Skip to main content
Journal of Microbiology and Biotechnology logoLink to Journal of Microbiology and Biotechnology
. 2021 Jul 15;31(9):1191–1199. doi: 10.4014/jmb.2105.05016

Two Enteropathogenic Escherichia coli Strains Representing Novel Serotypes and Investigation of Their Roles in Adhesion

Jing Wang 1,2, HongBo Jiao 4, XinFeng Zhang 5, YuanQing Zhang 6, Na Sun 3, Ying Yang 3, Yi Wei 1,2, Bin Hu 3,*, Xi Guo 1,2,*
PMCID: PMC9705854  PMID: 34261855

Abstract

Enteropathogenic Escherichia coli (EPEC), which belongs to the attaching and effacing diarrheagenic E. coli strains, is a major causative agent of life-threatening diarrhea in infants in developing countries. Most EPEC isolates correspond to certain O serotypes; however, many strains are nontypeable. Two EPEC strains, EPEC001 and EPEC080, which could not be serotyped during routine detection, were isolated. In this study, we conducted an in-depth characterization of their putative O-antigen gene clusters (O-AGCs) and also performed constructed mutagenesis of the O-AGCs for functional analysis of O-antigen (OAg) synthesis. Sequence analysis revealed that the occurrence of O-AGCs in EPEC001 and E. coli O132 may be mediated by recombination between them, and EPEC080 and E. coli O2/O50 might acquire each O-AGC from uncommon ancestors. We also indicated that OAgknockout bacteria were highly adhesive in vitro, except for the EPEC001 wzy derivative, whose adherent capability was less than that of its wild-type strain, providing direct evidence that OAg plays a key role in EPEC pathogenesis. Together, we identified two EPEC O serotypes in silico and experimentally, and we also studied the adherent capabilities of their OAgs, which highlighted the fundamental and pathogenic role of OAg in EPEC.

Keywords: Enteropathogenic Escherichia coli, O-antigen, O-antigen gene cluster, serotype, adhesion

Introduction

Escherichia coli, the predominant facultative anaerobe in human colonic flora, comprises both commensal and pathogenic strains, with the latter causing various diseases from gastroenteritis to extraintestinal infections [1]. To date, eight pathovars of E. coli have been reported, which can be broadly classified as diarrhoeagenic and extraintestinal E. coli (ExPEC) [2, 3]. Among the diarrheagenic E. coli, enteropathogenic E. coli (EPEC) is a major causative agent of life-threatening diarrhea in infants in developing countries [4].

Lipopolysaccharide (LPS), a component of the outer membrane, is located exclusively in the outermost layer of gram-negative bacteria. LPS typically consists of three components: lipid A, core oligosaccharides and O-antigen (OAg). The OAg is the most surface-exposed part of the LPS, and is usually a polymer comprising repeating oligosaccharide units (O-units), each containing two to eight sugar residues from a broad range of common or rare sugars and their derivatives [5].

The variability in OAgs is the basis for the serotyping systems of gram-negative bacteria. The antigenic scheme of E. coli was first presented by Fritz Kauffmann in the 1940s, and to date, more than 180 serotypes have been internationally recognized [6]. The genes for OAg synthesis are usually present at a specific locus on the chromosome, named the O-antigen gene cluster (O-AGC). These genes are normally classified into three groups: nucleotide sugar precursor synthesis genes (for biosynthesis of nucleotide sugar precursors specific to OAg), glycosyltransferase genes (for the sequential and specific addition of sugars that generate the O-units), and OAg processing genes (for OAg assembly) [7]. In E. coli strains, O-AGC usually maps between the housekeeping genes, galF and gnd, with a few exceptions, including O8/O9/O9a located between gnd and hisI genes [8, 9] and O62, which is located far from the galF and gnd loci [10].

Currently, two pathways have been identified as responsible for the assembly of E. coli OAgs: the Wzx/Wzy-dependent pathway and the ABC transporter (Wzm/Wzt)-dependent pathway. In each pathway, OAg synthesis is initiated by the transfer of sugar phosphate from NDP-sugar to undecaprenyl phosphate (Und-P) [11]. In the Wzx/Wzy pathway, other sugars are transferred sequentially to Und-PP-sugar to form O-units, which are then flipped by Wzx and polymerized by Wzy to generate the polymer [12]. In the Wzm/Wzt pathway, the sugars for each O-unit are sequentially added to Und-PP-sugar, designated as the “primer,” and the process does not stop until the complete repeating-unit polymer is generated, followed by the translocation of UndPP-OAg from the cytoplasm to periplasm by the ABC transporter [13].

During the pathogenesis, adhesion to epithelial cells is a key virulence function. EPEC adheres to the enterocytes in the small bowel and enables the colonization of intestinal epithelium, forming attaching and effacing (A/E) lesions and translocating effector proteins into host cell cytoplasm [14]. The majority of the genes required for A/E lesion formation are grouped within a pathogenicity island named the ‘locus of enterocyte effacement’ (LEE) [15]. Two LEE-encoded adhesins, type III secretion system (TTSS) EspA filaments and the outer-membrane adhesin, intimin (interacted with its translocated receptor Tir), have been reported possessing the ability to facilitate the adhesion of EPEC to intestinal epithelium [16]. In addition, the non-LEE-encoded factors, including the type IV bundle-forming pilus (BFP) and EspFu can also trigger EHPC adhesion [16, 17]. Several studies on other bacteria by comparing the wild-type strain with the OAg-deficient mutant provided evidence that OAg plays a key role in bacterial adhesion, thus affecting pathogenesis [18-20], as well as enabling the bacteria to evade the host immune system [21, 22]. However, the adherent and pathogenic role of OAg in EPEC is still largely unknown. The aim of this study was to characterize the putative novel O-AGC loci of two EPEC strains isolated from Shandong Province, China, during routine detection. Moreover, mutagenesis of the O-AGCs was constructed and used for functional analysis of the loci, and the roles of the OAgs of these two strains in virulence were also investigated via in vitro experiments.

