Abstract
The genetic modification of cattle has many agricultural and biomedical applications. However, random integration often leads to the unstable or differentially expression of the exogenous genes, which limit the application and development of transgenic technologies. Finding a safe locus suitable for site-specific insertion and efficient expression of exogenous genes is a good way to overcome these hurdles. In this study, we efficiently integrated three targeted vector into the cattle Rosa26 (cRosa26) by CRISPR/Cas9 technology in which EGFP was driven by CAG, EF1a, PGK and cRosa26 endogenous promoter respectively. The CRISPR/Cas9 knock-in system allows highly efficient gene insertion of different expression units at the cRosa26 locus. We also find that in the four cell lines, EGFP was stable expressed at different times, and the CAG promoter has the highest activity to activate the expression of EGFP, when compared with the cRosa26, EF1a and PGK promoter. Our results proved that cRosa26 was a locus that could integrate different expression units efficiently, and supported the friendly expression of different expression units. Our findings described here will be useful for a variety of studies using cattle.
Introduction
Genetically modified cattle hold great promise in the fields of agriculture and biomedicine, such as for improving the quality of milk [1], for producing the recombination of pharmaceutically active proteins [2, 3] and for improving resistance to zoonotic diseases [4, 5]. The traditional transgenic technique generally integrates exogenous genes into genome by random insertion. The integration site and the copy number cannot be accurately controlled, thus leading to the unstable or differentially expression of the exogenous genes, which limit the application and development of transgenic technologies. Site-specific integration maybe an effective way to overcome these hurdles [6].
In recent years, designer nucleases, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated 9 (Cas9), were reported to be suitable for genome editing in cattle [7–9]. Using these approaches, it is possible to integrate exogenous genes into a pre-selected locus with a single copy for comparative or subtractive gene function studies. Therefore, the selection of a “safe genomic acceptor site”, which is suitable for insertion and efficient expression of exogenous genes without perturbing the transcription of nearby endogenous genes, is of great importance [10].
Rosa26 is the most widely used "safe locus" in mammalian genome, which was first discovered by Friedrich and Soriano in mice [11]. The study of Rosa26 found that this loci can support the expression of exogenous genes at all stages of embryonic development and in all tissues of adults without adverse effects [12]. Now the targeted modification of Rosa26 in mice has been widely used in continuous and conditional expression of exogenous genes. These modification result in the establishment of several hundred mouse models, which play important roles in the basic study such as gene function, disease models and drug development research [13–15]. After the discovery of Rosa26 in mice, the Rosa26 locus of human [16], rat [17], pig [18, 19], rabbit [20] and sheep [21] were continually determined through comparative study. This locus were highly conserved in sequence, and supported stable and high expression of exogenous genes in all species. Recently, the cRosa26 locus has been characterized and targeted by a Cre-dependent reporter gene [22, 23]. However, whether this locus supports exogenous gene expression under exogenous promoter has not been verified.
To address this question, we constructed enhanced GFP (EGFP) reporter expression vectors driven by different promoters, CAG, PGK and EF1α, with the cRosa26 endogenous promoter as a control, and efficiently integrated four targeted vectors into the cRosa26 by CRISPR/Cas9 technology. We further conducted in vitro experiments to functionally validate its applicability. Our results may broad the use of safe locus cRosa26 in cattle.
Materials and methods
Ethics statement
This study was approved by the Institutional Animal Care and Use Committee of the China Agricultural University under approval number SKLAB-2014-07-05.
Construction of vectors
Vectors were constructed using standard molecular cloning methods. The cRosa26-PGK-NEO donor vector consisted of the 1.3 kb 5′ homology arm and the 1.2 kb 3′ homology arm flanking an neo gene and EGFP gene driven by CAG, EF1a and PGK promoter were inserted between the homologous arms. To construct CRISPR/Cas9 expression vectors, candidate sgRNAs were designed using online software programs, and each 20 bp target sequence was subcloned into the pX330 vector (Addgene 42230). All the vectors were confirmed through restriction digestion and Sanger sequencing.
