Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2022 Nov 27;12:20392. doi: 10.1038/s41598-022-23259-w

Fusarium chlamydosporum, causing wilt disease of chili (Capsicum annum L.) and brinjal (Solanum melongena L.) in Northern Himalayas: a first report

Tasmeen J Parihar 1, Mohd Yaseen Sofi 1, Rovidha S Rasool 2, Sehla Khursheed 3, Zahoor A Bhat 3, Khursheed Hussain 4, Bhagyashree Dhekale 5, Sajad Majeed Zargar 6, Asma S Hakak 1,7, Mehraj D Shah 3, F A Nehvi 1, M Ashraf Bhat 1, M N Khan 1, Khalid Z Masoodi 1,
PMCID: PMC9701669  PMID: 36437280

Abstract

Chili (Capsicum annuum L.) and brinjal (Solanum melongena L.) are the most widely grown solanaceous crops in the world. However, their production has reduced over several years due to the attack of various fungal and bacterial pathogens and various abiotic factors. Still, the major constrain in their production are pathogens with fungal etiology, especially the fungal wilt of solanaceous crops. Fusarium oxysporum and Fusarium solani have been previously identified as the pathogens causing wilt disease in chili and brinjal. Recently, a new fungal pathogen F. equiseti has been reported as the causal agent of wilt disease infecting chili. The current study focused on identifying fungal pathogens associated with the wilted plants of chili and brinjal, collected from different parts of the Himalayan region of Kashmir valley, through morpho-cultural and molecular characterization. DNA extraction, PCR amplification, and sequencing were performed on various isolates. DNA barcoding using the internal transcribed spacer region (ITS) was used to identify the pathogen followed by the pathogenicity test. Further confirmation of the pathogen was done by sequencing of transcription elongation factor (TEF) and Calmodulin (CAL2). In current study Fusarium chlamydosporum has been reported as the wilt causing pathogen of chili and brinjal for the first time in Kashmir Himalayas.

Subject terms: Plant biotechnology, Microbiology, Molecular biology, Plant sciences

Introduction

The most widely grown and commercially important vegetable crops in India are chili (Capsicum annuum L.) and brinjal (Solanum melongena L.).India is the primary producer, exporter, and consumer of chili globally, while it ranks second in world brinjal production after China1. Both these crops belong to the solanaceous family and are considered the vital source of nutrients, thus helping in combating various human health diseases and disorders. These crops are prone to multiple diseases, and the most devastating is the wilt in terms of incidence and yield loss2. In India, the wilt of chili and brinjal has emerged as a severe threat, with disease incidence of 2–85%3. The two critical fungal species i.e., Fusarium oxysporum and Fusarium solani are involved with chili wilt in India, whereas, Fusarium moniliforme and Fusarium pallidoroseum are the other two species found in some parts of India3,4. Recently, F. equiseti has been reported from Kashmir valley as the causal agent of chili wilt5. Global yield losses owing to the disease are estimated to range between 10 and 80%6. Apart from chili and brinjal, wilt affects a wide variety of crops such as tomato, tobacco, legumes, cucurbits, etc. The characteristic symptoms of wilt disease are slight yellowing of the leaves that wither and defoliate prematurely. Browning of the vascular tissues, stunting, and necrosis are the other symptoms7,8. Reports suggest that Fusarium palfidoroseum Sacc. is the primary causal agent of wilt in Kashmir valley. The losses due to this disease is reported to be 30–40% annually9.

The identification of the Fusarium spp. is conventionally based on morphological characteristics such as shape, size, and color of micro and macroconidia besides colony characteristics5. Although the primary identification of the pathogen is based on the colony and morphological characters, the information collected by nucleotide sequencing from conserved gene sections, such as internal transcribed spacer and translation elongation factor 1-alpha, is the most reliable method of identification. Recently F. equiseti has been reported as the cause of chili wilt through DNA barcoding5.

Various approaches, such as direct sequencing of the ITS region and restriction fragment patterns from PCR-generated ITS sequences, are viewed as effective methods for identifying fungi at the species level. These methods have been utilized in the molecular identification of a wide range of pathogenic fungi10. Besides ITS, transcription elongation factor (TEF) is also used to identify the associated pathogens. In the current study, an attempt was made to identify the pathogens associated with chili and brinjal wilt, based on morphological and molecular characterization using different DNA Barcodes viz., internal transcribed spacer, translation elongation factor 1-alpha and Calmodulin (CAL2) 11.

