Abstract
To investigate the role of Pseudogenes (PG) in juvenile nasopharyngeal angiofibroma (JNA) that were once considered to be junk-DNA or ‘genomic fossils’. Five to 10 fresh JNA samples were analyzed for molecular expressions of 5 PG/respective parent genes (VEGFR1P1/VEGFR; FGFR3P1/FGFR3; PDGFAP1/PDGFA; IL6RP1/IL6R; POU5F1B/POU5F1) and clinical details correlated. IL6R, PDGFA, VEGFR2, FGF3 and their respective PG (VEGFR1P1, PDGFAP1, IL6RP1, FGFR3P1) were highly expressed but POU5F1/POU5F1B were not. The difference in expression between IL6R & IL6RP1 was substantially larger compared with other 4 pairs. While VEGFR1P1, PDGFAP1 & POU5F1B were expressed more than their respective parent genes; IL6RP1 & FGFR3P1 showed reduced expression. No clinical significance was apparent in any parameter nor was any difference noted between recurrent and upfront cases. A definite implication of pseudogene in JNA is evident in this ever first global study but future studies are needed to validate the current findings as well as further characterize its role/profile in larger sample. This may explain extreme variability of JNA, its heterogenous etiopathogenesis, evolving patterns and molecular characterization for possible targeted therapy.
Keywords: Angiofibroma, Nasopharynx, Pseudogenes
Introduction
Pseudogenes referred to as ‘genomic fossils were earlier considered to be a part of ‘junk DNA’ (non-protein coding transcipts), but currently are recognized to have an essential role in gene expression/regulation of their respective parent gene. This modulation is through gene silencing by either siRNA or by influencing the mRNA levels of the functional gene. The current status of pseudogene is still in infancy and particularly unknown in JNA. The literature cites 2 categories of pseudogenes: viz. processed and unprocessed; the former being formed by retro-transposition of cDNA and mRNA while the latter being further subcategorized as unitary and duplicated. The genome includes many paralogous pseudogenes and over 20,000 pseudogenes have been identified but many genes still do not have a parallel pseudogene. Depending upon the functionality [1] these have been described as either ‘Dead’ pseudogene that are non-transcribing or as ‘Ghost’ with intermediate functionality.
While many pseudogenes are expressed in some cancers like prostate, breast, glioblastoma etc. but the functionality of only a few has been demonstrated. Hence the clinical variability as seen in many diseases may be attributed to this variable expression. The same holds true for JNA that is seen to have evolved quite differently in past 7 decades [2]. Moreover these may also unfold the controversial etiologies that have been proposed for JNA suggesting it to be either (1) true neoplasm [3] arising from basisphenoid periosteum; (2) arising from remnants of fetal erectile tissue [4]; (3) true hamartoma (4) a hemangioma [5] or (5) vascular malformation [6]. The compressible nature with a frank blood on aspiration [7] defends the theory of origin of JNA related to either incomplete regression of the first brachial artery [5] or being hemangiomatous entity or even as a result of abnormal differentiation of the nonchromaffin paraganglionic cells of the terminal end of the maxillary artery. With a wide diversity in its suggested origin and changing clinical patterns, it is important to investigate the molecular aspects pertaining to pseudogene expression and appreciate for the first time in the world literature at least its preliminary trend in JNA.
Material and Methods
This pilot study is based on 10 JNA samples obtained through transpalatal excision with 4 samples of nasal polyp as controls. The diagnosis of JNA was established through histology and basic clinical details including imaging were noted. Four recurrent cases were intentionally included to appreciate any difference from upfront cases. Five pseudogenes were considered in this study. The following 4 pseudogenes corresponded to those parental genes that were earlier observed to be highly expressed in our JNA-population [8] viz. VEGFR1P1 corresponding to VEGFR; FGFR3P1 corresponding to FGFR3; PDGFAP1 corresponding to PDGFA; IL6RP1 corresponding to IL6R. In addition the fifth pseudogene viz. POU5F1B was selected since its parent gene POU5F1 a stem cell specific parental gene is mistakenly reported to be expressed in various cancers and preliminary work in our city laboratory has revealed a differential expression between these 2 (despite 98% sequence similarity) across different cell lines. Another reason for consideration was the evident regulatory role played by POU5F1B on the mutation of Beta-catenin that can potentially regulate POU5F1B expression and the role of beta-catenin has already been appreciated in our JNA population [9]. Due to financial constraints only VEGFR1P1 and VEGFR could be analyzed in 10 cases while others in only 5 cases.