Screening of highly efficient sgRNA
The editing activity of each sgRNA was first assayed by using T7EI (New England Biolabs, USA) as described previously [24]. Briefly, 4 μg of each CRISPR/Cas9 expression vector was nucleofected into 1 × 106 CFFs using Amaxa Nucleofector reagent (Lonza Group AG Basel, Switzerland) according to the manufacturer’s guidelines and the program T-016. After 72 h, the Cas9-treated cells were collected and the genomic DNA was extracted using a DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany). PCR amplicons including nuclease target sites were generated using the primers: Rosa26-F/Rosa26-R, the primers are listed in Table 1. The 700 bp PCR amplicons were denatured by heating and annealed to form heteroduplex DNA using a thermocycler and then digested with T7E1 for 30 min at 37°C and then analyzed using agarose gel electrophoresis. Mutation frequencies (indels, %) were calculated by quantifying the relative using ImageJ software. Then the PCR amplicons of the most efficient sgRNA were further analyzed by TA-cloning and a DNA sequencing analysis to confirm the induction of CRISPR-mediated mutations at the expected site.
Table 1. List of primers used in the present study.
| Primers | Sequence |
|---|---|
| ROSA26-F | GCCGCAATACCTTTATGGGAG |
| ROSA26-R | ATTGGTGGTGAAACCTGTCTG |
| P1 | GGCAGCAGGACTCGAGTTAG |
| P2 | TGGTGCAGATGAACTTCAGG |
| P3 | TGAATGAACTGCAGGACGAG |
| P4 | CCACATATCCAGGGCTCAAG |
| EGFP-F | GAACCGCATCGAGCTGAA |
| EGFP-R | TGCTTGTCGGCCATGATATAG |
| GAPDH-F | CATGTTTGTGATGGGCGTG |
| GAPDH-R | CATCGTGGAGGGACTTATGAC |
| SETD5-F | TGGATCCCATGTCAACCGTG |
| SETD5-R | TTCAGGGTCGTTGCCAGTAC |
| THUMPD3-F | AGGATCTTGGAAGCACTGCC |
| THUMPD3-R | TTCTGGGGCCACTTTCAGTC |
| LHFPL4-F | CTGCTTCGCCATCATCAACG |
| GATGGTGCTGAAGTCGGTGA | |
| LHFPL4-R | GATGGTGCTGAAGTCGGTGA |
| SRGAP3-F | TCTCTGACGCCTTCCAACAC |
| CTGGTTGGCTCTCCTCTTGG | |
| SRGAP3-R | CTGGTTGGCTCTCCTCTTGG |
Cell culture and transfection
The cell culture and transfection procedure was performed as previously described [22]. Briefly, primary CFFs were isolated from a Holstein cattle fetus by disaggregating the entire body, with the exception of the head and viscera, and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, Grand Island, New York, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco, Grand Island, New York, USA) at 37.5°C in an atmosphere of 5% CO2 and humidified air. Next, 4 μg of CRISPR/Cas9 expression vector and 4 μg of linearized donor vector were nucleofected into 1 × 106 CFFs using Amaxa Nucleofector reagent (Lonza Group AG Basel, Switzerland) according to the manufacturer’s guidelines and the program T-016. G418 (1 mg/ml) selection was used in cell colonies that formed within 48 h after transfection, and the cell density was approximately 1 × 105 cells/dish (10 cm). Individual cell clones were isolated 7–10 days after G418 selection, and then were expanded and cultured. Finally, for each individual cell clones one-third of them were used for extracting the genomic DNA and analysis of integration, and two-thirds of them were frozen for further analysis.
Identification of positive cell clones by PCR
To identify positive cell clones, genomic DNA was extracted from a single cell clone using a DNeasy Blood and Tissue kit (Qiagen). To confirm the successful generation of targeted clones, two pairs of primers located between the donor and outside of the 5’ or 3’ homologous arm were used: the P1/P2 primer pair was used for the 5’ arm, and the P3/P4 primer pair was used for the 3’ arm. For the successful production of Rosa26-CAG-EGFP-targeted cells, the expected amplicon were 3.6 kb and 2.4 kb; For the successful production of Rosa26-PGK-EGFP-targeted cells, the expected amplicon were 2.4 kb and 2.4 kb; For the successful production of Rosa26-EF1a-EGFP-targeted cells, the expected amplicon were 2.5 kb and 2.4 kb; For the successful production of Rosa26-EGFP-targeted cells, the expected amplicon were 2.0 kb and 2.4 kb. The PCR procedure was performed using LA-Taq (Takara), with initial DNA denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 60°C for 30 s and 72°C for 2–4 min and a final 10-min extension. The PCR products were sequenced by TA cloning. All the primers are listed in Table 1.