Material and methods

Survey for disease incidence

A survey of three districts (Srinagar, Baramulla, and Anantnag) in Kashmir Division of Northern Himalayan region of India was carried out during July–August 2019 through 2021 to assess the status of wilt disease of chili and brinjal. Field studies and plant material collections were conducted in accordance with local legislation, and appropriate permissions were obtained as and when required. In the present study, SKUAST-K has various KVKs in all districts of J&K that directly work with local farmer populations under various schemes. There is a mutual agreement between the University and the Department of Agriculture, J&K for sharing the material for research. Three villages were selected from each district, and three fields were chosen randomly in each village. One square meter area (1 m2) from each field involving approximately 20–25 plants was selected randomly to assess the disease incidence. The percent disease incidence was calculated using the following formula:

Percent disease incidence =Total number of diseased plantsTotal number of examined plants×100

Isolation, identification and pathogenicity test of the pathogen isolate

The pathogen isolates were isolated on PDA medium using the tissue bit method from infected samples. The cultures were purified by single spore technique and maintained on PDA slants at 25 ± 1 °C12,13. The pathogen was identified based on morphological (shape, size, and color of micro and macroconidia and septation) and cultural characters (colony color) of the isolated cultures on the PDA and SNA media. DNA barcoding was further used to authenticate morphological-based identification. The pathogenicity test of the isolated fungus was performed on potted chili (cv. Shalimar Long) and brinjal (cv. Local Long) plants using the rhizosphere inoculation technique14 to prove Koch’s postulates. Sand maize meal medium (potting mixture) was prepared by placing 90 g of sand and 10 g of maize meal in 250 ml of Erlenmeyer flask that contained 40 ml of distilled water was autoclaved at 1.05 kg cm−2 pressure for half an hour. Spore suspension of the pathogen was prepared from the already isolated and purified pathogen that was grown earlier on PDA (Potato dextrose agar) medium and inoculated in the sterilized Sand maize meal mixture (potting mixture) in ratio of (2:1) and spore suspension @ 100 µl per pot was mixed with upper layer of soil and continues shaking of this potting mixture inoculated with pathogen was done to obtain uniform growth of the pathogen in potting mixture that was allowed to grow for 7 days to infest soil5,15,16 (Supplementary Table 1). Plants of chili and brinjal were sown in this infected potting mixture and grown for 3 weeks to provide conducive conditions for the pathogen to infect the host plants. Finally, the plants were observed for appearance of symptoms.

Morpho-cultural characterization

Cultural characterization was carried out based on colony color and status of the mycelium that were grown on PDA medium. For morphological studies of the fungus, the wet mounts in lactophenol and cotton blue of 10 days old culture were examined under the microscope, and the observations with respect to color, width, and septation of hyphae, as well as the shape, size, septation, and color of conidia, conidiophore, and chlamydospore were recorded.

DNA extraction and PCR amplification

DNA was isolated using a 400 μl SDS extraction buffer (200 mM Tris HCL pH 8.5, 250 mM NaCl, 25 mM EDTA, and 0.5% SDS)17. Primers were designed manually using Oligocalc, ClustalW (http://www.ebi.ac.uk/Tools/msa/clustalo/) and Blast (http://blast.ncbi.nlm.nih.gov/Blast.cgi) online software. ITS1F2/ITS4R2 and TEF Fu3 F/TEF Fu3 R CAL2-28F/CAL2-RD were used for PCR amplification (Tables 1, 2 and, 3).

Table 1.

Primers used for amplification of ITS regions.

S. No Primer name Primer sequence Size of amplicon Tm °C
1 K-Lab-FusOxy-ITS1F2 Primer 5′CCTGCGGAGGATCATTA 3′  ~ 500 bp 63.7
2 K-Lab-FusOxy-ITS4R2 Primer 5′TCCTCCGCTTATTGAT3′ 53.6

Table 2.

Primers used for amplification of TEF region.

S. No Primer name Primer sequence Size of amplicon Tm °C
1 K-Lab-TEF-Fu3-F 5′GGTATCGACAAGCGAACCAT3′  ~ 500 bp 63.8
2 K-Lab-TEF-Fu3-R 5′TAGTAGCGGGAGTCTCGAA3 63.8

Table 3.

Primers used for amplification of CAL2 to identify the species.