Materials and Methods

Bacterial Strains, Plasmids, and Growth Conditions

The two EPEC strains, EPEC001 from a patient's fecal sample, and EPEC080 from a goat were isolated by the Shandong Center for Disease Control and Prevention. Details of EPEC001, EPEC080, their derivatives, and plasmids are described in Table 1. The primers used for mutant construction are also listed in Table 1. All strains were routinely cultured in 2× YT medium (16 g tryptone, 10 g yeast extract, and 5 g sodium chloride per liter). When necessary, the media were supplemented with chloramphenicol (Cm, 25 μg/ml) or blasticidin (Bs, 200 μg/ml).

Table 1.

Strains, plasmids, and primers.

Strain/plasmid/primer Description
Bacterial strain
EPEC001 Wild-type strain
EPEC001ΔOAg Deletion of the entire O-antigen gene cluster, Cmr
EPEC001Δwzy Deletion of the wzy gene, Cmr
EPEC080 Wild-type strain
EPEC080ΔOAg Deletion of O-antigen gene cluster, Cmr
EPEC080Δwzy Deletion of the wzy gene, Cmr
Plasmid
pSim17 Plasmid carrying genes encoding lambda Red recombinase system, Bsr
pKD3 Template for PCR amplification of Red recombinase-medicated recombination, Cmr
Primer Nucleotide sequences (5'-3') a
FOAg001 ACATTTATTGAAACCAATATTGTTGGTACTTATGTCCTTTTGGAAGCCGCCATATGAATATCCTCCTTAG, forward primer for EPEC001 O-antigen gene cluster deletion
ROAg001 TATAAGCATCAAAACATATCCTAGCGGCTTTTACATTTCCAGTTAACATTGTGTAGGCTGGAGCTGCTTCG, reverse primer for EPEC001 O-antigen gene cluster deletion
Fwzy001 TTATTAAATATATGTTTATCAAGGCTTTCTACAAATCCTTTGATTTTATTCATATGAATATCCTCCTTAG, forward primer for EPEC001 wzy gene deletion
Rwzy001 ATCATTCCATAATATTAACCATATTAATGATACTACATAAGTATTAAAAGGTGTAGGCTGGAGCTGCTTCG, reverse primer for EPEC001 wzy gene deletion
FOAg080 CTGGCTGCTGAAAGCCATGTGGATCGTTCCATTACAGGCCCTGCGGCATTCATATGAATATCCTCCTTAG, forward primer for EPEC080 O-antigen gene cluster deletion
ROAg080 CTACCAGCAGCCACGGGATCATGCCGCTGTCGCAGTAAGCGAAATCACGGGTGTAGGCTGGAGCTGCTTCG, reverse primer for EPEC080 O-antigen gene cluster deletion
Fwzy080 TTGGCTTTTGCGTTTATTTCTATTTATTACAAGGCTAAGGCAATAAGGCTCATATGAATATCCTCCTTAG, forward primer for EPEC080 wzy gene deletion
Rwzy080 TAATTCACTCATGCGCAAAGAAAATGCTGGCACAAACGAAAATAAAACTAGTGTAGGCTGGAGCTGCTTCG, reverse primer for EPEC080 wzy gene deletion
Vcat ATGGACAACTTCTTCGCC, forward primer for each mutant verification, designed in cat gene of pKD3
VOAg001 ACGAGGCGTTTCAAGAGA, reverse primer for EPEC001ΔOAg verification, designed in gnd of EPEC001, 856bp
Vwzy001 GTTGGAAATAAATGGCTGTG, reverse primer for EPEC001Δwzy verification, designed in orf11 of EPEC001 O-AGC, 774bp
VOAg080 ACTAACCACTGGACTTGCTC, reverse primer for EPEC080ΔOAg verification, designed in gnd of EPEC080, 1002bp
Vwzy080 CCACTGTTGGCTTTTGTTT, reverse primer for EPEC080Δwzy verification, designed in orf12 of EPEC080 O-AGC, 867bp

aBoldface characters indicate the 50 nucleotides homologous to the initial and final portions of the target DNA segment.

Genome Sequencing, Assembly, and Annotation

Genomic DNA was extracted from 1.5 ml of overnight bacterial culture (approximately 108 colony-forming units (CFU)/ml) using a DNA extraction kit (Tiangen, China) according to manufacturer's instructions. Subsequently, the DNA was sheared, polished, and prepared using the Illumina Sample Preparation Kit. Genome sequencing was performed using the Solexa sequencing technology (Illumina Inc., USA) and the reads obtained were assembled using the de novo genome-assembly program Velvet to generate a multi-contig draft genome. Artemis [23] was used to annotate genes, and the lockMaker program [24] was used to identify conserved motifs. BLAST and PSI-BLAST [25] were used to search genes and proteins against the available databases including GenBank (www.ncbi.nlm.nih.gov/genbank) and Pfam protein families database (pfam.sanger.ac.uk). TMHMM v2.0 (http://www.cbs.dtu.dk/services/TMHMM-2.0/) was used to identify potential transmembrane domains within protein sequences. The putative O-AGC between the galF and gnd genes of each strain was retrieved from the genomes for further analysis.