Q-PCR analyses
The Q-PCR was performed as previously described [22]. Briefly, total mRNAs were extracted from various targeted cells using Trizol Reagent (Thermo Fisher Scientific, Waltham, MA, USA) prior to performing Q-PCR analyses. The cDNA templates were synthesized using a FastQuant RT Kit (Tiangen, China), and the genomic DNA was then digested with DNase I. Primers EGFP-F/ EGFP-R were used to detect EGFP. Primers SETD5-F/SETD5-R were used to detect SETD5. Primers THUMPD3-F/THUMPD3-R were used to detect THUMPD3. Primers LHFPL4-F/ LHFPL4-R were used to detect LHFPL4. Primers SRGAP3-F/SRGAP3-R were used to detect SRGAP3. Primers GAPDH-F/GAPDH-R were used to amplify cattle GAPDH as the reference. Q- PCR was performed using SYBR Premix Ex Taq (TaKaRa, RR820A) and the 7500 Real-Time PCR System (Applied systems), with the following parameters: 95°C for 30 s, followed by 40 two-step cycles at 95°C for 5 s and at 60°C for 4 s. The relative expression level of each gene was calculated by the ΔΔCt method, normalized to GAPDH expression.
Western blotting
The Western blotting was performed as previously described [22]. Briefly, samples were isolated from targeted cells and wild-type (WT) cells and homogenized in cell lysis buffer for Western and IP analyses (Beyotime, Shanghai, China). After centrifugation at 10000 g for 10 min at 4°C, the total protein supernatants were collected, and protein concentrations were measured using a BCA Protein Assay kit (Beyotime, Shanghai, China). Approximately 20 μg of protein was separated on 10% SDS-PAGE gels and transferred to Immobilon-P membranes (MilliporeSigma, Burlington, MA, USA). After blocking in 3% BSA in TBST for 1 h, membranes were incubated with a EGFP antibody (dilution, 1:10000; Abcam, Cambridge, MA, USA) or cattle GAPDH antibody (dilution, 1:10000; Abcam, Cambridge, MA, USA) overnight at 4°C. After washes with TBST, membranes were incubated with a goat anti-rabbit antibody conjugated with horseradish peroxidase (dilution, 1:20000; Sino-American Co, Beijing, China) for 1 h followed by three washes with TBST. Protein signals were detected using an ECL Chemiluminescence kit (Thermo Fisher Scientific, Waltham, MA, USA).
Results
Screening of sgRNA with high cleavage efficiency to cRosa26
In this study, we selected the intron of the cRosa26 locus for targeting and designed 3 guide RNAs (sgRNAs) (Fig 1A). To evaluate the transfection efficiency of CRISPR-targeting plasmids (sgRNA 1–3) in cattle fetal fibroblasts (CFFs), T7 endonuclease 1 (T7E1) assay was used. The CRISPR-targeting plasmids were transfected into the CFFs by electroporation. After 72 h, the genome of the CFFs was extracted and analyzed. sgRNA-1 cleaved the target site with the greatest efficiency, as evidenced by the increased incidence of allelic mutations (non-homologous end joining (NHEJ) frequency) (Fig 1B). TA-cloning and a DNA sequencing analysis of the PCR amplicons corroborated the induction of CRISPR-mediated mutations at the endogenous site (Fig 1C). Therefore, we used CRISPR-sgRNA-1 in subsequent experiments.
Fig 1. CRISPR/Cas9 induced targeted mutations at the cRosa26 locus.
(A) Modification of the cRosa26 locus by CRISPR/Cas9. The CRISPR/Cas9 target sequences (20-bp target and 3-bp PAM sequence (colored in red)) are shown. (B) Representative results of T7EI assays. The mutation frequencies (% indels) of different sgRNAs were calculated by measuring the band intensities. M, 100-bp DNA ladder; WT, wild-type control cells; sgRNA-1, sgRNA-1-transfected cells; sgRNA-2, sgRNA-2-transfected cells; sgRNA-3, sgRNA-3-transfected cells. (C) Representative sequencing results of the TA clones revealing different indel mutations mediated by sgRNA-1 in the target site.
Efficient CRISPR/Cas9-mediated site-specific integration into the cRosa26 locus
To check whether the cRosa26 locus allowed widely and high activity of ubiquitous promoter, we chosen three ubiquitous promoters, CAG, EF1a and PGK, which were used commonly in genetically modified cattle, with the cRosa26 endogenous promoter as a control, to drive EGFP into the cRosa26 locus by traditional HR strategy (Fig 2A and S1 Fig). CFFs were electroporated with the linearized targeting vector accompanied by CRISPR-sgRNA-1. After selection with G418 (1 mg/ml from day 7 to day 10), 47 EF1a-EGFP, 48 CAG-EGFP, 50 PGK-EGFP, 28 EGFP (cRosa26-EGFP) cell clones were screened and expanded, respectively. As shown in Table 2, based on PCR analyses of the 5′- and 3′-arms, 39 of the 47 clones (EF1a-EGFP), 42 of the 48 clones (CAG-EGFP), 39 of the 50 clones (PGK-EGFP) and 24 of the 28 clones (cRosa26-EGFP) were correctly targeted. The PCR results of several positive clones are shown in Fig 2B and S1 Fig.