S. No Primer name Primer sequence Size of amplicon Tm °C
1 K-Lab CAL2-28F-F 5′GAGTTCAAGGAGGCCTTCTCCC3′  ~ 600 bp 66.3
2 K-Lab CAL2-RD-R 5′TGRTCNGCCTCDCGGATCATCTC3′ 74.7

Sequencing and DNA barcoding

PCR products amplified using ITS1F2/ITS4R2 and TEF Fu3 F/TEF Fu3 R were outsourced for sequencing to Bionivid Technology, Bangalore, India. The genetic variability among collective samples was ascertained through DNA barcoding of ITS1 and ITS2. Dendrogram was constructed using MEGA 6.0 software. The results were reconfirmed using CAL2-28F/CAL2-RD primers for identification and were outsourced for sequencing to Biokart India Pvt. Ltd.

Results

Morpho-cultural identification of pathogen isolates

The colonies initially appeared white (Fig. 1a), which progressively became purple at the agar base, which showed 90 mm of growth after incubation of 15 days at 25 ± 1 °C. Mycelium was smooth, branched, cylindrical, septate, and 3.28–4.82 µm wide. The conidiophores were cylindrical, short, septate, and measured 72.50–106.30 × 3.00–4.50 µm in size (Table 4). Microconidia were spindle-shaped, hyaline with 0–3 septa, measuring 6.0–26.0 × 2.0–4.0 µm in size while as macroconidia were sickle-shaped, hyaline with 3–5 septa and measured 30.0–38.0 × 3.0–4.5 µm in size (Fig. 1b and Suppl Fig. 2a, b). The chlamydospores were intercalary, rough walled, hyaline, and measured 5.80–9.01 µm in diameter (Fig. 1b and Suppl Fig. 2c). SNA media being low nutrient medium than PDA helped to obtain more prominent microconidia, macroconidia and, clamadospores (Fig. 1c). Based on these characteristics and their comparison with the authentic description given by Booth (1971)18,19, the fungus associated with chili and brinjal was identified as Fusarium chlamydosporum.

Figure 1.

Figure 1

Figure 1

(a) Morpho-cultural characteristics of Fusarium clamydosporum isolated from wilted plants of chili Capsicum annuum L. and brinjal Solanum melongena L. showing 2 and 3 weeks old cultures front and back side. (b) Microconidia, Macrocondia and chlamydospore of Fusarium clamydosporum isolated from wilted plants of chili (Capsicum annuum L.) and brinjal (Solanum melongena L.). (c) Microconidia, Macrocondia and chlamydospore of Fusarium clamydosporum in SNA medium.

Table 4.

Morpho-cultural characteristics of Fusarium chlamydosporum causing chili and brinjal wilt.

Fungal propagule Shape Color Size Septation
Colony Branched monophialids, cylindrical mycelium Initially white, turning light pink colored at agar base 90 mm dia. in 15 days Septate
Hyphae Smooth and branched Hyaline 3.28–4.82 µm in width Septate
Microconidia Spindle-shaped Hyaline 6–26 × 2–4 µm 0–3 Septate
Macroconidia Sickle shaped Hyaline 30–38 × 3–4.5 µm 3–5 Septate
Conidiophores Cylindrical, short, and branched Hyaline 72.50–106.30 × 3.00–4.50 µm Septate
Chlamydospores Spherical, smooth, and rough walled, single or in chains Hyaline 5.81–9.01 µm in dia.

Pathogenicity test

The pathogenicity of isolates was carried out on potted chili (cv. Shalimar Long) and brinjal (cv. Local Long) plants using rhizosphere inoculation technique (Fig. 2 a,b). The incubation period for F. chlamydosporum was 19–20 days in brinjal and chili hosts respectively. The initial symptoms appeared as pale green to yellow discoloration of leaves, which later started to droop and finally resulted in the death of the entire plant. Vascular bundles, when exposed, showed brownish discoloration. F. chlamydosporum was re-isolated from the inoculated seedlings and was found to be the same pathogen when compared with their original isolates and resembled the original inoculated pathogen in morphological, cultural, and pathogenic characteristics, proving Koch’s postulates (Fig. 3). The cultures were further validated at the molecular level by sequencing of TEF Locus and CAL2 gene.

Figure 2.

Figure 2

(a) Pathogenicity test of isolated Fusarium clamydosporum on potted chili Capsicum annuum L. plants at 2, 4 and 6 weeks after sowing control plants were treated with distilled water. (b) Pathogenicity test of isolated Fusarium clamydosporum on potted brinjal Solanum melongena L. plants at 2, 4, and 6 weeks after sowing. Control plants were treated with distilled water.