Construction of Mutants

The mutant strains were constructed using a λ Red recombinase system as previously described[26]. Briefly, first, the plasmid pSim17 was electroporated into the wild-type (WT) strain to enable a direct homologous recombination with PCR products. Following this, the chloramphenicol acetyltransferase (cat) gene from plasmid pKD3 was amplified using 50 nucleotides homologous to the flanking regions of the DNA target segment and the PCR product was transformed into the pSim17-containing wild-type strain that could express recombinase. The mutants with the introduced cat gene were confirmed by PCR and sequencing.

LPS Preparation and Analysis

LPS was extracted using the hot aqueous-phenol method as previously described [27]. The extracted LPSs were separated by using 12% SDS-PAGE at 50 V for 30 min and 100 V for 2 h and subsequently, they were visualized by silver staining using the Fast Silver Stain Kit (No. P0017S, Beyotime, China) according to manufacturer’s protocol. The gel image was captured using a GS900 Calibrated Densitometer (BioRad Laboratories, USA) under “silver stain” mode.

Cell Culture and Bacterial Adhesion

HeLa cells were cultured in high-glucose Dulbeccós modified Eaglés medium containing 10% fetal bovine serum and penicillin-streptomycin-glutamine and they were grown at 37°C under 5% CO2. For adhesion assays, cells grown overnight to approximately 80% confluence were seeded into 12-well tissue culture plates at a concentration of 1×106 cells per well and they were maintained as differentiated monolayers. Next, bacteria in the logarithmic growth phase were added to the cell monolayers at an MOI of of 10. After 6 h of incubation at 37°C, the cells were washed extensively with phosphate-buffered saline (PBS) three times to remove non-adherent bacteria and they were permeabilized with 0.2% Triton X-100. The adhesive bacteria were collected, serially diluted in PBS, and spread onto Luria-Bertani agar for counting bacterial CFUs. Three independent experiments were performed for each strain. Statistical significance was determined using an unpaired Student's t-test. A p-value of < 0.05 was considered statistically significant.

Nucleotide Sequence Accession Number

The DNA sequences of the O-AGCs from EPEC001 and EPEC080 were deposited in GenBank database under accession numbers MW690110 and MW690111, respectively.

Results

Functional Annotation of Putative O-AGCs

The putative O-AGC of EPEC001 is 12,344 bp in length, and it contains 12 open reading frames (orfs) with the same transcriptional direction from galF to gnd (Fig. 1, Table 2). orf1 to 4 are identical to the dTDP-glucose 4,6-dehydratase (rmlB), dTDP-4-dehydrorhamnose reductase (rmlD), glucose-1-phosphate thymidylyltransferase (rmlA), and dTDP-4-dehydrorhamnose 3,5-epimerase (rmlC) genes, respectively. A set of genes in the order rmlBDAC is usually localized at the 5’ end of O-AGC and the products are responsible for the biosynthesis of dTDP-L-Rha, the nucleotide precursor of L-Rha, which is usually found as a component of OAg. orf6 was assigned as glf, which encodes a UDP-galactopyranose mutase catalyzing the formation of UDP-D-Galf, which is the nucleotide precursor of D-Galf, from UDP-D-Gal. orf5 and orf10 were presumptively identified as wzx and wzy, respectively, using BLAST. Additionally, Orf5 contains 11 predicted transmembrane (TM) domains, which is the typical number for OAg flippase (Wzx), and Orf10 contains nine predicted TM domains, which is typical for OAg polymerase (Wzy). orf9, orf11, and orf12 were all assigned as glycosyltransferase genes. Moreover, orf9 was predicted as the rhamnosyltransferase gene and orf12 as the galactofuranosyltransferase gene, which suggests that the occurrence of L-Rha and Galf residues in EPEC001 OAg is very likely and is in accordance with the existence of rmlBDAC (orf1 to 4) and glf (orf6) genes. Among the remaining two orfs, the product of orf8 was predicted to be the ISAs1 family transposase and the product of orf7 exhibited no similarity to any functionally characterized/identified protein, and therefore, it was assigned as a hypothetical protein.

Fig. 1. O-antigen gene clusters of EPEC001 and EPEC080, and comparisons with each related serotype(s).

Fig. 1

rmlA, glucose-1-phosphate thymidylyltransferase gene; rmlB, dTDP-D-glucose 4,6-dehydratase gene; rmlC, dTDP-4-keto-6- deoxy-D-glucose 3,5-epimerase gene; rmlD, dTDP-6-deoxy-L-mannose-dehydrogenase gene; glf, UDP-galactopyranose mutase gene; fdtA, dTDP-6-deoxy-hex-4-ulose isomerase gene; fdtB, dTDP-6-deoxy-D-xylo-hex-3-ulose aminase gene; fdtC, dTDP-D-Fuc3N acetylase gene; manB, phosphomannomutase gene; manC, mannose-1-phosphate guanylyltransferase gene; wzx, O-antigen flippase gene; wzy, O-antigen polymerase gene.

Table 2.

Characteristics of open reading frames (ORFs) in the O-antigen gene clusters of EPEC001 and EPEC080.