Fig 2. CRISPR/Cas9-mediated targeted site-specific integration at the cRosa26 locus.
(A) Schematic diagram of the cRosa26 HDR template vector and strategy for insertion of various EGFP expression cassette into the cRosa26 locus. EGFP, enhanced green fluorescent protein gene; NEO, neomycin-resistance gene; EGFP driven by CAG, PGK, and EF1α promoter, respectively. (B) PCR analysis of knock-in cell lines using the primer sets shown in A. M, 1 kb DNA ladder; C1-C6, the positive targeted integration of CAG-EGFP cassettes cell clones; P1-P6, the positive targeted integration of PGK-EGFP cassettes cell clones; E1-E6, the positive targeted integration of EF1α-EGFP cassettes cell clones; WT, wild-type cFFs; P, the donor vector; H2O was the negative control.
Table 2. Summary of the PCR results of G418-resistant targeted clones.
| Targeting Vector | Screening method | Isolated colonies | positive cell colonies | Targeting efficiency (%) |
|---|---|---|---|---|
| Targeting-EF1a-EGFP | G418 | 47 | 39 | 82.9 (42/47) |
| Targeting-CAG-EGFP | G418 | 48 | 42 | 87.5 (42/48) |
| Targeting-PGK-EGFP | G418 | 50 | 39 | 78.0 (39/50) |
| Targeting- EGFP | G418 | 28 | 24 | 85.7 (24/28) |
Then, 5 potential off-target sites were selected according to an online design tool Cas-OFFinder (http://www.rgenome.net/cas-offinder/), and 3 EGFP-positive cell clones were evaluated. T7E1 assay showed that no off-target mutations were detectable in any of the potential off-target sites or these EGFP-positive cell clones (Fig 3A–3C). The sequences of the top 5 possible off-target sites are listed in Table 3.
Fig 3. Off-target effect analysis of targeted site-specific integration cell clones.
(A) T7E1 assays for the five-potential off-target sites of the correctly CAG-EGFP targeted cells. OT1-OT5 represents 5 potential off-target sites. (B) T7E1 assays for the five-potential off-target sites of the correctly EF1a-EGFP targeted cells. OT1-OT5 represents 5 potential off-target sites. (C) T7E1 assays for the five-potential off-target sites of the correctly PGK-EGFP targeted cells. OT1-OT5 represents 5 potential off-target sites. (D) T7E1 assays for the five-potential off-target sites of the correctly cRosa26-EGFP targeted cells. OT1-OT5 represents 5 potential off-target sites.
Table 3. List of the top 5 potential off-target effects of cROSA26.
| Off-target sites | Sequence | Mismatch |
|---|---|---|
| Target sgRNA | GGTGGAGTGAAATGAAGTCCAGG | |
| Site1 | GGTGGAGTGAgAgGAAGTCCTGG | 2bp |
| Site2 | GGaGGAtTGAAATGAAGcCCAGG | 3bp |
| Site3 | GGTGGtaTGtAATGAAGTCCAGG | 3bp |
| Site4 | GaTGGAaTGAAATGAAGgCCAGG | 3bp |
| Site5 | GGTaGAGTGAtAaGAAGTCCAGG | 3bp |
Characterization of EGFP expressions under the ubiquitous promoter on the cRosa26 locus
Then, EGFP expression with four different promoters (CMV, PGK, EF1α and cRosa26 promoter) was detected. Fluorescence microscope observation and Western blot analysis showed EGFP expressions were incomparable levels among the three cell lines, and the CAG promoter has the highest activity to activate the expression of EGFP in this locus, when compared with the EF1a, PGK and the cRosa26 endogenous promoter (Fig 4A and 4B). We further monitored EGFP expression driven by three promoters over a 30-day period. Results demonstrated that all the three promoters could support stable EGFP expression, and exhibited a similar expression trend that increased first and then stabilized (Fig 4C–4G). Subsequently, we used the positive targeted cells as donors to perform NT. As shown in Fig 5, EGFP was expressed in the blastocyst stage. These data suggest that cRosa26 is suitable for transgene expression driven by different promoters in a high and stable manner.
Fig 4. Characterization of EGFP expressions driven by different promoters.