Figure 3.

Figure 3

Symptomatological development of wilt diseases of a. chili. (Capsicum annuum L.)  and brinjal. (Solanum melongena L.) Control depicts uninfected plants and F. clamydosporum-treated with pathogen shows wilted plants.

DNA extraction and PCR amplification

The genomic DNA was extracted from fungal cultures and loaded on 0.7% agarose gel that was run for 30 min. The DNA extracted from different isolates resulted in single high molecular weight intact bands, indicating a good quality DNA. PCR amplification under standard conditions was carried out, and the amplified products were run on 1% agarose gel. PCR showed the amplified product size of 500 bp of ITS1 and ITS2 region (Fig. 4a and Suppl Fig. 1a), PCR product of TEF resulted in amplicon size of ~ 500 bp (Fig. 4b and Suppl Fig. 1b) and CAL2-28F/CAL2-RD that resulted in amplification of 600 bp (Fig. 4c). The PCR amplicons of primer targeting regions of ITS1-5.8S-ITS2and TEF were sequenced, and the pathogen identified was F. clamydosporum. BLAST was used to find regions of similarity between the query sequence and the NCBI database sequence. The sequence of ITS with accession numbers MK503837.1, OM319485, OM319486, and sequence of TEF with accession number OM441207, and OM441208 were successfully published in GenBank (https://www.ncbi.nlm.nih.gov Tables 5 and 6). The PCR amplicons of primer CAL2-28F/CAL2-RD were sequenced, and the pathogen identified was confirmed as F. clamydosporum. Sequence of CAL2-28F/CAL2-RD with accession number OP345814, OP345815 were successfully published in GenBank (Table 7) The F. clamydosporum sequence was compared with its similar sequence available in the NCBI database. An optimal dendrogram was constructed using MEGA software v 5.05, and different taxa were clustered together in a bootstrap test 1000 replicates using sequences of ITS, TEF and CAL2 genes that were compared with their respective hits retrieved from NCBI database and compared with the already available F. chlamydosporum sequences (Fig 5). All the Fusarium chlamydosporum isolates obtained showed grouping with already known Fusarium chlamydosporum19.

Figure 4.

Figure 4

(a) PCR product amplified from ITS region of Fusarium clamydosporum. M-100 bp ladder, Lane 1—pathogen isolated from chili, Lane 2—pathogen isolated from brinjal. (b) PCR product amplified from TEF region of Fusarium clamydosporum. M-100 bp ladder, Lane 1—pathogen isolated from chili, Lane 2—pathogen isolated from brinjal. (c) PCR product amplified from CAL2 of Fusarium clamydosporum M-100 bp ladder, Lane 1—pathogen isolated from chili, Lane 2—pathogen isolated from Brinjal.

Table 5.

Accession number of isolates collected from different places (ITS).

S.No Isolates Place of collection Pathogen identified Host plant Accession number (ITS)
1 A8 Srinagar-HMT Fusarium chlamydosporum Chili MK503837.1
2 R Baramulla-Sopore Fusarium chlamydosporum Chili OM319485
3 S Anantnag-Kokarnag Fusarium chlamydosporum Brinjal OM319486

Table 6.

Accession number of isolates collected from different places (TEF).

S. No Isolates Place of collection Pathogen identified host plant Accession number (TEF)
1 R Baramulla-Sopore Fusarium chlamydosporum Chili OM441207
2 S Anantnag-Kokarnag Fusarium chlamydosporum Brinjal OM441208

Table 7.

Accession number of isolates collected from different places (CAL2).

S. No Isolates Place of collection Pathogen identified Host plant Accession number (CAL2)
1 R Baramulla-Sopore Fusarium chlamydosporum Chili OP345814
2 S Anantnag-Kokarnag Fusarium chlamydosporum Brinjal OP345815

Figure 5.

Figure 5

Dendrogram generated by ITS, TEF and CAL2 sequence data predicting similarity and evolutionary relationship between the two isolates from chili and brinjal.

