expression changes associated with these neurobehavioral defects are not fully understood. In a previous study, we demonstrated that a single dose exposure to adult zebrafish was sufficient to impact gene expression in the brain at 6 hours post-DA injection, including the downregulation of genes involved in immune function, RNA processing, metabolism, signal transduction, and ion transport (Lefebvre et al., 2009). However, the long-term effects of a single exposure are unknown. Hence, the objectives of this study were to further investigate the long term effects of a single exposure to both symptomatic and asymptomatic DA concentrations on zebrafish brain. To this end, we conducted microarray analyses to assess brain gene expression changes after a single symptomatic and asymptomatic dose at 24, 48 and 168 hours post-exposure.

2. Materials and Methods

2.1. Experimental animals

Wild-type zebrafish (Danio rerio, AB strain), approximately five months of age, were obtained from Oregon State University (Sinnhuber Aquatic Research Laboratory Corvallis, OR). Fish were maintained at the Northwest Fisheries Science Center (NWFSC, Seattle, WA) in a ZebTec stand-alone recirculating and continuously-monitored zebrafish rack system with UV sterilizer (Techniplast, Exton, PA). Water temperature was maintained at 26°C, and fish were kept on a 12:12 hr light:dark cycle and fed daily with BioVita fish feed (Bio-Oregon, Longview, WA). The work was performed at the National Oceanic and Atmospheric Administration’s (NOAA) Northwest Fisheries Science Center (NWFSC). This federal agency does not have an IACUC. We followed guidelines used by the University of Washington’s IACUC, but all live zebrafish handling was performed at NOAA/NWFSC.

2.2. Experiment 1: Symptomatic domoic acid exposure

Adult zebrafish were exposed to domoic acid (DA) or an identical volume of vehicle (PBS) via intracoelomic (IC) injection at one year of age. DA was purchased from Sigma Chemical Corp. (St. Louis, MO). The dose of DA used in this experiment was 1.1 ± 0.2 μg /g fish. Dose standard deviations represent slight differences in individual fish body weights. Injections were of 10μL volume delivered with 33-gauge needle in a custom-made auto-injector from Hamilton® (Reno, NV). After each injection, fish were observed for 30-45 minutes to note the occurrence of any neurobehavioral excitotoxic signs (e.g., circle- or spiral-swimming). This is considered to be a “symptomatic dose” as these fish showed behavioral symptoms soon after injection, which were ameliorated within five minutes. Each treatment consisted of 10-12 individual fish (biological replicates) per time period. Zebrafish were euthanized via decapitation and brains were dissected at 24, 48 and 168 hours post-injection as described in Lefebvre et al. (2009). In summary, whole brains were surgically removed, rinsed in ice cold PBS, and flash frozen in liquid nitrogen.

2.3. Experiment 2: Asymptomatic DA exposure

Adult zebrafish were exposed to a 0.31 ± 0.03 μg/g dose of DA or an identical volume of vehicle (PBS) via IC injection at seven months of age. Exposures and sampling were done as described in Experiment 1. This dose produced no behavioral signs of excitotoxicity and is less than the EC50 of DA (0.86 μg/g) in zebrafish (Lefebvre et al., 2009). Each treatment consisted of 10-12 individual fish (biological replicates) per time period. Zebrafish were euthanized via decapitation and brains were dissected at 24, 48 and 168 hours post-injection as described in Lefebvre et al. (2009).

2.4. Dose validation

All doses were validated before injection via standard high-performance liquid chromatography-ultraviolet detection (HPLC-UV) detection methods as described previously (Lefebvre et al., 2009).

2.5. Total RNA isolation

Global transcriptome analysis was conducted using microarrays. Analysis was done on three RNA replicates per time point, each consisting of RNA from 3-4 pooled brains. Total RNA was isolated from zebrafish brains using the miRNeasy Mini Kit (Qiagen Inc., Valencia, CA) following manufacturer’s instructions, and stored at −70°C. RNA quantity and quality (OD260/280 and OD260/230 ratios) were determined using a NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA). RNA integrity was characterized using the Agilent RNA 6000 Nano Kit with an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). Only total RNA samples with RNA integrity numbers greater than 8 were used for microarray analysis.

2.6. Microarray analyses

Microarray analysis was conducted using Affymetrix GeneChip® Zebrafish Genome Arrays (Affymetrix, Inc. Santa Clara, CA) and Zebrafish (V3) Gene Expression Microarray (Agilent Technologies, Inc. Santa Clara, CA) in Experiments 1 (symptomatic exposure) and 2 (asymptomatic exposure), respectively. Array hybridization, processing and data analysis were done as previously described (Hiolski et al., 2014; Lefebvre et al., 2009).

Data analysis was conducted using Bioconductor (Gentleman et al., 2004). Affymetrix array data were normalized using a quantile normalization procedure and the probes were summarized for each probe set using the RMA algorithm (Irizarry et al., 2003), as implemented in the Bioconductor oligo package (Carvalho and Irizarry, 2010). Probe sets were first filtered to remove all control probe sets. We then filtered out probes that did not also appear on the Agilent array used for the asymptomatic DA dose, based on the NCBI Gene ID. This resulted in 9785 genes. Since some genes are measured more than once on this array, we present the average of any duplicated genes.

Agilent microarrays were preprocessed by doing background correction using the ‘normexp’ function (Ritchie et al., 2007). The data were normalized using a quantile normalization (Smyth and Speed, 2003) and any genes that were not also represented in the Affymetrix platform were filtered out of the dataset. A weighted analysis of variance (ANOVA) model was fit and all comparisons made using empirical Bayes adjusted contrasts using the Bioconductor limma package (Ritchie et al., 2015). Gene annotations were updated to the latest version of the zebrafish genome (GRCz11) by querying the probe sequences using standalone BLAST+ (Agilent arrays) or using BioMart (Affymetrix). All raw and processed data files are deposited in NCBI Gene Expression Omnibus database (GSE152814, and GSE34716 for symptomatic and asymptomatic samples, respectively).

Gene Ontology analysis (GO) of differentially expressed genes was performed for each comparison using the biological process (BP) ontology terms. We further determined the relationships between all significant GO terms by drawing directed acyclic graphs using WebGestalt (http://www.webgestalt.org/2017/GOView/). Only child terms (eg. a GO term closer to the leaf nodes of the graph than to the root) with a unique set of genes were considered.

Additionally, we conducted a cross-comparison analysis between the dose experiments to determine whether there were similarities in the GO terms and pathways enriched by each dose. Significant GO terms from the symptomatic analysis were tested in the asymptomatic dataset using a self-contained gene set test (the roast function from the Bioconductor limma package (Wu et al., 2010)) to determine whether there is evidence for significant enrichment of these pathways in the asymptomatic data. Similarly, significant GO terms from the asymptomatic analysis were tested against the symptomatic data. Pathway analysis of the differentially expressed genes (DEGs, FDR<0.05) was conducted using the Bioconductor SPIA package (Tarca, Kathri, and Draghici 2020). Significant KEGG pathways in the symptomatic set were tested for significance in the asymptomatic set and vice versa as described for the GO analysis.