(A) EGFP expression in correctly targeted cells 15 d after transduction. The scale bar is 400 μm. (B) EGFP expression in correctly targeted cells detected by Western blot. (C) Stable EGFP expression in correctly targeted cells during 30 d after transduction analyzed by Q-PCR (Mean ± SD, n = 3). (D) Stable EGFP expression in correctly CAG-EGFP targeted cells during 30 d after transduction analyzed by Western blot (Mean ± SD, n = 3). (E) Stable EGFP expression in correctly EF1a-EGFP targeted cells during 30 d after transduction analyzed by Western blot (Mean ± SD, n = 3). (F) Stable EGFP expression in correctly PGK-EGFP targeted cells during 30 d after transduction analyzed by Western blot (Mean ± SD, n = 3). (G) Stable EGFP expression in correctly cRosa26-EGFP targeted cells during 30 d after transduction analyzed by Western blot (Mean ± SD, n = 3). (H) Expression fold change of nearby genes before and after exogenous DNA integration. For all genes, n = 3, mean ± SD, and *p < 0.05. Expression of each gene before integration is used as a control.
Fig 5. EGFP expressions driven by different promoters in bovine embryos.
Discussion
Continuous and stable expression of foreign genes in vivo or in vitro is important for basic research and application of transgenic technologies. The traditional transgenic technique generally integrates foreign genes into genome by using plasmid transfection, viral transduction or transposons. Among viral transduction, lentivirus-mediated gene transfer has successfully been applied to transgenic cattle [25]. Although viral gene delivery has advantages for efficient genome integration, viral infection may cause activation of proto-oncogene, resulting in potential of tumorigenesis [26]. By zygotic injection using DNA transposons such as the Piggybac (PB), Sleeping beauty (SB), transgenic cattle and multi-gene transgenic cattle could be efficiently generated, which greatly improved the transposon system and broadened the application of zygotic injection to prepare transgenic cattle [27, 28]. However, like the viral transfection, the integration of foreign genes mediated by transposons is still a random integration. The integration site and the copy number can not be accurately controlled, thus leading to the unstable or differentially expression of the exogenous genes. In addition, transgenic individuals prepared by zygotic injection cannot avoid the occurrence of chimerism. Therefore, it is not suitable for the preparation of cattle with long gestation (9 months) and long generation interval (22–26 months).
In recent years, with the rapid development of site-specific integration technology based on homologous recombination technique, it is possible to integrate exogenous genes into a pre-selected locus with a single copy so as to overcome the defects of random integration. Therefore, find a safe locus suitable for insertion and efficient expression of exogenous genes is of great importance. Rosa26 is the most widely used "safe locus" in mammalian genome. In previous study, the cattle Rosa26 was proved to be a "safe locus" to support the stable expression of foreign genes under its endogenous promoter [22]. As the expression of foreign genes is often related to promoter activity, therefore, to further improve the expression of foreign genes, a stronger promoter often needed. Meanwhile, exogenous promoters in different species or different locus have different effects on gene expression due to different chromosomal environment, and the insertion of promoters with different intensities at the same site has different effects on the expression of neighboring genes [6, 10, 29]. So, exploring the related characteristics of different active promoters at cRosa26 locus is necessary and helpful to broaden the wide application of cRosa26 locus.
The study of mouse Rosa26 found that the endogenous promoter of Rosa26 was a medium-strength promoter, and its activity in initiating exogenous gene expression was different from that of the strong promoter CAG [30]. Studies on Rosa26 in pigs found that the endogenous promoter of Rosa26 had weaker activity in initiating exogenous gene expression than EF1a, CMV and CAG [31]. For the expression of exogenous genes, we often need to select appropriate promoters. For example, for the expression of exogenous genes in milk, we often need to use mammary gland specific promoters. Therefore, whether cRosa26 locus can support various promoter to initiate exogenous gene friendly expression need to be studied.
In this study, three broad-spectrum promoters EF1a, CAG and PGK commonly used in large animal transgenic were selected as promoters to drive EGFP gene, as the cRosa26 endogenous promoter was a control. We successfully constructed four expression units, and targeted to cRosa26 locus under the mediation of CRISPR/Cas9. According to our statistical results, there was no significant difference in the site-specific integration efficiency of cRosa26 for the three expression units, and the efficiency was ranged from 78% to 87.5%, which proved that cRosa26 was a locus that could integrate foreign genes efficiently. EGFP expression analysis was performed on the correctly targeted cells of the four expression units. It was found that the three broad-spectrum promoters could continuously and stably initiate EGFP expression at the cRosa26 locus, and the activity of CAG promoter was higher than that of EF1a and PGK promoters and even the cRosa26 endogenous promoter which provided strong evidence that cRosa26 supported the friendly expression of different expression units. Our findings described here will be useful for a variety of studies using cattle.