Discussion

Chili and brinjal are the most widely grown solanaceous crops worldwide and are rich source of nutrients, thus helping combat various human health diseases and disorders1. However, the production of these crops has drastically reduced from the last several years due to several biotic and abiotic stresses. The main constrain in producing these crops is the attack of various fungal diseases3.The current study was carried out to identify the causal pathogen of the most devastating wilt disease of chili and brinjal, to which 50–80% losses have been attributed. Previous reports have found that wilt in solanaceous crops is caused by F. oxysporum, F. solani and F. equiseti5. The pathogen isolates were collected from three districts (Srinagar, Baramulla, and Anantnag) in Kashmir Division, and were isolated and maintained on PDA and SNA media at 25 ± 1 ℃20,21 to study morpho-cultural characteristics. In this study, a new species of Fusarium causing wilt was identified based on morpho-cultural characteristics and confirmed by DNA Barcoding of ITS, TEF and Calmodulin genomic regions, identified as Fusarium chlamydosporum. Many researchers have utilized ITS and TEF genomic regions for identification of Fusarium species and have confirmed these primers as barcode DNA for identification of various species of fungi2124 but for confirmation of the species identified CAL2-28F/CAL2-RD were also utilized because many researchers have earlier authenticated these primers for species identification in Fusarium pathogen19,25. Although Fusarium chlamydosporum was known to cause wilt in cotton, damping-off disease on Aleppo pine in Algeria, wilt disease of guava (Psidium guajava L.) in India, Die-back of olive in Tunisia, crown rot in Banana and lentil2629 but first time is reported as causal agent of wilt disease in Capsicum annuum L. and Solanum melongena L.in Kashmir valley in Northern Himalayan region of India.

The inoculation of the cultured wilt pathogen on respective hosts using rhizosphere inoculation technique produced characteristic symptoms of wilt on leaves and vascular bundles with incubation periods of 19–20 days in F. chlamydosporum, in chili and brinjal hosts indicating same virulent nature of F. chlamydosporum in both host crops. The results are in complete agreement with other researchers who have reported almost same incubation period in different species of Fusarium infecting chili5.

Internal transcribed spacer (ITS) amplification using genus and/or species-specific ITS primers distinguished F.chlamydosporum based on PCR amplification using ITS primer combinations K-Lab-FusOxy-ITS1F2 and K-Lab-FusOxy-ITS4R2 on different isolates that showed amplification of ~ 500 bp. To further confirm our results, transcription elongation factor (TEF) amplification was carried out with TEF primer combination viz., K-Lab-TEF-Fu3-F and K-Lab-TEF-Fu3-R. Primer directed the amplification of ~ 500 bp. For reconfirming the identification CAL2-28F/CAL2-RD primers were used that showed amplification of 600 bp and the PCR amplicons were sequenced to reconfirm the species identified. The pathogens were identified using sequencing of the ITS1-5.8S-ITS2 and TEF regions and CAL2-28F/CAL2-RD (Tables 5, 6 and 7). Alignment of sequences through CLUSTALW revealed that the similarity among sequences was independent of their geographic origin, and it also showed the genetic relatedness of 45–98%.

In the phylogenetic study, F.chlamydosporum sequences of ITS, TEF and CAL2 genes were compared with their respective hits retrieved from NCBI database and were also compared with the already available F.chlamydosporum sequences19. The phylogenetic analysis led to the grouping of F.clamydosporum species sequences and their respective hits sequences and already available F.chlamydosporum sequences obtained from NCBI into different clades (Fig. 4c). Similar species were grouped in a single clade irrespective of their geographic origin. A new fungal species F.chlamydosporum was found associated with causing wilt of chili and brinjal from Kashmir valley, and this is the first report of this pathogen from India.

Supplementary Information

Supplementary Table S1. (12.3KB, docx)

Acknowledgements

The paper was part of the Ph. D research of Ms. Tasmeen J. Parihar who worked under supervision of Dr. Khalid Z. Masoodi. The equipment used in the study were funded by SERB research grant No. EMR/2016/0005598 and Early Career Research Award no. ECRA/2016/000025 to Dr. Khalid Z. Masoodi. The research was partially funded by SKUAST-K ROC grant No. AU/ACCTTS/Budget/BA/2021-22/7565-7629 and partially by IDP-SKUASTK (NAHEP). We thank Prof M. N. Khan, Director Education for providing the partial funding from ROC. The partial cost of consumables and sequencing incurred in the investigation was borne from the salary of the corresponding author. We are open for angel funders and research collaborations which could facilitate research funding for student research.