2.7. Quantitative real time PCR

Complementary DNA (cDNA) was synthesized using the iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA). qPCR primers were designed using Amplify software (version 4; University of Wisconsin, Madison). The primer sequences, annealing temperature, amplicon size, and amplification efficiency of each primer are provided in Table 1. qPCR was performed using the CFX96 Touch™ Real Time System (Bio-Rad, Hercules, CA) with the following protocol: 1 cycle of 95°C for 3 min; 40 cycles of 95°C for 15 sec followed by 30 seconds at primer-specific annealing temperature (65-68°C, see Table 1). Immediately following the PCR protocol, melt curve analysis was conducted to determine the quality of the amplicon (1 cycle of 65°C for 5 sec; 80 cycles of 5 sec each starting at 65°C with a 0.5°C increment at each step up to 95°C). We normalized the expression of target genes by using the mean of two house-keeping genes (arnt2 and beta-actin). To account for variation in amplification efficiency (E), E−ΔCt values were calculated using the Pfaffl method, which does not assume 100% efficiency for all primer pairs (Pfaffl, 2002). Mann-Whitney tests were performed in PRISM 9.4.1 for Windows (GraphPad Software, San Diego, CA). Individual amplification efficiencies were calculated with LinRegPCR software (Ruijter et al., 2009).

Table 1. qPCR Primers Used in This Study.

Primer sequences (5’-3’), amplicon size (base pairs, bp), annealing temperature (Tm) and primer (amplification) efficiency of target and housekeeping genes are provided.

Gene Forward Primer Reverse Primer Amplicon
size (bp)
Tm
(°C)
Primer
Efficiency
calm3a TTCCCGAGTTCTTGACGATG TAGCCATTGCCGTCCTTATC 103 65 2.11
srrt CGGAGTCGGTCAAACGCTACAA CTTTGAGCGAAACCACTCTTCATCT 108 65 2.03
gale GCTTCAGGTCGAAAGATTGCATATC CTTCCAACCCAGCTCTTTCTC 104 65 1.88
pias4a GGAGGCCAATCAGAGATGATAAAG CGCCTCAGGAACACATATATCC 95 67 1.75
cry1bb GGAGGAGGGCATGAAGGTGTT ACAGTAACAGTGGAAGAACTGCTGG 120 68 1.85
neil1 ACTCCACACAGGGTTCTGAGCTT TTAGAAAGAACATTCTCCCTGAAGC 133 67 1.75
cpd-phr GGTAAAGGAATGCAAAAGCCTG GGAGATTCTAAGAGGGTTGAAATCG 132 67 1.75
arnt2 ATCGCAACACTGCTTTCGATGTG CAGCCTGCTGACTGTGATGTTGAC 117 67 1.88
β-actin CAACAGAGAGAAGATGACACAGAT CA GTCACACCATCACCAGAGTCCATCAC 140 65 1.73

3. Results

3.1. Symptomatic Exposure to DA

Symptomatic exposure of adult zebrafish to DA zebrafish caused time-dependent changes in gene expression. At 24 hours post-injection, 238 genes were differentially expressed (Fig. 1, Supplemental Fig. 1). Among them, 92 and 146 genes were up and down-regulated, respectively. In contrast, at 48 h only 35 genes were differentially expressed. Of the 35 DEGs observed at 48 h, 16 genes were upregulated and 19 were downregulated. Only one differentially expressed gene – oga (Glycoside hydrolase O-GlcNAcase) - was downregulated at 168 h post-exposure. No other genes were differentially expressed at this timepoint. Comparison of the DEGs at three different time points revealed very little overlap. There were only five genes shared between the 24 h and 48 h timepoints – hic1l (hypermethylated in cancer 1-like), foxg1b (forkhead box G1b), fkbp5 (FKBP prolyl isomerase 5), pik3r3a (phosphoinositide-3-kinase regulatory subunit 3a), and si:ch211-250g4.3.

Figure 1. Symptomatic and asymptomatic differentially expressed genes.

Figure 1.

Number of differentially expressed genes (DEGs) in adult zebrafish brain at 24, 48, and 1-week time points following exposure to A) a symptomatic dose (FDR <0.05) or B) an asymptomatic dose of DA (FDR <0.05). Venn Diagrams showing the number of overlapping DEGs between 24, 48, 168, and 6 h timepoints for the C) symptomatic dose and D) asymptomatic dose.

The majority of DEGs in this analysis did not overlap those in the zebrafish brain observed more immediately (6 hours) after exposure (Lefebvre et al., 2009). For the 24 h timepoint in the symptomatic dataset, 13 genes were shared: rbbp6 (retinoblastoma binding protein 6), ankrd12 (ankyrin repeat domain 12), pcdh2ac (protocadherin 2 alpha c), jak1 (janus kinase 1), phf2 (PHD finger protein 2), calm1a (calmodulin 1a), cadm3 (cell adhesion molecule 3), pik3r3a (phosphoinositide-3-kinase, regulatory subunit 3a (gamma)), scn8a (sodium channel, voltage gated, type VIII, alpha subunit a), slc16a9 (solute carrier family 16 member 9a), nipbl (NIPBL cohesin loading factor b), mical3 (microtubule associated monooxygenase, calponin and LIM domain containing 3a), and foxg1b. In the 48 h timepoint, five genes – rgs9b (regulator of G protein signaling 9b), igfbp1a (insulin-like growth factor binding protein 1a), slc4a1 (solute carrier family 4 member 1a), pik3r3a, and foxg1b – were differentially expressed in this analysis and in Lefebvre et al., 2009, respectively. Most of these genes were primarily associated with signal transduction pathways in the latter analysis.

Functional Classification of DEGs Using GO Annotations and KEGG Pathway Analysis

Functional annotation of DEGs at 24 h and 168 h post-exposure resulted in no significant GO terms (p-value < 0.01). DEGs at 48 h post-exposure were associated with the GO terms associated with protein modification, metabolism, and receptor signaling (Table 2). Of all significant child terms associated with symptomatic exposure at any timepoint, none were found to also be associated with asymptomatic exposure. KEGG pathway analysis revealed that DEGs at 24 h post-exposure enriched apelin signaling and oocyte meiosis pathways (Table 3).

Table 2: GO Term Enrichment of Symptomatic DEGs at 48 hours Post-Exposure.

GO terms found to be significantly enriched (p-value < 0.01) at 48 hours post-exposure to a symptomatic dose of DA. Only significant child terms are included. No GO terms were significantly enriched at the 24 and 168 h timepoints.

GO Term GO ID P-value FDR DEGs in GO term
Peptidyl-proline modification GO:0018208 <0.001 0.046 Egln3, p4ha1b, fkbp5
Protein hydroxylation GO:0018126 0.001 0.150 Egln3, p4ha1b
Vitamin metabolic process GO:0006766 0.003 0.150 Cyp26a1, mmadhcb
Retinoid metabolic process GO:0001523 0.003 0.150 Dhrs3a, cyp26a1
Cellular hormone metabolic process GO:0034754 0.004 0.150
Intracellular receptor signaling pathway GO:0030522 0.009 0.150
Monocarboxylic acid catabolic process GO:0072329 0.010 0.150 cyp26a1, hadhb
Table 3: KEGG Pathway Analysis of Symptomatic DEGs at 24 hours Post-Exposure.