Immediately following surgical excision a small part of tumor specimen was sent for molecular processing. These snap frozen samples were transported to the laboratory for RNA extraction that was undertaken as follows: Total RNA was extracted from 10 frozen sample tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The RNA integrity was evaluated using the Nano Drop ND-1000 spectrophotometer. Reverse transcription of the RNA was done using the iScript cDNA synthesis kit (Borad) using manufacturer’s instructions. Gene expression in sample tissues was measured using qPCR and SYBR Gren premix reagent (Biorad). The primers used for study are depicted in Table 1.
Table 1.
Primers used for genes and pseudogenes
| GAPDH_F: | ACCACAGTCCATGCCATCAC |
| GAPDH_R: | TCCACCACCCTGTTGCTGTA |
| (VEGFR1) FLT1_F: | TCCCTTATGATGCCAGCAAGT |
| VEGFR1) FLT1_R: | CCAAAAGCCCCTCTTCCAA |
| (VEGFR1P1) FLT1P1_F: | CTTTTGCCAAATGCCACCTC |
| (VEGFR1P1)FLT1P1_R: | CTGATGTGCCCACTGTTGGA |
| VEGFRP1_F: | GGTATGGAGAAAACCCTCCTT |
| VEGFRP1_R: | AGGCTTCGTGTCAAACTCTA |
| POU5F1_F: | GATGGCGTACTGTGGGCC |
| POU5F1_R: | ACCCTGAGGAGGCCCAAAAC |
| POU5F1B_F: | CAGAAACCCTCTTGCAGGCT |
| POU5F1B_R: | CTTGGTGTGAGCCTGGTGTA |
| IL6R_F: | CCCCTCAGCAATGTTGTTTGT |
| IL6R_R: | CTCCGGGACTGCTAACTGG |
| IL6RP1_F: | ATCGGGCTGAACGGTCAAAG |
| IL6RP1_R: | GGCGTCGTGGATGACACAG |
| FGFR3_F: | TGCGTCGTGGAGAACAAGTTT |
| FGFR3_R: | GCACGGTAACGTAGGGTGTG |
| FGFR3P1_F: | TTAACACTTCTTACGCAATGCT |
| FGFR3P1_R: | GCCCAGTAACAGTACAGAACGA |
| PDGFA_F: | GCAAGACCAGGACGGTCATTT |
| PDGFA_R: | GGCACTTGACACTGCTCGT |
| PDGFAP1_F: | CAAAGGAGCTTTCGAGGAGAG |
| PDGFAP1_R: | GTGGCATCGTCTTTTGCTTTC |
In brief, 2ug of total RNA was converted into cDNA according to the manufacturer’s protocol. The prepared cDNA was diluted to a final volume of 400 ul in nuclease free water. A total volume of 20ul reaction mixture was set with the thus prepared cDNA. The reaction mixture comprised of (1) 2X Sybr green mix reagent = 10 ul; (2) Forward Primer (10 uM) = 1ul; (3) Reverse primer (10 uM) = 1 ul; (4) cDNA (diluted to 400 ul) = 2 ul; (5) Water = 6 ul. The quantitative real-time PCR reaction was performed with an initial denaturation step of 10 min at 95 °C; and 40 cycles of 95 °C (5 s), 60 °C (15 s), 72 °C (15 s) with a final extension step at 72 °C for 5 min. All experiments were performed in triplicate. All samples were normalized to GAPDH. The normalized expression fold changes were calculated using the delta-delta-Ct method. All the PCR products were confirmed by Sanger sequencing. The expression differences between the sample tissues and control samples were analyzed using Student’s t-test. A value of p < 0.005 was considered statistically significant.
Results
The age of patients ranged from 12 to 22 years (mean 15.7) and all were males. These presented primarily with nasal blockage and moderate to severe epistaxis. The radiological staging of disease varied from stage IIA to IIIA as per Mishra criteria [10] and stage I–IIC as per Radkowsy criteria [11]. All the cases had uneventful postoperative phase and were discharged as usual. Table 2 depicts the clinical summary of the cases along with the individual data pertaining to the expression profiles of pseudogenes and their parent genes while Table 3 depicts the mean expressions of 5 pseudogenes along with their corresponding parental genes. The parental genes IL6R, PDGFA, VEGFR2, FGF3 were found to be highly expressed in JNA but stem factor POU5F1 did not show any significant expression. Accordingly their corresponding pseudogenes were either highly expressed (VEGFR1P1, PDGFAP1, IL6RP1 and FGFR3P1) or minimally expressed (POU5F1B).