Orf no. Gene name Position of the gene G+C content (%) Similar protein(s), strain(s) (GenBank accession no.) %Identical/%Similar (total no. of aa) Putative function of protein
EPEC001
1 rmlB 1..1086 42.44 dTDP-glucose 4,6-dehydratase [Escherichia coli] (WP_052925278.1) 100/100 (361) dTDP-glucose 4,6-dehydratase
2 rmlD 1086..1985 47.55 dTDP-4-dehydrorhamnose reductase [Escherichia coli] (WP_046201417.1) 99/100 (299) dTDP-4-dehydrorhamnose reductase
3 rmlA 2043..2918 43.26 glucose-1-phosphate thymidylyltransferase RfbA [Escherichia coli] (WP_046201417.1) 99/100 (291) Glucose-1-phosphate thymidylyltransferase
4 rmlC 2927..3481 32.43 dTDP-4-dehydrorhamnose 3,5-epimerase [Escherichia coli] (WP_057080958.1) 99/100 (184) dTDP-4-dehydrorhamnose 3,5-epimerase
5 wzx 3490..4728 34.22 O34 family O-antigen flippase [Escherichia coli] (WP_097479960.1) 51/71 (412) flippase
6 glf 4731..5822 32.6 UDP-galactopyranose mutase [Escherichia coli] (WP_033560995.1) 75/85 (363) UDP-galactopyranose mutase
7 5825..6814 32.12 hypothetical protein [Escherichia coli] (WP_053273170.1) 99/99 (329) hypothetical protein
8 7459..8013 40.24 ISAs1 family transposase [Escherichia coli] (MBJ0238419.1) 96/97 (184) H repeat-associated protein
9 8068..8961 32.66 glycosyltransferase [Escherichia coli] (WP_085446706.1) 38/59(297) glycosyltransferase family 2 protein
10 wzy 9274..10335 29.75 EpsG family protein [Cronobacter muytjensii] (WP_075192411.1) 47/69 (353) polymerase
11 10345..11439 29.22 glycosyltransferase family 4 protein [Cronobacter muytjensii] (WP_083605367.1) 46/64 (364) glycosyltransferase
12 11436..12344 31.35 glycosyltransferase family 2 protein [Enterobacter asburiae] (WP_150182824.1) 62/77 (303) Galactofuranosyltransferase GlfT1
EPEC080
1 rmlB 1..1086 43.18 dTDP-glucose 4,6-dehydratase [Escherichia coli] (WP_029399178.1) 100/100 (361) dTDP-glucose 4,6-dehydratase
2 rmlD 1086..1985 46.11 dTDP-4-dehydrorhamnose reductase [Escherichia coli] (WP_029399176.1) 100/100(299) dTDP-4-dehydrorhamnose reductase
3 rmlA 2043..2921 43.34 glucose-1-phosphate thymidylyltransferase RfbA [Escherichia coli] (WP_029399175.1) 100/100 (292) Glucose-1-phosphate thymidylyltransferase 1
4 fdtA 2935..3354 32.85 FdtA/QdtA family cupin domain-containing protein [Cedecea lapagei] (WP_126355658.1) 66/83(139) TDP-4-oxo-6-deoxy-alpha-D-glucose-3,4-oxoisomerase
5 fdtC 3332..3796 36.77 N-acetyltransferase [Escherichia coli] (EFN7827253.1) 100/100(154) dTDP-3-amino-3,6-dideoxy-alpha-D-galactopyranose 3-N-acetyltransferase
6 fdtB 3801..4922 33.77 DegT/DnrJ/EryC1/StrS family aminotransferase [Escherichia coli] (HAO2821289.1) 99/99(373) dTDP-3-amino-3,6-dideoxy-alpha-D-galactopyranose transaminase
7 wzx 4906..6177 30.47 O50 family O-antigen flippase [Escherichia coli] (EFN5080582.1) 54/74(423) flippase
8 6190..7221 31.2 glycosyltransferase family 4 protein [Enterobacter cloacae complex sp.] (WP_133294767.1) 53/71(343) glycosyltransferase family 4 protein
9 rmlC 7234..7767 34.08 dTDP-4-dehydrorhamnose 3,5-epimerase [Escherichia coli] (EEW2230532.1) 99/100(177) dTDP-4-dehydrorhamnose 3,5-epimerase
10 7793..8722 30.96 glycosyltransferase family 2 protein [Escherichia coli] (WP_063610376.1) 48/69(309) rhamnosyltransferase
11 wzy 8762..9805 27.2 EpsG family protein [Escherichia coli] (WP_089723541.1) 45/66(347 polymerase
12 9844..10599 28.04 glycosyl transferase group 2 family protein [Escherichia coli] (OAC41241.1) 58/76(251) UDP-Glc:alpha-D-GlcNAc-diphosphoundecaprenol beta-1,3-glucosyltransferase WfgD
13 10613..11722 30.21 glycosyltransferase [Croceivirga radicis] (WP_080317782.1) 52/71(369) Phosphatidyl-myo-inositol mannosyltransferase
14 manC 11738..13159 36.42 mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase [Escherichia coli](WP_029399160.1) 100/100(473) Mannose-1-phosphate guanylyltransferase 1
15 manB 13180..14550 54.48 phosphomannomutase/phosphoglucomutase [Escherichia coli] (EFA9345916.1) 99/99(456) Phosphomannomutase/phosphoglucomutase