KEGG pathways found to be significantly enriched (p-value < 0.1) at 24 hours post-exposure to an asymptomatic dose of DA. KEGG pathway analysis was conducted using the Bioconductor SPIA package. Asterisks indicate pathways that were also found to be significantly enriched among asymptomatic data. No KEGG pathways were found to be significantly enriched at the 48 and 168 h timepoints.

KEGG Pathway Pathway
ID
P-value DEGs in pathway
Apelin signaling pathway* 04371 0.046 Prkcea, calm3b, calm1a, gnai2a, pik3c3, notch3
Oocyte meiosis 04114 0.057 Calm3b, rps6kal, calm1a, pkmyt1, ppp2r1bb

3.2. Asymptomatic Exposure to DA

Comparison of individual time point DEGs revealed that 116 genes are differentially expressed at 24 h post-injection, 14 genes at 48 h post-injection, and 26 genes at 168 h post-injection (FDR<0.05; Fig. 1, Supplemental Fig. 1). Among the 116 DEGs at 24 h post-injection, 70 were upregulated and 46 downregulated. Whereas at 48 h, ten and four were up and downregulated, respectively. At 168 h post-injection, 11 and 15 genes were up and downregulated, respectively. Five genes were shared between the 24 and 168 h datasets – cry5 (cryptochrome circadian regulator 5), tcp11l2 (t-complex 11, testis-specific-like 2), cry-dash (cryptochrome DASH), cpdp (CPD photolyase), and bhlhe41 (basic helix-loop-helix family, member e41). Similar to the symptomatic set, there was little overlap with the asymptomatic DEGs at 6 h in Lefebvre 2009. Only two genes were shared between 6 h and 24 h – tob1b (transducer of ERBB2, 1b) and tcp11l2 – and two between 6 h and 168 h - tcp11l2 and nptx1l (neuronal pentraxin 1 like). No genes were shared at the 48 h timepoint.

Functional Classification of DEGs Using GO Annotations and KEGG Pathway Analysis

Functional annotation showed that the genes differentially expressed at 24 h are associated with GO terms associated with circadian rhythms, DNA modification, regulation of transcription, cell fate, and mitochondrial respiration (Table 4). At 48 h post-injection, enriched GO terms were associated with light sensing and phototransduction (Table 4). At 168 h post-injection, DEGs associated with GO terms including circadian rhythms, response to environmental insults, and transcription (Table 4). DEGs at 24 hours enriched the KEGG pathways cell cycle, protein processing in endoplasmic reticulum, neuroactive ligand-receptor interaction, and apoptosis (Table 5). At 48 and 168 hours, they enriched phototransduction and cytosolic DNA-sensing, respectively (Table 5).

Table 4: GO Term Enrichment of Asymptomatic DEGs.

GO terms found to be significantly enriched (p-value < 0.01) at 24, 48, or 168 hours post-exposure to an asymptomatic dose of DA. Asterisks indicate GO terms that were additionally found to be significantly enriched among asymptomatic data.

Time point (h) GO Term GO ID P-value DEGs in GO term
24 Circadian regulation of gene expression GO:0032922 0.001 Ciarta, bhlhe41, cry4, cry3a
DNA alkylation GO:0006305 0.001 Hells, dnmt3ba, gp9
DNA methylation or demethylation GO:0044728 0.001
Mitochondrial respiratory chain complex assembly* GO:0033108 0.003 Sdhaf3, cox17, ndufa4
Regulation of cell fate specification GO:0042659 0.002 Eve1, gp9, ace
Cell fate commitment involved in formation of primary germ layer GO:0060795 0.005
Regulation of gastrulation* GO:0010470 0.006
Negative regulation of catalytic activity* GO:0043086 0.006 Timp2a, spry2, sh3bp51a, mcl1a, mcm2
Entrainment of circadian clock by photoperiod GO:0043153 0.006 Cry5, cry3a
Negative regulation of transcription, DNA-templated GO:0045892 0.009 ciarta, bhlhe41, hes6, cry3a, atf4a, phc1, tbx18, sox9a, smad4a
Glycerolipid catabolic process GO:0046503 0.009 Lipg, pla2g4aa
Regionalization GO:0003002 0.009 bhlhe41, hes6, eve1, foxa3, tbx18, gp9, spry2, ace, smad4a
DNA repair* GO:0006281 0.010 Cpdp, cry5, cry-dash, xrcc1, xpc, mcm2, mms19
48 h Visual perception GO:0007601 <0.001 opn1lw1, pde6ha, opn1lw2, pde6a, cnga1a
Protein-chromophore linkage GO:0018298 <0.001 opn1lw1, opn1lw2
Phototransduction GO:0007602 <0.001
Cellular response to light stimulus GO:0071482 <0.001
G protein-coupled receptor signaling pathway GO:0007186 0.003 opn1lw1, gngt2a, opn1lw2
168 h Circadian regulation of gene expression GO:0032922 <0.001 Cry1a, bhlhe41, per2, cry5
Entrainment of circadian clock by photoperiod GO:0043153 <0.001 Cry1a, per2, cry5
Response to cold GO:0009409 0.001 bhlhe41, per2
Response to hydrogen peroxide GO:0042542 0.001 Cry1a, per2
Response to UV GO:0009411 0.001 Ddb2, per2
Negative regulation of transcription, DNA-templated GO:0045892 0.001 Cry1a, arntl1a, bmp2b, bhlhe41, per2
Cardiac muscle cell development GO:0055013 0.001 Bmp2b, sept15
Bicellular tight junction assembly GO:0070830 0.002 Cldni, cldn10l2
DNA repair GO:0006281 0.002 Ddb2, cry-dash, cpdp, cry5
Table 5: KEGG Pathway Analysis of Asymptomatic DEGs.

KEGG pathways found to be significantly enriched (p-value < 0.1) by differentially expressed genes at 24, 48, and 168 hours post-exposure to an asymptomatic dose of DA. KEGG pathway analysis was conducted using the Bioconductor SPIA package.

Timepoint KEGG Pathway PathwayID P-Value DEGs in pathway
24 h Cell cycle 04110 0.045 Smad4a, mad2l1, mcm2
Protein processing in endoplasmic reticulum 04141 0.053 rrbp1a, dnajc3a, atf4a, man1a1
Neuroactive ligand-receptor interaction 04080 0.089 sst1.1, vipr2, p2rx4a
Apoptosis 04210 0.094 map2k2a, mcl1a, atf4a
48 h Phototransduction 04744 <0.001 Opn1mw2, pde6a, cnga1a
168 h Cytosolic DNA-sensing pathway 04623 0.093 irf7

3.3. Comparison between Symptomatic and Asymptomatic Datasets

There was very little overlap between the asymptomatic and symptomatic gene sets. Only two genes were differentially expressed (FDR < 0.05) in both the 24 h asymptomatic and symptomatic datasets – vipr2 (vasoactive intestinal peptide receptor 2) and or115-1 (odorant receptor, family F, subfamily 115, member 1) – and none in the 48 h or 168 h datasets. Our cross-comparison analysis also revealed large differences in the GO terms and pathways enriched by symptomatic and asymptomatic exposure. In our self-contained gene set test using the significant GO and KEGG terms from the symptomatic analysis, we found evidence of significant enrichment of the Apelin signaling pathway in the asymptomatic dataset (Table 3). In the reverse test using the GO terms from the asymptomatic analysis, mitochondrial respiratory chain complex assembly, regulation of gastrulation, negative regulation of catalytic activity, and DNA repair were all significantly enriched in the symptomatic dataset at 24 hours. None of the asymptomatic GO terms were also found to be enriched in the symptomatic dataset at 48 and 168 hours.