Table 2.
Clinical characteristics of cases and Normalized Fold Change of Expression with respect to GAPDH
| Case1 | Case2 | Case3 | Case4 | Case5 | Case6 | Case7 | Case8 | Case9 | Case10 | |
|---|---|---|---|---|---|---|---|---|---|---|
| Age | 18 | 14 | 12 | 17 | 12 | 14 | 18 | 12 | 22 | 18 |
| Gender | M | M | M | M | M | M | M | M | M | M |
| Stage (R) | IIA | IIA | IIC | IIA | IIA | IIA | IIC | I | IIC | IIC |
| Stage (M) | IIA | IIA | IIIA | IIA | IIA | IIA | IIIA | IIA | IIIA | IIIA |
| Tumour volume (ml) | 10 | 5 | 20 | 15 | 20 | 5 | 10 | * | 15 | 10 |
| Intraoperative Bleed (ml) | 100 | 500 | 1200 | 500 | 100 | 1700 | 200 | 700 | 350 | 1600 |
| Preoperative embolization | No | No | No | No | No | No | No | No | No | No |
| Recurrence | No | No | Yes | No | No | No | No | Yes | Yes | Yes |
| IL6RP1 | 7.6 | 4.7 | 5.3 | 8.7 | 7.9 | – | – | – | – | – |
| IL6R | 18 | 22.3 | 19.3 | 21.7 | 21.9 | – | – | – | – | – |
| PDGFRP1 | 5.3 | 7.3 | 6.4 | 8.7 | 5.9 | – | – | – | – | – |
| PDGF1 | 4.3 | 5.7 | 5.9 | 5.4 | 6.1 | – | – | – | – | – |
| VEGFR1P1 | 18.9 | 16.2 | 22.8 | 20.5 | 22.4 | 22.9 | 23.8 | 28.1 | 18.4 | 17.1 |
| VEGFR | 13.7 | 13.2 | 16.3 | 14.9 | 13.6 | 18.3 | 12.8 | 17.4 | 14.7 | 16.3 |
| FGFR3P1 | 3.3 | 4.7 | 4.3 | 5.7 | 5.1 | – | – | – | – | – |
| FGFR3 | 7.4 | 9.5 | 9.8 | 7.5 | 8.3 | – | – | – | – | – |
| POU5F1B | 1.2 | 1.6 | 1.7 | 0.8 | 1.1 | – | – | – | – | – |
| POU5F1 | 1 | 0.7 | 1.2 | 2.1 | 1.8 | – | – | – | – | – |
*volume could not be defined as use of cautery during endoscopic excision grossly shrunk the tumor. M male;
Table 3.
Standard deviation and mean expression values of pseudogenes and parental genes
| Median values | Standard deviation | |
|---|---|---|
| IL6RP1 | 7.6 | 1.740114939 |
| IL6R | 21.7 | 1.886266153 |
| PDGFAP1 | 6.4 | 1.32740348 |
| PDGFA | 5.7 | 0.708519583 |
| VEGFR1P1 | 21.6 | 4.16664013 |
| VEGFR | 15.1 | 1.88686031 |
| FGFR3P1 | 4.7 | 0.901110426 |
| FGFR3 | 8.3 | 1.111305539 |
| POU5F1B | 1.2 | 0.37013511 |
| POU5F1 | 1.2 | 0.577061522 |
It is further worth noting that the differences in expressions of, PDGFA, VEGFR, FGF3 and POU5F1 with their corresponding pseudogenes were apparently lesser than the significant variation noted between IL6R expressions with its corresponding pseudogene IL6RP1. While 3 pseudogenes (VEGFR1P1, PDGFAP1, POU5F1B) were expressed more than their parent gene, the IL6RP1 and FGFR3P1 showed reduced expression. There was no significant difference between the molecular expressions of either the parental or their respective pseudogenes between recurrent and upfront cases.