Conclusions
In conclusions, we proved that cRosa26 was a locus that could integrate different expression units efficiently, and supported the friendly expression of different expression units. Our findings described here will be useful for a variety of studies using cattle.
Supporting information
(A) Schematic diagram of the cRosa26 HDR template vector and strategy for insertion of EGFP expression cassette into the cRosa26 locus. EGFP, enhanced green fluorescent protein gene; NEO, neomycin-resistance gene. (B) PCR analysis of knock-in cell lines using the primer sets shown in A. M, 1 kb DNA ladder; R1-R4, the positive targeted integration of EGFP-NEO cassettes cell clones; WT, wild-type cFFs; P, the donor vector; H2O was the negative control.
(TIF)
The sequence underlined is the sequence of the 5’ homologous arm targeting the cattle Rosa26. The sequence colored in pink indicates the PGK Promoter. The sequence colored in green indicates the EGFP gene. The sequence colored in yellow indicates the PGK-NEO-polyA casstte used for cell selection. The sequence underlined and bolded is the 3’ homologous arm targeting the cattle Rosa26.
(PDF)
The sequence underlined is the sequence of the 5’ homologous arm targeting the cattle Rosa26. The sequence colored in pink indicates the CAG Promoter. The sequence colored in green indicates the EGFP gene. The sequence colored in yellow indicates the PGK-NEO-polyA casstte used for cell selection. The sequence underlined and bolded is the 3’ homologous arm targeting the cattle Rosa26.
(PDF)
The sequence underlined is the sequence of the 5’ homologous arm targeting the cattle Rosa26. The sequence colored in pink indicates the EF1a Promoter. The sequence colored in green indicates the EGFP gene. The sequence colored in yellow indicates the PGK-NEO-polyA casstte used for cell selection. The sequence underlined and bolded is the 3’ homologous arm targeting the cattle Rosa26.
(PDF)
(PDF)
(PDF)
Acknowledgments
The authors gratefully acknowledge the ‘‘College of Animal Science and Technology, China Agricultural University” and “Key Laboratory of Songliao Aquatic Environment, Ministry of Education, School of Municipal and Environmental Engineering, Jilin Jianzhu University” group for helpful discussions.
Data Availability
All relevant data are within the paper and its Supporting information files.
Funding Statement
This study was financially supported by the National Natural Science Foundation of China (No. 51808255) awarded to YXX; the Agricultural Variety Improvement Project of Shandong Province (No. 2019LZGC011) awarded to MW and Jilin Province Education Department Science and Technology Research Project (No. JJKH20210305KJ) awarded to YXX. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Brophy B, Smolenski G, Wheeler T, Wells D, L"Huillier P, Laible G. Cloned transgenic cattle produce milk with higher levels of beta-casein and kappa-casein. Nat Biotechnol. 2003;21(2):157–162. doi: 10.1038/nbt783 [DOI] [PubMed] [Google Scholar]
- 2.Berkel PV, Welling MM, Geerts M, Veen HV, Ravensbergen B, Salaheddine M, et al. Large scale production of recombinant human lactoferrin in the milk of transgenic cows. Nat Biotechnol. 2002;20(5):484–487. doi: 10.1038/nbt0502-484 [DOI] [PubMed] [Google Scholar]
- 3.Wang M, Sun Z, Yu T, Ding F, Li L, Wang X, et al. Large-scale production of recombinant human lactoferrin from high-expression, marker-free transgenic cloned cows. Rep. 2017;7(1):e10733. doi: 10.1038/s41598-017-11462-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Wall RJ, Powell AM, Paape MJ, Kerr DE, Bannerman DD, Pursel VG, et al. Genetically enhanced cows resist intramammary Staphylococcus aureus infection. Nat Biotechnol. 2005;23(4):445–451. doi: 10.1038/nbt1078 [DOI] [PubMed] [Google Scholar]
- 5.Wu H, Wang Y, Zhang Y, Yang M, Yong Z. Tale nickase-mediated sp110 knockin endows cattle with increased resistance to tuberculosis. P Natl Acad Sci USA. 2015;112(13):1530–1539. doi: 10.1073/pnas.1421587112 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Lombardo A, Cesana D, Genovese P, Di SB, Provasi E, Colombo DF, et al. Site-specific integration and tailoring of cassette design for sustainable gene transfer. Nat methods. 2011;8(10):861–869. doi: 10.1038/nmeth.1674 [DOI] [PubMed] [Google Scholar]