The putative O-AGC of EPEC080 also maps between galF and gnd genes, with 14,550 bp in length and 15 orfs being annotated (Fig. 1, Table 2). orf1 to 3 and orf9 were annotated as rmlB, rmlD, rmlA, and rmlC, respectively. orf4 to 6, the three orfs downstream of rmlA, were assigned to the isomerase (fdtA), N-acetyltransferase (fdtC), and transaminase (fdtB) genes, respectively. The products of these three genes along with RmlA and RmlB are responsible for the synthesis of dTDP-D-Fuc3NAc from Glc-1-P. dTDP-D-Fuc3NAc is the nucleotide precursor of D-Fuc3NAc, which is a rare sugar occasionally occurring in OAg. orf14 and orf15 were assigned as the mannose-1-phosphate guanylyltransferase (manC) and phosphomannomutase (manB) genes, respectively. ManB, ManC, and the phosphomannose isomerase, ManA, are involved in the synthesis of GDP-D-Man, the nucleotide precursor of D-Man, from Fru-6-P. However, the manA gene is not always located in O-AGC. orf7 and orf11 were functionally annotated as wzx and wzy, respectively. TM domain analysis revealed that Orf7 contained 10 TM segments and Orf11 contained eight TM segments, each exhibiting typical features of O-antigen flippase (Wzx) and O-antigen polymerase (Wzy). The remaining four orfs were predicted to encode glycosyltransferases. Furthermore, among them, orf10, 11, and 13 were assigned to the rhamnosyltransferase, glucosyltransferase, and mannosyltransferase genes, respectively. This indicates the existence of L-Rha, D-Glc, and D-Man residues in EPEC080 OAg, and it partly verifies the gene annotation of O-AGC.

Construction of Mutant Strains

To determine the functional roles of putative O-AGCs, mutant strains with O-AGC and wzy deletions were constructed for EPEC001 and EPEC080, respectively, and verified by PCR amplification and subsequent sequencing. For PCR, the common forward primer was designed in the cat gene of pKD3 that substitutes the DNA segment of the deleted gene(s) and the reverse primer was designed in the orf downstream of the targeted gene(s)(Table 1). As shown in the agarose gel electrophoresis of all PCR products (Fig. 2), each mutant strain generated a specific and length-correct band, with the corresponding wild-type strain (control) giving no PCR product. All constructed mutant strains were further confirmed by sequencing.

Fig. 2. Agarose gel electrophoresis of all PCR products from the mutant strains and their wild-type controls.

Fig. 2

Lane 1: DL2000 DNA marker; lane 2: EPEC001 (Vcat/VOAg001); lane 3: EPEC001ΔOAg (Vcat/VOAg001); lane 4: EPEC001 (Vcat/Vwzy001); lane 5: EPEC001Δwzy (Vcat/Vwzy001); lane 6: EPEC080 (Vcat/VOAg080); lane 7: EPEC080ΔOAg (Vcat/ VOAg080); lane 8: EPEC080 (Vcat/Vwzy080); lane 9: EPEC080Δwzy (Vcat/Vwzy080).

Functional Confirmation of O-AGCs

As shown in the LPS profile (Fig. 3), EPEC001 generated a WT bimodal distribution of LPS, characterized by a first band of lipid A-core and additional bands corresponding to O-units. However, the mutant EPEC001ΔOAg only generated one band of lipid A-core and no attached OAg, and the mutant EPEC001Δwzy showed a semi-rough LPS phenotype with only one O-unit substitution on the lipid A-core. These results collectively indicate that the locus between galF and gnd is effectively involved in the biosynthesis of EPEC001 OAg and that orf10 encodes the O-antigen polymerase (Wzy) responsible for the OAg assembly in EPEC001. Similar to EPEC001 and its derivatives, EPEC080 exhibited a complete LPS profile, while the EPEC080ΔOAg strain showed a rough LPS phenotype and the EPEC080Δwzy strain showed a semi-rough LPS phenotype. Thus, we demonstrated that the O-AGC of EPEC080 maps between galF and gnd, and the wzy (orf11) gene of the strain is involved in OAg assembly.

Fig. 3. Lipopolysaccharide profiles of strains EPEC001, EPEC080, and their derivatives.

Fig. 3

The extracts were electrophoresed on 12% SDS-PAGE and stained by silver staining. From left to right: EPEC001 expressing complete LPS, EPEC001ΔOAg expressing rough LPS, EPEC001Δwzy expressing semi-rough LPS, EPEC080 expressing complete LPS, EPEC080ΔOAg expressing rough LPS, and EPEC080Δwzy expressing semi-rough LPS.

The Role of OAgs in Adhesion

Except for the enteroinvasive E. coli, adhesion to host cells is a requirement for all E.coli pathovars and it is a key stage in bacterial infection. To investigate the pathogenic role of OAg, we assessed its adhesion ability to the HeLa cells of EPEC001, EPEC080, and their OAg derivatives (Fig. 4). After 6 h of infection, compared to the EPEC080 WT strain, the mutant complete loss of O-AGC and the mutant loss of wzy both exhibited increased bacterial adhesion (6-fold, p = 0.0067 and 5.9-fold, p = 0.0061, respectively). For EPEC001, the adhesion ability of its O-AGC mutant also significantly increased as compared to that of the WT strain (5.9-fold, p = 0.0093). However, the wzy mutant generated a completely opposite result, and the loss of wzy significantly decreased the bacterial adhesion level (0.16-fold, p = 0.014).

Fig. 4. Adherent capabilities of EPEC001, EPEC080, and their derivatives.

Fig. 4

Data are presented as means ± standard deviations (SD) for three biological replicates. Statistical analysis was performed using the unpaired Student t-test. *p < 0.05, **p < 0.01.