Discussion
This pilot study indicates that these 4 genes that are already established for JNA in our population [8] do express pseudogenes as well. It is further suggested that the pseudogene behavior usually parallels their parental gene expression, except for the degree of proportionality of expression that seems to vary. While 3 pseudogenes showed enhanced expression compared to their parental genes, the other 2 pseudogenes showed a reverse trend. The trends of expression of first 4 PGs with their parental genes as depicted in the individual data (Tables 2 and 3) are pretty constant with no extraordinary outlier to violate the trend. However POU5F1B and POU5F does not appear to be related to the JNA per se and moreover their trends are also somewhat inconsistent. Figure 1 summarizes the relative expressions of all the pseudogenes and their respective parental genes.
Fig. 1.

Relative distribution of mean expressions of Genes and Pseudogenes
The behavior of pseudogenes has not yet been reported for JNA till date and hence this pilot study was undertaken for the first time to investigate its trend. Although some definite suggestibility was seen regarding the same, still this study has many limitations. Firstly the sample size is very small to be conclusive otherwise. Secondly the financial restrictions limited the inclusion of only 5 pseudogenes. The proportionality of expression as seen in this pilot study definitely needs further validation as majority of the following discussion is rather a calculated speculation and only a hypothesis.
It may be possible that only the expression of parental gene IL6R (not its respective pseudogenes) may reflect (1) some simultaneously ongoing pro-inflammatory process that is less likely considering its consistency in all the cases; (2) that IL6RP1 minimally participates in tumour kinetics or is simultaneously downregulated with inflammation. Therefore a sizable difference in their expressions may have become evident in current study. However the former point is supported by the fact that since our population of JNA is well known to show the strongest expression of VEGF [8] (stronger than IL6) some ongoing inflammatory environment (probably) would have been dominant in this series contributing to ‘highest’ expression of IL6R. Alternatively the well-established implication of VEGF as seen in our [8] JNA population (as well as in other global studies) may reflect the composite expression of both VEGF and its pseudogenes leading to this extremely high expression of VEGFR (exceeding the composite expression of IL6); the actual expression of VEGF may in fact be much lesser towards the overall composite effect accordingly. So all the pseudogenes cannot be similarly implicated as their parental genes in JNA. Overall such conclusions cannot be drawn unless further validation.
On the other hand it was seen that expression of FGFR3P1 (as IL6RP1) is although enhanced but is still lesser than its parent gene. This may suggest a reduced tendency of gene duplications (of FGFR3/IL6R) as compared to the other markers and also that pseudogenization may sometimes be adaptive especially as gene expression becomes deleterious, due to changes of the genetic background or environmental influences. Such environmental challenges are already reported with evolving pattern of presentation of JNA [2]. In addition maximum standard deviation was appreciated for expression of VEGFR1P1 that may further indicate a high rate of genetic events underlying its parent gene or even suggests its differential ability to modulate the parental gene activity. Both the factors can explain the wide range of bleeding seen during surgery and accordingly a substantially different expressions in individual cases can also be appreciated in individual data (Table 2). Overall a very complex interplay exists between the various molecular pathways that is likely to be further influenced by their respective (many) pseudogenes through many different mechanisms. Hence it needs a very systematic approach to unfold the specific molecular pathways for better understanding of underlying mechanism before instituting any targeted therapy.
The predominance of pseudogenes in general suggests that many very similar genes that perform very similar functions do co-exists and the tumor is unaffected by loss of function of any one of them. While mutations in one of these result in loss of function, the evolutionary pressure is relieved since the other gene substitutes its function. The enhanced levels of pseudogenes in comparison to the parental genes in JNA may indicate a continuous ongoing enhanced genomic activity possibly as a reaction to environmental challenges for tumour survival ultimately culminating in genomic evolution. The rapid rise of JNA incidence in the current decade as seen at our center points out towards the anticipated environmental insults such as exposure to pesticides, insecticides, plastic waste material, environmental pollution etc.[2].
The ongoing mutations in the JNA-genome may account for the sequence drift and hence a genetic evolution in past several decades may have translated into changed clinical/molecular pattern of disease worldwide [12]. This may also in part define the heterogeneity of JNA and its intractable course seen not very uncommonly. Being more abundant in JNA the pseudogenes are likely to influence parental gene expression also and whether they do it through the aforesaid mechanisms still needs to be worked upon. Similarly the proposed mechanisms by which new genes are generated such as gene duplication, transposable element protein domestication, lateral gene transfer, gene fusion, gene fission, and de novo origination may possibly be the underlying molecular dynamics of JNA. The multitude of speculations need to be validated in future studies as it is well evident now that pseudogenes may have some role in JNA. It is understood that study of pseudogenisation may assist in understanding the key phenotypic evolution as well as its genetic basis. Hence this pilot analysis encourages further investigation through future larger prospective studies to appreciate the heterogeneity and controversial etiopathogeneses of JNA for a better characterization and management.