- 7.Proudfoot C, Carlson DF, Huddart R, Long CR, Pryor JH, King TJ, et al. Genome edited sheep and cattle. Transgenic Res. 2015;24(1):147–153. doi: 10.1007/s11248-014-9832-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zhou W, Guo R, Deng M, Wang F, Zhang Y. Rs-1 enhanced the efficiency of crispr-cas9 mediated knock-in of human lactoferrin. Shengwu Gongcheng Xuebao/Chinese journal of biotechnology. 2017;33(8):1224–1234. doi: 10.13345/j.cjb.170105 [DOI] [PubMed] [Google Scholar]
- 9.Sun Z, Wang M, Han S, Ma S, Zou Z, Ding F, et al. Production of hypoallergenic milk from DNA-free beta-lactoglobulin (BLG) gene knockout cow using zinc-finger nucleases mRNA. Sci Rep-UK. 2018;8(1):e15430. doi: 10.1038/s41598-018-32024-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sadelain M, Papapetrou EP, Bushman FD. Safe harbours for the integration of new DNA in the human genome. Nat Rev Cancer. 2012;12(1):51–58. [DOI] [PubMed] [Google Scholar]
- 11.Friedrich G, Soriano P. Promoter traps in embryonic stem-cells: a genetic screen to identify and mutate developmental genes in mice. Gene Dev. 1991;5(9):1513–1523. doi: 10.1101/gad.5.9.1513 [DOI] [PubMed] [Google Scholar]
- 12.Zambrowicz BP, Imamoto A, Fiering S, Herzenberg LA, Kerr WG, Soriano P. Disruption of overlapping transcripts in the Rosa β geo 26 gene trap strain leads to widespread expression of β-galactosidase in mouse embryos and hematopoietic cells. Proc. Natl. Acad. Sci. 1997;94(8):3789–3794. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Amitai-Lange A, Berkowitz E, Altshuler A, Dbayat N, Nasser W, Suss-Toby E, et al. A method for lineage tracing of corneal cells using multi-color fluorescent reporter mice. J Vis Exp. 2015;106:e53370. doi: 10.3791/53370 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Dow LE, Fisher J, O’Rourke KP, Muley A, Kastenhuber ER, Livshits G, et al. Inducible in vivo genome editing with CRISPR/Cas9. Nat Biotechnol. 2015;33(4):390–394. doi: 10.1038/nbt.3155 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Alberto RD, Daniel S, Joyner AL. Altered paracrine signaling from the injured knee joint impairs postnatal long bone growth. Elife. 2017;6:e27210. doi: 10.7554/eLife.27210 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Keller G, Irion S, Luche H, Gadue P, Fehling HJ, Kennedy M. Identification and targeting of the Rosa26 locus in human embryonic stem cells. Nat Biotechnol. 2007;25(12):1477–1482. doi: 10.1038/nbt1362 [DOI] [PubMed] [Google Scholar]
- 17.Kobayashi T, Kato-Itoh M, Yamaguchi T, Tamura C, Sanbo M, Hirabayashi M, et al. Identification of rat Rosa26 locus enables generation of knock-in rat lines ubiquitously expressing tdtomato. Stem Cells Dev. 2012;21(16):2981–2986. doi: 10.1089/scd.2012.0065 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Li S, Flisikowska T, Kurome M, Zakhartchenko V, Kessler B, Saur D, et al. Dual fluorescent reporter pig for Cre recombination: transgene placement at the Rosa26 locus. PLoS One. 2014;9(7):e102455. doi: 10.1371/journal.pone.0102455 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Li X, Yang Y, Bu L, Guo X, Tang C, Song J, et al. Rosa26-targeted swine models for stable gene over-expression and Cre-mediated lineage tracing. Cell Res. 2014;24(4):501–504. doi: 10.1038/cr.2014.15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Yang D, Song J, Zhang J, Xu J, Zhu T, Wang Z, et al. Identification and characterization of rabbit Rosa26 for gene knock-in and stable reporter gene expression. Sci Rep-UK. 2016;6(1):e25161. doi: 10.1038/srep25161 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Wu M, Wei C, Lian Z, Liu R, Zhu C, Wang H, et al. Rosa26-targeted sheep gene knock-in via crispr-cas9 system. Sci Rep-UK. 2016;6(1):e24360. doi: 10.1038/srep24360 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Wang M, Sun Z, Zou Z, Ding F, Li L, Wang H, et al. Efficient targeted integration into the bovine Rosa26 locus using talens. Sci Rep-UK. 2018;8(1):e10385. doi: 