Discussion

In this study, we genetically characterized novel putative O-AGCs from two E. coli strains that could not be tested using Iguchi's O-genotyping PCR assay, which targets almost all known E. coli serotypes [28]. To date, more than 180 O serotypes of E. coli strains have been identified based on their OAg variability. Several E. coli O serotypes are closely associated with human diseases with high morbidity and mortality rates. For example, the Shiga toxin-producing E. coli (STEC) O157:H7 is a well-known pathogenic clone that causes hemolytic-uremic syndrome and foodborne illnesses [29]. The “big six” non-O157 STEC strains (O26, O45, O103, O111, O121, and O145) cause less severe infections than O157. However, the severity of infection differs with different serotypes. Another example is the STEC O104:H4, which caused a widespread and severe foodborne illness epidemic in Germany in 2011 [30]. In recent years, strains representing novel serotypes and being associated with or as one of the dominant clones causing human diseases have been isolated and characterized [31-33]. Pair-to-pair alignment shows that the O-AGC of EPEC001 is close to that of E. coli O132 and the O-AGC of EPEC080 is related to that of E. coli O2/O50 (Fig. 1). Generally, products encoded by the six upstream genes including wzx of EPEC001 O-AGC, share high percentages of protein identity levels (50 to 100) to the corresponding region of E. coli O132 O-AGC with the right region being unique, which is probably the serotype determinant. Indeed, all glycosyltransferase genes and wzy, the possessing gene, which are considered highly sero-specific, were located at the 3' end of O-AGC. It seems that a recombination event occurred between the O-AGCs of EPEC001 and E. coli O132 and we propose that one of the recombination sites is located in the rmlA gene since the DNA identity level of rmlA was much higher than that of its downstream genes. Likewise, the first nine genes in the O-AGCs of EPEC080 and E. coli O2/O50 have the same order and they share 49 to 95% protein identity level. However, the DNA identity level of each gene pair is less than 90%. Thus, it is proposed that both EPEC080 and E. coli O2/O50 have each acquired their respective O-AGC from uncommon ancestors instead of via recombination between them. As the diversity of serotypes is based on the structural variations of OAgs and O-AGC is usually closely related to OAg, an elucidation of OAg structures needs to be conducted in the future to provide an insight into the evolution of the O-AGCs of novel serotypes.

The presence and length of OAgs play a key role in bacterial pathogenesis, and they protect the bacteria by evading the host innate immune response. ExPEC strains such as UPEC and NMEC are always triggered to be resistant to host systemic immunity by expressing specific surface polysaccharides, mainly including a capsule and/or OAg [21, 22, 34]. While the host-diarrheagenic E. coli interactions are primarily mediated by bacterial invasive virulence factors, the role of surface polysaccharides in the pathogenesis and regulation of intestinal inflammation remains unclear. Recently, it has been reported that the OAg of adherent-invasive E. coli (AIEC) can reduce its ability to adhere to and invade intestinal epithelial cells in vitro and regulate host inflammation via complement C3 [35]. EPEC can be further divided into “typical” and “atypical” subtypes based on the presence or absence of E. coli adherence factor plasmid [36] with each subtype containing frequently isolated serotypes or being non-typeable [14]. To the best of our knowledge, whether OAg affects the adhesion to and invasion into the intestinal epithelial cells of EPEC is rarely studied. A much earlier study reported that an EPEC strain, B171 (serotype O111), exhibits localized adherence to HeLa cells and this process is mediated by the OAg encoded by plasmid pYR111 [37]. In the present study, we investigated the role of OAg in the adhesion of EPEC to HeLa cells. The increased adhesion abilities of EPEC001ΔOAg and EPEC008 OAg derivatives are very similar to those observed in Shigella sonnei [38], Salmonella enterica [39], and Burkholderia cenocepacia [40]. All these findings suggest that OAg may mask one or more bacterial surface adhesins and OAg expression modulates bacterial pathogenesis by balancing their adherent and invasive capabilities and conferring optimal protection against host defense mechanisms. However, EPEC001Δwzy generates an opposite result, that is, this OAg isogenic strain attenuated the adherent ability to HeLa cells, similar to that observed in AIEC [35] and Plesiomonas shigelloides [41]. Another report also revealed that the deletion of the wzy gene significantly decreases the adherent and invasive abilities of avian pathogenic E. coli [42]. Thus, contrasting conclusions exist on the pathogenesis of OAgs in different species and strains. We propose that on one hand, this is attributed to the different chemical structures of OAgs. On the other hand, OAg may indirectly contribute to pathogenesis, that is, its expression may be regulated by various upstream signals and other virulence factors can also be adjusted by OAg. Therefore, the OAg-associated regulatory pathway of pathogens needs to be further characterized individually.

In general, we characterized and identified two EPEC serotypes in silico and experimentally, thus further expanding the current E. coli serotyping scheme. We also evaluated the in vitro adherent capabilities of the OAgs of two strains, and our findings highlight the fundamental and pathogenic role of OAg in EPEC.

Acknowledgments

This work was supported by the Shandong Medical and Health Science and Technology Development Programs [Grant No. 2017WS455], the Shandong Preventive Medicine Association Zhifei Disease Prevention and Control Technology Research Fund Project [Grant No. LYH2017-03], and a grant from the Tianjin Municipal Natural Science Foundation [Grant No. 17JCYBJC24300].

Footnotes

Conflict of Interest

The authors have no financial conflicts of interest to declare.