Author contributions

Funding acquisition K.Z.M., conceptualization K.Z.M., Z.A.B., methodology, T.J.P., M.Y.S., R.S.R., Supervision, K.Z.M., Z.A.B., Seed procurement, K.H., formal analysis, K.Z.M., Z.A.B., B.D., F.A.N., M.N.K., data curation, T.J.P., K.Z.M., R.S.R., K.H., writing-original draft preparation, T.J.P., R.S.R., K.Z.M., Bioinformatic analysis, M.Y.S., K.Z.M., Review and editing K.Z.M., Z.A.B., M.Y.S., R.S.R., S.K., Deans Nominee M.D.S., Advisory Committee member S.M.Z., All authors have read and approved the manuscript.

Data availability

The sequencing data is available on NCBI database. The sequence of ITS with accession numbers MK503837.1, OM319485, OM319486, were successfully published in GenBank (https://www.ncbi.nlm.nih.gov). The sequence of TEFs have been provided Accession Numbers OM441207, and OM441208 by https://www.ncbi.nlm.nih.gov. The sequence of CAL2 have been provided Accession Numbers OP345814, OP34581 in GeneBank (https://www.ncbi.nlm.nih.gov.) Morphological identification was done by registered plant pathologist Dr. Z.A. Bhat. Molecular identification was done by Dr. Khalid Z. Masoodi. Voucher specimen have been deposited at K-Lab pathogen repository, Division of Plant Biotechnology, SKUAST-K, Shalimar. The experimental research and field studies carried out in the present investigation and plant collections are in accordance with local legislation and comply with institutional, national, and international guidelines.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-022-23259-w.