10.1038/s41598-018-28502-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Yuan M, Zhang J, Gao Y, Yuan Z, Zhu Z, Wei Y, et al. Hmej-based safe-harbor genome editing enables efficient generation of cattle with increased resistance to tuberculosis. J Biol Chem. 2021;296:e100497. doi: 10.1016/j.jbc.2021.100497 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kim HJ, Lee HJ, Kim H, Cho SW, Kim JS. Targeted genome editing in human cells with zinc finger nucleases constructed via modular assembly. Genome Res. 2009;19(7):1279–1288. doi: 10.1101/gr.089417.108 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Hofmann A, Zakhartchenko V, Weppert M, Sebald H, Wenigerkind H, Brem G, et al. Generation of transgenic cattle by lentiviral gene transfer into oocytes. Biol Reprod. 2004;71(2):405–409. doi: 10.1095/biolreprod.104.028472 [DOI] [PubMed] [Google Scholar]
- 26.Bushman F, Lewinski M, Ciuffi A, Barr S, Leipzig J, Hannenhalli S, et al. Genome-wide analysis of retroviral DNA integration. Nat Rev Microbiol. 2005;3(11):848–858. doi: 10.1038/nrmicro1263 [DOI] [PubMed] [Google Scholar]
- 27.Garrels W, Talluri TR, Apfelbaum R, Carratalá YP, Bosch P, Pötzsch K, et al. One-step multiplex transgenesis via sleeping beauty transposition in cattle. Sci Rep-UK. 2016;6(1):e21953. doi: 10.1038/srep21953 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Yum SY, Lee SJ, Kim HM, Choi WJ, Park JH, Lee WW, et al. Efficient generation of transgenic cattle using the DNA transposon and their analysis by next-generation sequencing. Sci Rep-UK. 2016;6(1):e27185. doi: 10.1038/srep27185 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ma L, Wang Y, Wang H, Hu Y, Chen J, Tan T, et al. Screen and verification for transgene integration sites in pigs. Sci Rep-UK. 2018;8(1):e7433. doi: 10.1038/s41598-018-24481-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Xiao C, Calado DP, Galler G, Thai TH, Patterson HC, Jing W, et al. Mir-150 controls b cell differentiation by targeting the transcription factor c-myb. Cell. 2007;131(1):146–159. doi: 10.1016/j.cell.2007.07.021 [DOI] [PubMed] [Google Scholar]
- 31.Kong Q, Hai T, Ma J, Huang T, Jiang D, Xie B, et al. Rosa26 locus supports tissue-specific promoter driving transgene expression specifically in pig. PLoS ONE. 2014;9(9):e107945. doi: 10.1371/journal.pone.0107945 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(A) Schematic diagram of the cRosa26 HDR template vector and strategy for insertion of EGFP expression cassette into the cRosa26 locus. EGFP, enhanced green fluorescent protein gene; NEO, neomycin-resistance gene. (B) PCR analysis of knock-in cell lines using the primer sets shown in A. M, 1 kb DNA ladder; R1-R4, the positive targeted integration of EGFP-NEO cassettes cell clones; WT, wild-type cFFs; P, the donor vector; H2O was the negative control.
(TIF)
The sequence underlined is the sequence of the 5’ homologous arm targeting the cattle Rosa26. The sequence colored in pink indicates the PGK Promoter. The sequence colored in green indicates the EGFP gene. The sequence colored in yellow indicates the PGK-NEO-polyA casstte used for cell selection. The sequence underlined and bolded is the 3’ homologous arm targeting the cattle Rosa26.
(PDF)
The sequence underlined is the sequence of the 5’ homologous arm targeting the cattle Rosa26. The sequence colored in pink indicates the CAG Promoter. The sequence colored in green indicates the EGFP gene. The sequence colored in yellow indicates the PGK-NEO-polyA casstte used for cell selection. The sequence underlined and bolded is the 3’ homologous arm targeting the cattle Rosa26.
(PDF)
The sequence underlined is the sequence of the 5’ homologous arm targeting the cattle Rosa26. The sequence colored in pink indicates the EF1a Promoter. The sequence colored in green indicates the EGFP gene. The sequence colored in yellow indicates the PGK-NEO-polyA casstte used for cell selection. The sequence underlined and bolded is the 3’ homologous arm targeting the cattle Rosa26.
(PDF)
(PDF)
(PDF)
Data Availability Statement
All relevant data are within the paper and its Supporting information files.