REFERENCES

  • 1.Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004;2:123–140. doi: 10.1038/nrmicro818. [DOI] [PubMed] [Google Scholar]
  • 2.Fratamico PM, DebRoy C, Liu Y, Needleman DS, Baranzoni GM, Feng P. Advances in molecular serotyping and subtyping of Escherichia coli. Front. Microbiol. 2016;7:644. doi: 10.3389/fmicb.2016.00644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Smith JL, Fratamico PM, Gunther N. Extraintestinal pathogenic Escherichia coli (ExPEC) Foodborne Pathog. Dis. 2007;4:134–163. doi: 10.1089/fpd.2007.0087. [DOI] [PubMed] [Google Scholar]
  • 4.Hu J, Torres AG. Enteropathogenic Escherichia coli: foe or innocent bystander? Clin. Microbiol. Infect. 2015;21:729–34. doi: 10.1016/j.cmi.2015.01.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Merino S, Gonzalez V, Tomás JM. The first sugar of the repeat units is essential for the Wzy polymerase activity and elongation of the O-antigen lipopolysaccharide. Future Microbiol. 2016;11:903–918. doi: 10.2217/fmb-2015-0028. [DOI] [PubMed] [Google Scholar]
  • 6.Liu B, Furevi A, Perepelov AV, Guo X, Cao H, Wang Q, et al. Structure and genetics of Escherichia coli O antigens. FEMS Microbiol. Rev. 2020;44:655–683. doi: 10.1093/femsre/fuz028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ooka T, Seto K, Ogura Y, et al. O-antigen biosynthesis gene clusters of Escherichia albertii: their diversity and similarity to Escherichia coli gene clusters and the development of an O-genotyping method. Microb. Genom. 2019;5:e000314. doi: 10.1099/mgen.0.000314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Amor PA, Whitfield C. Molecular and functional analysis of genes required for expression of group IB K antigens in Escherichia coli: characterization of the his-region containing gene clusters for multiple cell-surface polysaccharides. Mol. Microbiol. 1997;26:145–161. doi: 10.1046/j.1365-2958.1997.5631930.x. [DOI] [PubMed] [Google Scholar]
  • 9.Sugiyama T, Kido N, Kato Y, Koide N, Yoshida T, Yokochi T. Generation of Escherichia coli O9a serotype, a subtype of E. coli O9, by transfer of the wb* gene cluster of Klebsiella O3 into E. coli via recombination. J. Bacteriol. 1998;180:2775–2778. doi: 10.1128/JB.180.10.2775-2778.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hou X, Perepelov AV, Guo X, Senchenkova SN, Shashkov AS, Liu B, et al. A gene cluster at an unusual chromosomal location responsible for the novel O-antigen synthesis in Escherichia coli O62 by the ABC transporter-dependent pathway. Glycobiology. 2017;27:669–676. doi: 10.1093/glycob/cwx030. [DOI] [PubMed] [Google Scholar]
  • 11.Eichler J, Imperiali B. Stereochemical divergence of polyprenolphosphate glycosyltransferases. Trends Biochem. Sci. 2018;43:10–17. doi: 10.1016/j.tibs.2017.10.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Islam ST, Lam JS. Synthesis of bacterial polysaccharides via the Wzx/Wzy-dependent pathway. Can. J. Microbiol. 2014;60:697–716. doi: 10.1139/cjm-2014-0595. [DOI] [PubMed] [Google Scholar]
  • 13.Greenfield LK, Whitfield C. Synthesis of lipopolysaccharide O-antigens by ABC transporter-dependent pathways. Carbohydr. Res. 2012;356:12–24. doi: 10.1016/j.carres.2012.02.027. [DOI] [PubMed] [Google Scholar]
  • 14.Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB. Recent advances in understanding enteric pathogenic Escherichia coli. Clin. Microbiol. Rev. 2013;26:822–880. doi: 10.1128/CMR.00022-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.McDaniel TK, Jarvis KG, Donnenberg MS, Kaper JB. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. USA. 1995;92:1664–1668. doi: 10.1073/pnas.92.5.1664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Cleary J, Lai LC, Shaw RK, Straatman-Iwanowska A, Donnenberg MS, Frankel G, et al. Enteropathogenic Escherichia coli (EPEC) adhesion to intestinal epithelial cells: role of bundle-forming pili (BFP), EspA filaments and intimin. Microbiology (Reading) 2004;150:527–538. doi: 10.1099/mic.0.26740-0. [DOI] [PubMed] [Google Scholar]
  • 17.Martins FH, Kumar A, Abe CM, Carvalho E, Nishiyama- M, Jr, Xing C, et al. EspFu-mediated actin assembly enhances enteropathogenic Escherichia coli adherence and activates host cell inflammatory signaling pathways. mBio. 2020;11:e00617–20. doi: 10.1128/mBio.00617-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.March C, Cano V, Moranta D, Llobet E, Pérez-Gutiérrez C, Tomás JM, et al. Role of bacterial surface structures on the interaction of Klebsiella pneumoniae with phagocytes. PLoS One. 2013;8:e56847. doi: 10.1371/journal.pone.0056847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Plainvert C, Bidet P, Peigne C, Barbe V, Médigue C, Denamur E, et al. A new O-antigen gene cluster has a key role in the virulence of the Escherichia coli meningitis clone O45:K1:H7. J. Bacteriol. 2007;189:8528–8536. doi: 10.1128/JB.01013-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Sarkar S, Ulett GC, Totsika M, Phan MD, Schembri MA. Role of capsule and O antigen in the virulence of uropathogenic Escherichia coli. PLoS One. 2014;9:e94786. doi: 10.1371/journal.pone.0094786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bao Y, Zhang H, Huang X, Ma J, Logue CM, Nolan LK, et al. O-specific polysaccharide confers lysozyme resistance to extraintestinal pathogenic Escherichia coli. Virulence. 2018;9:666–680. doi: 10.1080/21505594.2018.1433979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Vila J, Sáez-López E, Johnson JR, et al. Escherichia coli: an old friend with new tidings. FEMS Microbiol. Rev. 2016;40:437–463. doi: 10.1093/femsre/fuw005. [DOI] [PubMed] [Google Scholar]