3.4. Quantitative PCR Validation

We validated microarray results for seven randomly selected genes – calm3a (calmodulin 3), srrt (serrate RNA effector molecule homolog), gale (UDP-galactose-4-epimerase), and pias4a (protein inhibitor of activated STAT 4a), neil (nei-like DNA glycosylase 1), cry1bb (cryptochrome 3b), and cpd-phr (CPD photolyase) - using quantitative reverse transcriptase (qRT)-PCR. Amplification efficiency of the primers varied between 1.725-2.114 (Table 1). At the 24 hr post-injection time point, genes srrt, gale, neil1, and cpd-phr were upregulated in response to DA exposure, confirming microarray results (Fig. 2, Supplemental Table 1). Additionally, pias4a was not significantly differentially regulated, also concurring with microarray results. At 48 hours, genes calm3a, neil1, cry1bb, and cpd-phr agreed with microarray results, showing no significant differential expression. At 168 hours, four out of the seven genes (calm3a, srrt, gale, and pias4a) concurred with microarray results. Disagreement with our microarray results may be due to various technical factors previously identified (Freeman et al., 1999; Morey et al., 2006; Yang et al., 2002).

Figure 2. Quantitative PCR validation of asymptomatic microarray data.

Figure 2.

Plots of log-fold change and standard error values for microarray and qPCR at 24, 48, and 168 hours post-exposure for seven select genes: calm3a, srrt, gale, pias4a, neil1, cry1bb, and cpd-phr. Blue bars represent microarray data, red bars represent qRT-PCR data.

4. Discussion

4.1. Gene expression changes resulting from asymptomatic exposure are distinct from and appear to persist longer than those from symptomatic exposure

One major finding from this analysis is that symptomatic and asymptomatic doses produced functionally distinct changes in gene expression, consistent with previous studies (Hiolski et al., 2014; Lefebvre et al., 2009). For both doses, there was very little overlap in the differentially expressed genes, GO terms, and KEGG pathways that were enriched across time points, which corroborates previous studies reporting large time-dependent differences in the gene expression profiles of zebrafish exposed to DA (Hiolski et al., 2014; Lefebvre et al., 2009). Interestingly, we found more DEGs at 168 hours in the asymptomatic set than in the symptomatic set, suggesting that the effects of asymptomatic DA exposure may persist longer than those of symptomatic exposure. The observed attenuation of gene expression changes by 168 h in the symptomatic set suggests that, while this dose produces behavior associated with acute neurotoxicity, individuals may be able to recover following acute exposure without long-term changes to the transcriptome.

4.2. Both asymptomatic and symptomatic DA exposure alter genes involved in mitochondrial function

Both doses showed differential expression of genes associated with mitochondrial function at 24 h post-exposure, though these genes were not the same between doses. DA-induced mitochondrial dysfunction has been previously demonstrated in mice (Lu et al., 2012) and zebrafish (Hiolski et al., 2014). Acute high-dose DA exposure causes neuron death by excess influx of Ca2+, which can be taken up by mitochondria through mcu (mitochondrial calcium uniporter) (De Stefani et al., 2011). At 24 h, mcu was upregulated in the symptomatic dataset. Mitochondrial uptake of Ca2+ modulates increases in cytosolic Ca2+ following glutamate insults (Wang and Thayer, 1996), however, this uptake has also been shown to drive neuronal death (Schinder et al., 1996; Stout et al., 1998). At the same timepoint, the symptomatic dose downregulated genes encoding mitochondrial ribosome proteins (mrpl1, mrpl30, mrpl47, and mrpl52). Effects on mitochondrial ribosomal genes may alter protein synthesis, particularly of proteins involved in energy conversion and ATP production (Greber and Ban, 2016). One previous study has found that chronic low-level DA exposure resulted in a reduction of maximum mitochondrial respiration rates in zebrafish, as well as a compensatory increase in mitochondrial biogenesis (Hiolski et al., 2014). Additionally, in our asymptomatic dataset, we found differential expression of genes in mitochondrial respiratory chain complex assembly - sdhaf3 (succinate dehydrogenase complex assembly factor 3), cox17 (cytochrome c oxidase copper chaperone), and ndufa4 (NDUFA4 mitochondrial complex associated) - at 24 h, which may reflect changes in ATP production. These findings suggest that mitochondria may be a target of DA excitotoxicity at both asymptomatic and symptomatic doses.

4.3. Symptomatic DA exposure may affect CNS through post-translational modifications and changes to retinoic acid metabolism

DA exposure has been demonstrated to cause cognitive deficits in rodents (Kuhlmann and Guilarte, 1997; Lefebvre et al., 2017; Petrie et al., 1992) and humans (Grattan et al., 2018, 2016), which have been attributed to acute hippocampal neuron loss. Our results suggest that several pathways critical for neuronal health are enriched following symptomatic DA exposure, including apelin signaling. Apelin signaling regulates angiogenesis, vasodilation, and constriction via the activation of calmodulins (Helker et al., 2020), two of which - calm3b and calm1a are differentially expressed in this study (Chapman et al., 2014). Furthermore, certain apelins are neuroprotective of cortical neurons by alleviating the increase in intracellular Ca2+ caused by NMDA-mediated neurotoxicity (Cheng et al., 2012) and by modulating NMDAR activity (Cook et al., 2011).

At 48 h, we observed enrichment of the GO term peptidyl proline modification, a type of non-covalent post-translational modification that can affect neuron health and function. Among the genes that enriched this GO term was egln3 (egl-9 family hypoxia-inducible factor 3), which encodes an enzyme that regulates neuronal apoptosis and was downregulated in this analysis (Lee et al., 2005). fkbp5 (FKBP prolyl isomerase 5) - a glucocorticoid receptor chaperone that plays a role in the stress response and is a risk factor for a number of psychiatric diseases (Zannas et al., 2016) - was also downregulated in our analysis, consistent with previous analysis of zebrafish brains chronically exposed to DA (Hiolski et al., 2014). Overexpression of FKBP5 protein in mice impairs spatial learning by altering AMPA receptor recycling and glutamatergic transmission (Blair et al., 2019). Previous studies have shown DA-induced changes to long term potentiation (LTP) (Qiu et al., 2009), a synaptic mechanism mediated by AMPARs and that underlies learning. These changes in post-translational modification represent one potential avenue by which DA may alter neuronal health, learning, and memory.

Symptomatic DA exposure at 48 h may also cause changes in retinoic acid metabolism. We observed downregulation of cyp26a1 (cytochrome P450 family 26 subfamily A member 1, a retinoic acid metabolizing enzyme) and other genes. cyp26a1 maintains proper signaling during CNS development by attenuating retinoic acid (RA) expression (Emoto et al., 2005; Rydeen et al., 2015). Dhrs3a (dehydrogenase/reductase (SDR family) member 3a), another gene that regulates RA biosynthesis in the CNS (Feng et al., 2010), was also downregulated. Disruption of retinoid signaling during development has been shown to have persistent behavioral effects, including decreased social affiliation in adult zebrafish (Bailey et al., 2016). Studies in other models suggest that in adulthood, RA is involved in neuron differentiation, regeneration, and synaptic plasticity, and that abnormal RA levels may contribute to nervous system dysfunction (Maden, 2007; Mey and McCaffery, 2004).

4.4. Asymptomatic DA exposure results in changes to circadian rhythm, the visual system, and various neuroactive ligand signaling pathways.

Circadian rhythms entrain the fluctuation of various physiological processes with various environmental cues, most notably light. Disruptions in rhythmicity are associated with cognitive dysfunction, and recent studies have shown circadian rhythms regulate synaptic plasticity and memory formation (Hartsock and Spencer, 2020; Krishnan and Lyons, 2015). We found enrichment of the GO term “circadian regulation of gene expression” at 24 and 168 h following exposure. Glutamate is the primary neurotransmitter involved in transmitting light signals to the superchiasmatic nucleus, which acts as a central pacemaker to regulate circadian rhythms in mammals (Castel et al., 1993; Ding et al., 1994). Since DA binds with high-affinity to glutamate receptors, it is possible that exposure could disrupt downstream processes that are dependent on glutamatergic signaling, including circadian rhythm regulation. Zebrafish per2 (period circadian clock 2) and cry1a (cryptochrome circadian regulator 1a) - two genes that were downregulated at 168 h in our analysis - help establish rhythmic gene expression (Tamai et al., 2007; Wang et al., 2015). Knockdown of cry1a and per2 has been demonstrated to cause defective synchronization of cellular clocks, disruption of behavioral rhythms, and impaired cellular metabolism in zebrafish larvae (Hirayama et al., 2019).

In addition, we observed differential expression of genes associated with multiple neuroactive ligand-receptor interactions, including sst1.1 (somatostatin1.1), vipr2 (vasoactive intestinal peptide receptor 2) and p2rx4a (purinergic receptor P2X, ligand-gated ion channel, 4a). All these genes have been implicated in the modulation of various CNS functions, including immune regulation (Patel, 1999; Suurväli et al., 2017; Waschek, 2013). DA has been shown to induce microglial activation in in vitro culture and in rat brain (Ananth et al., 2001; Mayer et al., 2001) and induce antibody response in humans, zebrafish, and sea lions. (Lefebvre et al., 2019, 2012). In California sea lions diagnosed with domoic acid toxicosis, upregulation of the inflammatory cytokine tnfa (tumor necrosis factor alpha) has been observed (Mancia et al., 2012). Given the critical role of the neuroimmune system in health, these findings highlight the need for further studies on the immune system as a potential target of DA.

Additionally, both KEGG and GO term analyses suggest modifications to the visual system 48 hours post-exposure. Multiple genes involved in the GO term visual perception were upregulated, including two opsins (opn1lw1 and opn1lw2) and two photoreceptor phosphodiesterases (pde6ha and pde6a). In zebrafish, visual sensitivity and expression of opsin and phosphodiesterase genes vary with circadian oscillations (Abalo et al., 2020). One question this analysis raises is whether DA-induced changes in circadian rhythm might lead to downstream effects on visual acuity or vice versa, and if so, what practical effects this might have on behavior. Many zebrafish behaviors are reliant on visual perception, including prey capture, predator avoidance, and visual startle response (Neuhauss, 2003). Further studies should take advantage of the many behavioral assays available in the zebrafish model to assess the effect of DA on these endpoints (Neuhauss, 2003).

4.5. Relevance to Human Exposures

Consumption of DA at concentrations below regulatory limits occurs in certain human populations and is associated with memory deficits (Grattan et al., 2018, 2016). Understanding the risks associated with low-dose exposure is critical for establishing consumption guidelines and regulations that protect from adverse health effects. We demonstrate that, surprisingly, asymptomatic exposure produces transcriptomic changes that persist longer and are distinct from symptomatic exposure. It further identifies potential mechanisms that could underly observed cognitive deficits associated with low-dose exposure – namely effects on neuroactive ligand signaling in the immune system and circadian rhythms. These processes are critical for proper CNS function and further research should be conducted to understand their role in mediating DA toxicity.

5. Conclusions

Our analyses demonstrate that a single exposure to DA at symptomatic and asymptomatic doses produce unique transcriptional changes. While transcriptional changes were attenuated by one week in the symptomatic set, asymptomatic exposure caused significant gene expression changes through the one-week time point, suggesting that asymptomatic exposure to DA may result in more persistent effects. Our findings emphasize the need for further studies on asymptomatic exposure to determine its unique health impacts. Additional investigation on these transcriptional effects of acute DA exposure at both doses are required to determine downstream neurological impacts. One limitation of this study is the use of two different microarray platforms for the two analyses (Affymetrix for the symptomatic exposure and Agilent for the asymptomatic). To address this, we restricted our analysis to only the genes that were common to the two platforms, and used a gene set test for the comparison analysis.

Supplementary Material

Supplementary material

6. Acknowledgements

Support for this research was provided by NIEHS P30 ES007033, an NSF GRFP (112374), NIH R01s ES021930 and ES030319 (to KL and David Marcinek University of Washington), NSF R01s OCE-1314088 and OCE-1839041 (to KL and David Marcinek University of Washington), and an Internal Grant from NOAA Northwest Fisheries Science Center (to KL). Additional support was provided by the Woods Hole Center for Oceans and Human Health (NIH P01ES028938 and NSF 1840381), and we would like to thank Dr. John Stegeman and Dr. Mark Hahn for their work in obtaining this funding.

Footnotes

7.

CRediT Author Statement

Alia Hidayat: Validation, Formal analysis, Writing – Original draft preparation, Visualization. Kathi A. Lefebvre: Conceptualization, Methodology, Investigation, Resources, Writing – Review and Editing, Project administration, Funding acquisition. James MacDonald: Formal analysis, Writing – Review and Editing, Data curation. Theo Bammler: Formal analysis, Writing – Review and Editing, Data curation. Neelakanteswar Aluru: Supervision, Writing – Review and Editing.

8. References

  1. Abalo XM, Lagman D, Heras G, del Pozo A, Eggert J, Larhammar D, 2020. Circadian regulation of phosphodiesterase 6 genes in zebrafish differs between cones and rods: Implications for photopic and scotopic vision. Vision Res. 166, 43–51. 10.1016/J.VISRES.2019.11.001 [DOI] [PubMed] [Google Scholar]
  2. Ananth C, Thameem Dheen S, Gopalakrishnakone P, Kaur C, 2001. Domoic acid-induced neuronal damage in the rat hippocampus: Changes in apoptosis related genes (Bcl-2, Bax, caspase-3) and microglial response. J. Neurosci. Res 66, 177–190. 10.1002/jnr.1210 [DOI] [PubMed] [Google Scholar]
  3. Bailey JM, Oliveri AN, Karbhari N, Brooks RAJ, Rocha A.J.D. La, Janardhan S, Levin ED, 2016. Persistent behavioral effects following early life exposure to retinoic acid or valproic acid in zebrafish. Neurotoxicology 52, 23. 10.1016/J.NEURO.2015.10.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bejarano AC, Gulland FM, Goldstein T, St Leger J, Hunter M, Schwacke LH, VanDolah FM, Rowles TK, 2008. Demographics and spatio-temporal signature of the biotoxin domoic acid in California sea lion (Zalophus californianus) stranding records. Mar. Mammal Sci 24, 899–912. 10.1111/j.1748-7692.2008.00224.x [DOI] [Google Scholar]
  5. Berman FW, Murray TF, 1997. Domoic acid neurotoxicity in cultured cerebellar granule neurons is mediated predominantly by NMDA receptors that are activated as a consequence of excitatory amino acid release. J. Neurochem 69, 693–703. [DOI] [PubMed] [Google Scholar]
  6. Blair LJ, Criado-Marrero M, Zheng D, Wang X, Kamath S, Nordhues BA, Weeber EJ, Dickey CA, 2019. The disease-associated chaperone FKBP51 impairs cognitive function by accelerating AMPA receptor recycling. eNeuro 6. 10.1523/ENEURO.0242-18.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Burbacher TM, Grant KS, Petroff R, Shum S, Crouthamel B, Stanley C, McKain N, Jing J, Isoherranen N, 2019. Effects of oral domoic acid exposure on maternal reproduction and infant birth characteristics in a preclinical nonhuman primate model. Neurotoxicol. Teratol 72, 10–21. 10.1016/j.ntt.2019.01.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Carvalho BS, Irizarry RA, 2010. A framework for oligonucleotide microarray preprocessing. Bioinformatics 26, 2363–7. 10.1093/bioinformatics/btq431 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Castel M, Belenky M, Cohen S, Ottersen OP, Storm-Mathisen J, 1993. Glutamate-like Immunoreactivity in Retinal Terminals of the Mouse Suprachiasmatic Nucleus. Eur. J. Neurosci 5, 368–381. 10.1111/j.1460-9568.1993.tb00504.x [DOI] [PubMed] [Google Scholar]
  10. Chapman NA, Dupré DJ, Rainey JK, 2014. The apelin receptor: physiology, pathology, cell signalling, and ligand modulation of a peptide-activated class A GPCR1. 10.1139/bcb-2014-0072 92, 431–440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cheng B, Chen J, Bai B, Xin Q, 2012. Neuroprotection of apelin and its signaling pathway. Peptides 37, 171–173. 10.1016/J.PEPTIDES.2012.07.012 [DOI] [PubMed] [Google Scholar]
  12. Cook DR, Gleichman AJ, Cross SA, Doshi S, Ho W, Jordan-Sciutto KL, Lynch DR, Kolson DL, 2011. NMDA Receptor Modulation by the Neuropeptide Apelin: Implications for Excitotoxic Injury. J. Neurochem 118, 1113. 10.1111/J.1471-4159.2011.07383.X [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. De Stefani D, Raffaello A, Teardo E, Szabó I, Rizzuto R, 2011. A forty-kilodalton protein of the inner membrane is the mitochondrial calcium uniporter. Nature 476, 336–340. 10.1038/nature10230 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ding JM, Chen D, Weber ET, Faiman LE, Rea MA, Gillette MU, 1994. Resetting the biological clock: Mediation of nocturnal circadian shifts by glutamate and NO. Science (80-.) 266, 1713–1717. 10.1126/science.7527589 [DOI] [PubMed] [Google Scholar]
  15. Emoto Y, Wada H, Okamoto H, Kudo A, Imai Y, 2005. Retinoic acid-metabolizing enzyme Cyp26a1 is essential for determining territories of hindbrain and spinal cord in zebrafish. Dev. Biol 278, 415–427. 10.1016/j.ydbio.2004.11.023 [DOI] [PubMed] [Google Scholar]
  16. Feng L, Hernandez RE, Waxman JS, Yelon D, Moens CB, 2010. Dhrs3a Regulates Retinoic Acid Biosynthesis through a Feedback Inhibition Mechanism. Dev. Biol 338, 1. 10.1016/J.YDBIO.2009.10.029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ferriss BE, Marcinek DJ, Ayres D, Borchert J, Lefebvre KA, 2017. Acute and chronic dietary exposure to domoic acid in recreational harvesters: A survey of shellfish consumption behavior. 10.1016/j.envint.2017.01.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Freeman WM, Walker SJ, Vrana KE, 1999. Quantitative RT-PCR: Pitfalls and Potential. Biotech. 26, 112–125. [DOI] [PubMed] [Google Scholar]
  19. Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B, Gautier L, Ge Y, Gentry J, Hornik K, Hothorn T, Huber W, Iacus S, Irizarry R, Leisch F, Li C, Maechler M, Rossini AJ, Sawitzki G, Smith C, Smyth G, Tierney L, Yang JYH, Zhang J, 2004. Bioconductor: open software development for computational biology and bioinformatics. Genome Biol. 5, R80. 10.1186/gb-2004-5-10-r80 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Goldstein T, Mazet JAK, Zabka TS, Langlois G, Colegrove KM, Silver M, Bargu S, Van Dolah F, Leighfield T, Conrad PA, Barakos J, Williams DC, Dennison S, Haulena M, Gulland FMD, 2008. Novel symptomatology and changing epidemiology of domoic acid toxicosis in California sea lions (Zalophus californianus): An increasing risk to marine mammal health. Proc. R. Soc. B Biol. Sci 275, 267–276. 10.1098/rspb.2007.1221 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Grattan LM, Boushey C, Tracy K, Trainer VL, Roberts SM, Schluterman N, Morris JG, 2016. The association between razor clam consumption and memory in the CoASTAL cohort. Harmful Algae 57, 20–25. 10.1016/J.HAL.2016.03.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Grattan LM, Boushey CJ, Liang Y, Lefebvre KA, Castellon LJ, Roberts KA, Toben AC, Morris JG, 2018. Repeated dietary exposure to low levels of domoic acid and problems with everyday memory: Research to public health outreach. Toxins (Basel). 10. 10.3390/toxins10030103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Greber BJ, Ban N, 2016. Structure and Function of the Mitochondrial Ribosome. Annu. Rev. Biochem 85, 103–132. 10.1146/annurev-biochem-060815-014343 [DOI] [PubMed] [Google Scholar]
  24. Hartsock MJ, Spencer RL, 2020. Memory and the circadian system: identifying candidate mechanisms by which local clocks in the brain may regulate synaptic plasticity. Neurosci. Biobehav. Rev 118, 134. 10.1016/J.NEUBIOREV.2020.07.023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Helker CSM, Eberlein J, Wilhelm K, Sugino T, Malchow J, Schuermann A, Baumeister S, Kwon HB, Maischein HM, Potente M, Herzog W, Stainier DYR, 2020. Apelin signaling drives vascular endothelial cells towards a pro-angiogenic state. Elife 9, 1–44. 10.7554/ELIFE.55589 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hiolski EM, Kendrick PS, Frame ER, Myers MS, Bammler TK, Beyer RP, Farin FM, Wilkerson H.-W. wen, Smith DR, Marcinek DJ, Lefebvre KA, 2014. Chronic low-level domoic acid exposure alters gene transcription and impairs mitochondrial function in the CNS. Aquat. Toxicol 155, 151–9. 10.1016/j.aquatox.2014.06.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Hirayama J, Alifu Y, Hamabe R, Yamaguchi S, Tomita J, Maruyama Y, Asaoka Y, Nakahama K, Tamaru T, Takamatsu K, Takamatsu N, Hattori A, Nishina S, Azuma N, Kawahara A, Kume K, Nishina H, 2019. The clock components Period2, Cryptochrome1a, and Cryptochrome2a function in establishing light-dependent behavioral rhythms and/or total activity levels in zebrafish. Sci. Reports 2019 91 9, 1–15. 10.1038/s41598-018-37879-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U, Speed TP, 2003. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4, 249–264. 10.1093/biostatistics/4.2.249 [DOI] [PubMed] [Google Scholar]
  29. Krishnan HC, Lyons LC, 2015. Synchrony and desynchrony in circadian clocks: impacts on learning and memory. Learn. Mem 22, 426. 10.1101/LM.038877.115 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kuhlmann AC, Guilarte TR, 1997. The peripheral benzodiazepine receptor is a sensitive indicator of domoic acid neurotoxicity. Brain Res. 751, 281–288. 10.1016/S0006-8993(96)01409-6 [DOI] [PubMed] [Google Scholar]
  31. Lee S, Nakamura E, Yang H, Wei W, Linggi MS, Sajan MP, Farese RV, Freeman RS, Carter BD, Kaelin WG, Schlisio S, 2005. Neuronal apoptosis linked to EglN3 prolyl hydroxylase and familial pheochromocytoma genes: Developmental culling and cancer. Cancer Cell 8, 155–167. 10.1016/j.ccr.2005.06.015 [DOI] [PubMed] [Google Scholar]
  32. Lefebvre KA, Frame ER, Gulland F, Hansen JD, Kendrick PS, Beyer RP, Bammler TK, Farin FM, Hiolski EM, Smith DR, Marcinek DJ, 2012. A novel antibody-based biomarker for chronic algal toxin exposure and sub-acute neurotoxicity. PLoS One 7, e36213. 10.1371/journal.pone.0036213 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Lefebvre KA, Kendrick PS, Ladiges W, Hiolski EM, Ferriss BE, Smith DR, Marcinek DJ, 2017. Chronic low-level exposure to the common seafood toxin domoic acid causes cognitive deficits in mice. Harmful Algae 64, 20–29. 10.1016/j.hal.2017.03.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lefebvre KA, Robertson A, 2010. Domoic acid and human exposure risks: A review. Toxicon 56, 218–230. 10.1016/J.TOXICON.2009.05.034 [DOI] [PubMed] [Google Scholar]
  35. Lefebvre KA, Tilton SC, Bammler TK, Beyer RP, Srinouanprachan S, Stapleton PL, Farin FM, Gallagher EP, 2009. Gene expression profiles in zebrafish brain after acute exposure to domoic acid at symptomatic and asymptomatic doses. Toxicol. Sci 107, 65–77. 10.1093/toxsci/kfn207 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lefebvre KA, Yakes BJ, Frame E, Kendrick P, Shum S, Isoherranen N, Ferriss BE, Robertson A, Hendrix A, Marcinek DJ, Grattan L, 2019. Discovery of a potential human serum biomarker for chronic seafood toxin exposure using an SPR biosensor. Toxins (Basel). 11. 10.3390/toxins11050293 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lu J, Wu DM, Zheng YL, Hu B, Cheng W, Zhang ZF, 2012. Purple sweet potato color attenuates domoic acid-induced cognitive deficits by promoting estrogen receptor-α-mediated mitochondrial biogenesis signaling in mice. Free Radic. Biol. Med 52, 646–659. 10.1016/J.FREERADBIOMED.2011.11.016 [DOI] [PubMed] [Google Scholar]
  38. Maden M, 2007. Retinoic acid in the development, regeneration and maintenance of the nervous system. Nat. Rev. Neurosci 10.1038/nrn2212 [DOI] [PubMed] [Google Scholar]
  39. Mancia A, Ryan JC, Chapman RW, Wu Q, Warr GW, Gulland FMD, Van Dolah FM, 2012. Health status, infection and disease in California sea lions (Zalophus californianus) studied using a canine microarray platform and machine-learning approaches. Dev. Comp. Immunol 36, 629–637. 10.1016/J.DCI.2011.10.011 [DOI] [PubMed] [Google Scholar]
  40. Mayer AM, Hall M, Fay MJ, Lamar P, Pearson C, Prozialeck WC, Lehmann VK, Jacobson PB, Romanic AM, Uz T, Manev H, 2001. Effect of a short-term in vitro exposure to the marine toxin domoic acid on valiability, tumor necrosis factor-alpha, matrix metalloproteinase-9 and superoxide anion release by rat neonatal microglia. BMC Pharmacol. 1. 10.1186/1471-2210-1-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. McCabe RM, Hickey BM, Kudela RM, Lefebvre KA, Adams NG, Bill BD, Gulland FMD, Thomson RE, Cochlan WP, Trainer VL, 2016. An unprecedented coastwide toxic algal bloom linked to anomalous ocean conditions. Geophys. Res. Lett 43, 10,366–10,376. 10.1002/2016GL070023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Mey J, McCaffery P, 2004. Retinoic acid signaling in the nervous system of adult vertebrates. Neuroscientist. 10.1177/1073858404263520 [DOI] [PubMed] [Google Scholar]
  43. Morey JS, Ryan JC, Van Dolah FM, Morey J, Johnson Rd F, 2006. Microarray validation: factors influencing correlation between oligonucleotide microarrays and real-time PCR. Biol. Proced. Online 8, 175–193. 10.1251/bpo126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Neuhauss SCF, 2003. Behavioral genetic approaches to visual system development and function in zebrafish. J. Neurobiol 54, 148–160. 10.1002/NEU.10165 [DOI] [PubMed] [Google Scholar]
  45. Patel YC, 1999. Somatostatin and Its Receptor Family. Front. Neuroendocrinol 20, 157–198. 10.1006/FRNE.1999.0183 [DOI] [PubMed] [Google Scholar]
  46. Perl TM, Bédard L, Kosatsky T, Hockin JC, Todd ECD, Remis RS, 1990. An Outbreak of Toxic Encephalopathy Caused by Eating Mussels Contaminated with Domoic Acid. N. Engl. J. Med 322, 1775–1780. 10.1056/NEJM199006213222504 [DOI] [PubMed] [Google Scholar]
  47. Petrie BF, Pinsky C, Standish NM, Bose R, Glavin GB, 1992. Parenteral domoic acid impairs spatial learning in mice. Pharmacol. Biochem. Behav 41, 211–214. 10.1016/0091-3057(92)90084-S [DOI] [PubMed] [Google Scholar]
  48. Petroff R, Richards T, Crouthamel B, McKain N, Stanley C, Grant KS, Shum S, Jing J, Isoherranen N, Burbacher TM, 2019. Chronic, low-level oral exposure to marine toxin, domoic acid, alters whole brain morphometry in nonhuman primates. Neurotoxicology 72, 114–124. 10.1016/j.neuro.2019.02.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Pfaffl MW, 2002. Relative expression software tool (REST(C)) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30, 36e – 36. 10.1093/nar/30.9.e36 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Qiu S, Jebelli AK, Ashe JH, Currás-Collazo MC, 2009. Domoic Acid Induces a Long-Lasting Enhancement of CA1 Field Responses and Impairs Tetanus-Induced Long-term Potentiation in Rat Hippocampal Slices. Toxicol. Sci 111, 140–150. 10.1093/toxsci/kfp141 [DOI] [PubMed] [Google Scholar]
  51. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK, 2015. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 43, e47. 10.1093/nar/gkv007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Ritchie ME, Silver J, Oshlack A, Holmes M, Diyagama D, Holloway A, Smyth GK, 2007. A comparison of background correction methods for two-colour microarrays 23, 2700–2707. 10.1093/bioinformatics/btm412 [DOI] [PubMed] [Google Scholar]
  53. Ruijter JM, Ramakers C, Hoogaars WMH, Karlen Y, Bakker O, van den hoff MJB, Moorman AFM, 2009. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 37. 10.1093/NAR/GKP045 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Rydeen A, Voisin N, D’Aniello E, Ravisankar P, Devignes CS, Waxman JS, 2015. Excessive feedback of Cyp26a1 promotes cell non-autonomous loss of retinoic acid signaling. Dev. Biol 405, 47–55. 10.1016/j.ydbio.2015.06.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Schinder AF, Olson EC, Spitzer NC, Montal M, 1996. Mitochondrial Dysfunction Is a Primary Event in Glutamate Neurotoxicity. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Scholin CA, Gulland F, Doucette GJ, Benson S, Busman M, Chavez FP, Cordaro J, DeLong R, De Vogelaere A, Harvey J, Haulena M, Lefebvre K, Lipscomb T, Loscutoff S, Lowenstine LJ, Marin R, Miller PE, McLellan WA, Moeller PDR, Powell CL, Rowles T, Silvagni P, Silver M, Spraker T, Trainer V, Van Dolah FM, 2000. Mortality of sea lions along the central California coast linked to a toxic diatom bloom. Nature 403, 80–84. 10.1038/47481 [DOI] [PubMed] [Google Scholar]
  57. Schwarz M, Jandová K, Struk I, Marešová D, Pokorný J, Riljak V, 2014. Low dose domoic acid influences spontaneous behavior in adult rats. Physiol. Res 63, 369–376. [DOI] [PubMed] [Google Scholar]
  58. Smyth GK, Speed T, 2003. Normalization of cDNA microarray data. Methods 31, 265–273. 10.1016/S1046-2023(03)00155-5 [DOI] [PubMed] [Google Scholar]
  59. Sobotka TJ, Brown R, Quander DY, Jackson R, Smith M, Long SA, Barton CN, Rountree RL, Hall S, Eilers P, Johannessen JN, Scallet AC, 1996. Domoic acid: Neurobehavioral and neurohistological effects of low-dose exposure in adult rats. Neurotoxicol. Teratol 18, 659–670. 10.1016/S0892-0362(96)00120-1 [DOI] [PubMed] [Google Scholar]
  60. Stout AK, Raphael HM, Kanterewicz BI, Klann E, Reynolds IJ, 1998. Glutamate-induced neuron death requires mitochondrial calcium uptake. Nat. Neurosci. 1998 15 1, 366–373. 10.1038/1577 [DOI] [PubMed] [Google Scholar]
  61. Suurväli J, Boudinot P, Kanellopoulos J, Rüütel Boudinot S, 2017. P2X4: A fast and sensitive purinergic receptor. Biomed. J 10.1016/j.bj.2017.06.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Tamai TK, Young LC, Whitmore D, 2007. Light signaling to the zebrafish circadian clock by Cryptochrome 1a. Proc. Natl. Acad. Sci. U. S. A 104, 14712–14717. 10.1073/pnas.0704588104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Tarca AL, Kathri P, Draghici S, 2022. SPIA: Signaling Pathway Impact Analysis (SPIA) using combined evidence of pathway over-representation and unusual signaling perturbations. R package version 2.48.0, http://bioinformatics.oxfordjournals.org/cgi/reprint/btn577v1. [Google Scholar]
  64. Torres De La Riva G, Johnson CK, Gulland FMD, Langlois GW, Heyning JE, Rowles TK, Mazet JAK, 2009. Association of an unusual marine mammal mortality event with Pseudo nitzschia spp. blooms along the Southern California coastline. J. Wildl. Dis 45, 109–121. [DOI] [PubMed] [Google Scholar]
  65. Wang GJ, Thayer SA, 1996. Sequestration of glutamate-induced Ca2+ loads by mitochondria in cultured rat hippocampal neurons. 10.1152/jn.1996.76.3.1611 76, 1611–1612. [DOI] [PubMed] [Google Scholar]
  66. Wang M, Zhong Z, Zhong Y, Zhang W, Wang H, 2015. The Zebrafish Period2 Protein Positively Regulates the Circadian Clock through Mediation of Retinoic Acid Receptor (RAR)-related Orphan Receptor α (Rorα). J. Biol. Chem 290, 4367. 10.1074/JBC.M114.605022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Waschek JA, 2013. VIP and PACAP: Neuropeptide modulators of CNS inflammation, injury, and repair. Br. J. Pharmacol 10.1111/bph.12181 [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Wekell JC, Jurst J, Lefebvre K a, 2004. The origin of the regulatory limits for PSP and ASP toxins in shellfish. J. Shellfish Res 23, 927–930. 10.2983/035.029.0302 [DOI] [Google Scholar]
  69. Work TM, Barr B, Beale AM, Fritz L, Michael A, Wright JLC, Url S, 1993. Epidemiology of Domoic Acid Poisoning in Brown Pelicans (Pelecanus occidentalis) and Brandt’ s Cormorants (Phalacrocorax penicillatus) in California. J. Zoo Wildl. Med 24, 54–62. [Google Scholar]
  70. Wu D, Lim E, Vaillant F, Asselin-Labat M-L, Visvader JE, Smyth GK, 2010. ROAST: rotation gene set tests for complex microarray experiments. Bioinformatics 26, 2176–2182. 10.1093/BIOINFORMATICS/BTQ401 [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Yang YH, Dudoit S, Luu P, Lin DM, Peng V, Ngai J, Speed TP, 2002. Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation, Nucleic Acids Research. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Zannas AS, Wiechmann T, Gassen NC, Binder EB, 2016. Gene-Stress-Epigenetic Regulation of FKBP5: Clinical and Translational Implications. Neuropsychopharmacology. 10.1038/npp.2015.235 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material

RESOURCES