Acknowledgements
The authors would like to primarily acknowledge the Senior Scientist Dr Dinesh K. Singh from Indian Institute of Toxicology Research, Lucknow for his main role in laboratory analysis and providing the relevant molecular data for clinical correlation.
Funding
No external funding was available. The authors used the usual hospital resources. The statistician contributed on an honorary basis only.
Data Availability
Yes.
Compliance with Ethical Standards
Conflict of interest
The authors declare that they have no conflict of interest.
Ethical Approval
Duly approved by Ethics committee of the Institutional Review Board of King George’s Medical University Lucknow India.
Consent to Participate
Written informed consent was obtained by all the participants.
Footnotes
This paper is a part of thesis work under chief supervision of Prof Anupam Mishra.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Zheng D, Gerstein MB. The ambiguous boundary between genes and pseudogenes: the dead rise up, or do they? Trends Genet. 2007;23:219–224. doi: 10.1016/j.tig.2007.03.003. [DOI] [PubMed] [Google Scholar]
- 2.Mishra A, Mishra SC. Changing trends in the incidence of juvenile nasopharyngeal angiofibroma: seven decades of experience at King George’s Medical University, Lucknow, India. J LaryngolOtol. 2016;130:363–368. doi: 10.1017/S0022215116000268. [DOI] [PubMed] [Google Scholar]
- 3.Handoussa AS, Fand H, Elwi AM. Nasopharyngeal fibroma; a clinico-pathological study of seventy cases. J LaryngolOtol. 1954;68:647–666. doi: 10.1017/S0022215100050106. [DOI] [PubMed] [Google Scholar]
- 4.Osborn DA. The so-called juvenile angio-fibroma of the nasopharynx. J LaryngolOtol. 1959;73:295–316. doi: 10.1017/S0022215100055341. [DOI] [PubMed] [Google Scholar]
- 5.Nicolai P, Schreiber A, Bolzoni VA. Juvenile angiofibroma: evolution of management. Int J Pediatr. 2012;2012:412545. doi: 10.1155/2012/412545. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Beham A, Beham-Schmid C, Regauer S, Aubock L, Stammberger H. Nasopharyngeal angiofibroma: true neoplasm or vascular malformation? AdvAnatPathol. 2000;7:36–46. doi: 10.1097/00125480-200007010-00006. [DOI] [PubMed] [Google Scholar]
- 7.Mishra A, Verma V, Mishra SC. Juvenile perinasalangiofibroma. Ind J Otolaryngol Head Neck Surg. 2017;69:67–71. doi: 10.1007/s12070-016-1050-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Pandey P, Mishra A, Tripathi AM, Verma V, Trivedi R, Singh HP, et al. Current molecular profile of juvenile nasopharyngeal angiofibroma: first comprehensive study from India. Laryngoscope. 2017;127:e100–e106. doi: 10.1002/lary.26250. [DOI] [PubMed] [Google Scholar]
- 9.Mishra A, Singh V, Verma V, Pandey S, Trivedi R, Singh HP, et al. Current status & clinical correlation of beta-catenin in juvenile nasopharyngeal angiofibroma. J LaryngolOtol. 2016;30:1–7. doi: 10.1017/S0022215116008690. [DOI] [PubMed] [Google Scholar]
- 10.Mishra SC, Shukla GK, Bhatia N, Pant MC. A rational classification of angiofibromas of the postnasal space. J LaryngolOtol. 1989;103:912–916. doi: 10.1017/S0022215100110497. [DOI] [PubMed] [Google Scholar]
- 11.Radkowski D, McGill DT, Healy GB, Ohlms L, Jones DT. Angiofibroma: changes in staging and treatment. Arch Otolaryngol—Head Neck Surg. 1996;122:122–129. doi: 10.1001/archotol.1996.01890140012004. [DOI] [PubMed] [Google Scholar]
- 12.Mishra A, Mishra SC, Pandey A. Variations in molecular expressions of juvenile nasopharyngeal angiofibroma. J LaryngolOtol. 2017;131(9):752–759. doi: 10.1017/S0022215117001372. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Yes.