  • 23.Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream MA, et al. Artemis: sequence visualization and annotation. Bioinformatics. 2000;16:944–945. doi: 10.1093/bioinformatics/16.10.944. [DOI] [PubMed] [Google Scholar]
  • 24.Henikoff S, Henikoff JG, Alford WJ, Pietrokovski S. Automated construction and graphical presentation of protein blocks from unaligned sequences. Gene. 1995;163:GC17–26. doi: 10.1016/0378-1119(95)00486-P. [DOI] [PubMed] [Google Scholar]
  • 25.Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA. 2000;97:6640–6645. doi: 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Davis MR, Jr, Goldberg JB. Purification and visualization of lipopolysaccharide from Gram-negative bacteria by hot aqueousphenol extraction. J. Vis. Exp. 2012;63:3916. doi: 10.3791/3916. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Iguchi A, Iyoda S, Seto K, Morita-Ishihara T, Scheutz F, Ohnishi M, et al. Escherichia coli O-Genotyping PCR: a comprehensive and practical platform for molecular O serogrouping. J. Clin. Microbiol. 2015;53:2427–2432. doi: 10.1128/JCM.00321-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Maguire M, Kase JA, Roberson D, Muruvanda T, Brown EW, Allard M, et al. Precision long-read metagenomics sequencing for food safety by detection and assembly of Shiga toxin-producing Escherichia coli in irrigation water. PLoS One. 2021;16:e0245172. doi: 10.1371/journal.pone.0245172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Muniesa M, Hammerl JA, Hertwig S, Appel B, Brüssow H. Shiga toxin-producing Escherichia coli O104:H4: a new challenge for microbiology. Appl. Environ. Microbiol. 2012;78:4065–4073. doi: 10.1128/AEM.00217-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Chen M, Shpirt AM, Guo X, Shashkov AS, Zhuang Y, Wang L, et al. Identification serologically, chemically and genetically of two Escherichia coli strains as candidates for new O serogroups. Microbiology. 2015;161:1790–1796. doi: 10.1099/mic.0.000136. [DOI] [PubMed] [Google Scholar]
  • 32.Iguchi A, von Mentzer A, Kikuchi T, Thomson NR. An untypeable enterotoxigenic Escherichia coli represents one of the dominant types causing human disease. Microb. Genom. 2017;3:e000121. doi: 10.1099/mgen.0.000121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lang C, Hiller M, Konrad R, Fruth A, Flieger A. Whole-genome-based public health surveillance of less common shiga toxinproducing Escherichia coli serovars and untypeable strains identifies four novel O genotypes. J. Clin. Microbiol. 2019;57:e00768–19. doi: 10.1128/JCM.00768-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Lüthje P, Brauner A. Virulence factors of uropathogenic E. coli and their interaction with the host. Adv. Microb. Physiol. 2014;65:337–372. doi: 10.1016/bs.ampbs.2014.08.006. [DOI] [PubMed] [Google Scholar]
  • 35.Ohno M, Hasegawa M, Hayashi A, Caballero-Flores G, Alteri CJ, Lawley TD, et al. Lipopolysaccharide O structure of adherent and invasive Escherichia coli regulates intestinal inflammation via complement C3. PLoS Pathog. 2020;16:e1008928. doi: 10.1371/journal.ppat.1008928. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Trabulsi LR, Keller R, Tardelli Gomes TA. Typical and atypical enteropathogenic Escherichia coli. Emerg. Infect. Dis. 2002;8:508–513. doi: 10.3201/eid0805.010385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Riley LW, Junio LN, Libaek LB, Schoolnik GK. Plasmid-encoded expression of lipopolysaccharide O-antigenic polysaccharide in enteropathogenic Escherichia coli. Infect. Immun. 1987;55:2052–2056. doi: 10.1128/iai.55.9.2052-2056.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Caboni M, Pédron T, Rossi O, Goulding D, Pickard D, Citiulo F, et al. An O antigen capsule modulates bacterial pathogenesis in Shigella sonnei. PLoS Pathog. 2015;11:e1004749. doi: 10.1371/journal.ppat.1004749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hölzer SU, Schlumberger MC, Jäckel D, Hensel M. Effect of the O-antigen length of lipopolysaccharide on the functions of Type III secretion systems in Salmonella enterica. Infect. Immun. 2009;77:5458–5470. doi: 10.1128/IAI.00871-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Saldías MS, Ortega X, Valvano MA. Burkholderia cenocepacia O antigen lipopolysaccharide prevents phagocytosis by macrophages and adhesion to epithelial cells. J. Med. Microbiol. 2009;58:1542–1548. doi: 10.1099/jmm.0.013235-0. [DOI] [PubMed] [Google Scholar]
  • 41.Aquilini E, Merino S, Tomás JM. The Plesiomonas shigelloides wb(O1) gene cluster and the role of O1-antigen LPS in pathogenicity. Microb. Pathog. 2013;63:1–7. doi: 10.1016/j.micpath.2013.05.010. [DOI] [PubMed] [Google Scholar]
  • 42.Zuo J, Tu C, Wang Y, Qi K, Hu J, Wang Z, et al. The role of the wzy gene in lipopolysaccharide biosynthesis and pathogenesis of avian pathogenic Escherichia coli. Microb. Pathog. 2019;127:296–303. doi: 10.1016/j.micpath.2018.12.021. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Microbiology and Biotechnology are provided here courtesy of Korean Society for Microbiology and Biotechnology

RESOURCES