References

  • 1.Varmudy V. Marketing of Vegetables in India. Daya Books; 2002. [Google Scholar]
  • 2.Manda RR, Addanki VA, Srivastava S. Bacterial wilt of solanaceous crops. Int. J. Chem. Stud. 2020;8:1048–1057. doi: 10.22271/chemi.2020.v8.i6o.10903. [DOI] [Google Scholar]
  • 3.Naik M, Rani G, Madhukar H. Identification of resistant sources against wilt of chilli (Capsicum annuum L.) caused by Fusarium solani (Mart.) Sacc. J. Mycopathol. Res. 2008;46:93–96. [Google Scholar]
  • 4.Shaheen N, et al. Genetics and genomics of Fusarium wilt of chilies: A review. Agronomy. 2021;11:2162. doi: 10.3390/agronomy11112162. [DOI] [Google Scholar]
  • 5.Hami A, et al. Morpho-molecular identification and first report of Fusarium equiseti in causing chilli wilt from Kashmir (Northern Himalayas) Sci. Rep. 2021;11:1–14. doi: 10.1038/s41598-021-82854-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Singh JK, Kumar M, Kumar S, Kumar A, Mehta N. Inhibitory effect of botanicals on growth and sporulation of Fusarium oxysporum inciting wilt of chilli (Capsicum annuum L.) J. Pharmacogn. Phytochem. 2017;6:2199–2204. [Google Scholar]
  • 7.Engelhard, A., Jones, J. & Woltz, S. Vascular Wilt Diseases of Plants. 337–352 (Springer, 1989).
  • 8.Yamamoto, I., Komada, H., Kyniyasu, K., Saito, M. & Ezuka, A. Proceedings of the Kansai Plant Protection Society.
  • 9.Wani F, Najar A. Integrated management of Fusarium wilt [Fusarium pallidoroseum (Cooke) Sacc.] in chilli (Capsicum annum L.) SKUAST J. Res. 2012;14:40–45. [Google Scholar]
  • 10.Singh, J. K. Pathogenic Variability and Management of Fusarium Wilt of Chilli (Capsicum annuum L.) [with CD Copy] (Plant Pathology, CCS HAU Hisar, 2016).
  • 11.Cunningham F, et al. Ensembl 2015. Nucleic Acids Res. 2015;43:D662–D669. doi: 10.1093/nar/gku1010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Pathak, V. N. Essentials of Plant Pathology. (1972).
  • 13.Leslie JF, Summerell BA. The Fusarium Laboratory Manual. Wiley; 2008. [Google Scholar]
  • 14.Najar A, Anwar A, Masoodi L, Khar M. Evaluation of native biocontrol agents against Fusarium solani f. sp. melongenae causing wilt disease of brinjal in Kashmir. J. Phytol. 2011;3:31–34. [Google Scholar]
  • 15.Davey C, Papavizas G. Comparison of methods for isolating Rhizoctonia from soil. Can. J. Microbiol. 1962;8:847–853. doi: 10.1139/m62-111. [DOI] [Google Scholar]
  • 16.Kerr A. The root rot-Fusarium wilt complex of peas. Aust. J. Biol. Sci. 1963;16:55–69. doi: 10.1071/BI9630055. [DOI] [Google Scholar]
  • 17.Cenis J. Rapid extraction of fungal DNA for PCR amplification. Nucleic Acids Res. 1992;20:2380. doi: 10.1093/nar/20.9.2380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Booth C. The Genus Fusarium. Commonwearth Mycological Institute; 1971. [Google Scholar]
  • 19.Lombard L, Van Doorn R, Crous P. Neotypification of Fusarium chlamydosporum—A reappraisal of a clinically important species complex. Fungal Syst. Evolut. 2019;4:183–200. doi: 10.3114/fuse.2019.04.10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kumar A, Patil D, Rajamohanan PR, Ahmad A. Isolation, purification and characterization of vinblastine and vincristine from endophytic fungus Fusarium oxysporum isolated from Catharanthus roseus. PLoS ONE. 2013;8:e71805. doi: 10.1371/journal.pone.0071805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Akbar A, Hussain S, Ullah K, Fahim M, Ali GS. Detection, virulence and genetic diversity of Fusarium species infecting tomato in Northern Pakistan. PLoS ONE. 2018;13:e0203613. doi: 10.1371/journal.pone.0203613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Singha IM, Kakoty Y, Unni BG, Das J, Kalita MC. Identification and characterization of Fusarium sp. using ITS and RAPD causing fusarium wilt of tomato isolated from Assam, North East India. J. Genet. Eng. Biotechnol. 2016;14:99–105. doi: 10.1016/j.jgeb.2016.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Schoch CL, et al. From the cover: Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for fungi. Proc. Natl. Acad. Sci. USA. 2012;109:6241. doi: 10.1073/pnas.1117018109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Mwangi M, Muiru W, Kimenju J. Characterisation of Fusarium species infecting tomato in Mwea west sub-county, Kirinyaga County, Kenya. Can. J. Plant Pathol. 2021;43:56–61. doi: 10.1080/07060661.2020.1788645. [DOI] [Google Scholar]
  • 25.O’Donnell K, et al. DNA sequence-based identification of Fusarium: current status and future directions. Phytoparasitica. 2015;43:583–595. doi: 10.1007/s12600-015-0484-z. [DOI] [Google Scholar]
  • 26.Du Y, Chen F, Shi N, Ruan H. First report of Fusarium chlamydosporum causing banana crown rot in Fujian Province, China. Plant Dis. 2017;101:1048. doi: 10.1094/PDIS-11-16-1674-PDN. [DOI] [Google Scholar]
  • 27.Gupta VK, Misra AK. Fusarium chlamydosporum, causing wilt disease of guava (Psidium guajava L.) in India. Arch. Phytopathol. Plant Protect. 2012;45:2425–2428. doi: 10.1080/03235408.2012.728055. [DOI] [Google Scholar]
  • 28.Lazreg F, et al. First report of Fusarium chlamydosporum causing damping-off disease on Aleppo pine in Algeria. Plant Dis. 2013;97:1506–1506. doi: 10.1094/PDIS-02-13-0208-PDN. [DOI] [PubMed] [Google Scholar]
  • 29.Trabelsi, R., Gdoura, R. & Triki, M. A. Euro-Mediterranean Conference for Environmental Integration. 581–582 (Springer).

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Table S1. (12.3KB, docx)

Data Availability Statement

The sequencing data is available on NCBI database. The sequence of ITS with accession numbers MK503837.1, OM319485, OM319486, were successfully published in GenBank (https://www.ncbi.nlm.nih.gov). The sequence of TEFs have been provided Accession Numbers OM441207, and OM441208 by https://www.ncbi.nlm.nih.gov. The sequence of CAL2 have been provided Accession Numbers OP345814, OP34581 in GeneBank (https://www.ncbi.nlm.nih.gov.) Morphological identification was done by registered plant pathologist Dr. Z.A. Bhat. Molecular identification was done by Dr. Khalid Z. Masoodi. Voucher specimen have been deposited at K-Lab pathogen repository, Division of Plant Biotechnology, SKUAST-K, Shalimar. The experimental research and field studies carried out in the present investigation and plant collections are in accordance with local legislation and comply with institutional, national, and international guidelines.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES