Skip to main content
Journal of Microbiology and Biotechnology logoLink to Journal of Microbiology and Biotechnology
. 2020 Dec 11;31(2):259–271. doi: 10.4014/jmb.2009.09026

Function and Molecular Ecology Significance of Two Catechol-Degrading Gene Clusters in Pseudomonas putida ND6

Sanyuan Shi 1,, Liu Yang 1,, Chen Yang 1, Shanshan Li 2, Hong Zhao 3, Lu Ren 1, Xiaokang Wang 1, Fuping Lu 1, Ying Li 4,*, Huabing Zhao 1,*
PMCID: PMC9705993  PMID: 33323670

Abstract

Many bacteria metabolize aromatic compounds via catechol as a catabolic intermediate, and possess multiple genes or clusters encoding catechol-cleavage enzymes. The presence of multiple isozyme-encoding genes is a widespread phenomenon that seems to give the carrying strains a selective advantage in the natural environment over those with only a single copy. In the naphthalene-degrading strain Pseudomonas putida ND6, catechol can be converted into intermediates of the tricarboxylic acid cycle via either the ortho- or meta-cleavage pathways. In this study, we demonstrated that the catechol ortho-cleavage pathway genes (catBICIAI and catBIICIIAII) on the chromosome play an important role. The catI and catII operons are co-transcribed, whereas catAI and catAII are under independent transcriptional regulation. We examined the binding of regulatory proteins to promoters. In the presence of cis-cis-muconate, a well-studied inducer of the cat gene cluster, CatRI and CatRII occupy an additional downstream site, designated as the activation binding site. Notably, CatRI binds to both the catI and catII promoters with high affinity, while CatRII binds weakly. This is likely caused by a T to G mutation in the G/T-N11-A motif. Specifically, we found that CatRI and CatRII regulate catBICIAI and catBIICIIAII in a cooperative manner, which provides new insights into naphthalene degradation.

Keywords: Pseudomonas putida ND6, catechol ortho-cleavage pathway, CatRI and CatRII, catBICIAI and catBIICIIAII operons, cross-regulation, evolution of catabolic pathways

Introduction

A number of aerobic biodegradation pathways of aromatic compounds like benzoate, aniline, phenol, pyrene and naphthalene converge at the catechol ring cleavage reaction, and eventually generate intermediates of the tricarboxylic acid cycle through two different routes [1-3]. The catechol meta-cleavage pathway is usually encoded by the nah and xyl genes on plasmids, while the catechol ortho-cleavage pathway is usually determined by the chromosomal cat and ben genes [4-9]. Ortho-cleavage is followed by further steps of the β-ketoadipate pathway which is catalyzed by the three enzymes catechol 1,2-dioxygenase (C12O, E.C. 1.13.11.1) (catA), cis,cis-muconate-lactonizing enzyme I (catB), and muconolactone isomerase (catC). The expression of this operon is regulated by CatR, and is induced by cis,cis-muconate (CCM) [9-15].

Several research groups have found that bacteria possess multiple catechol ortho-cleavage genes or clusters, which might indicate the importance of keeping the intracellular concentration of catechol and its derivatives low [6,7, 16-20]. Notably, the strains with multiple catechol dioxygenase genes can usually grow on many more aromatic compounds than strains with one dioxygenase gene [14, 21]. Different enzymatic properties and induction patterns of C12O isozymes may be responsible for the metabolism of different substrates [22]. For example, three different C12O isozymes encoded by catA, catAI and catAII in the naphthalene-degrading strain Pseudomonas putida ND6 were found to have different enzymatic properties [17]. Burkholderia sp. strain TH2, a 2-chlorobenzoate (2CB)-degrading bacterium, metabolizes benzoate (BA) and 2CB via two catechol ortho-cleavage pathways (cat1 and cat2). Interestingly, the inducer of catA1 was found to be BA, and not 2CB. It was also found that CCM or its metabolite acts as an inducer for catA2. These results suggest that although cat2 genes are not indispensable for growth of TH2 on 2CB, they are advantageous [20]. Murakami et al. reported that the aniline-assimilating bacterium Frateuria sp. ANA-18 has two cat clusters, which are respectively located on the chromosome and the large plasmid [19]. Two CatR proteins that differ in their binding affinity for the catB promoters control the expression of the two cat gene clusters, which is affected by the concentration of CCM. The catB1 promoter was shown to be active in the presence of CCM, while the catB2 promoter was activated only at low concentrations of CCM [23]. Hence, the presence of multiple catechol ortho-cleavage genes and pathways in the same cell seems to be a widespread phenomenon that gives the host strains a selective advantage in the natural environment. However, the research on function, regulation and evolutionary significance of these genes and clusters should be further intensified.

P. putida strain ND6, which was isolated by our group from industrial wastewater in Tianjin, China, was capable of growth on naphthalene as the sole carbon and energy source, and successfully degraded 98% of 2 g/l naphthalene in mineral medium in 48 h. Similar to other described strains [24-26], ND6 possesses an integrated naphthalene-degrading pathway, and catabolizes catechol through the meta-cleavage pathway. However, a unique feature of ND6 exists in the presence of two catechol ortho-cleavage pathways, encoded by catRIBICIAI and catRIIBIICIIAII on the chromosome, in addition to the typical catechol meta-cleavage pathway on the plasmid. We investigated the cellular responses of P. putida ND6 grown in medium with 2 (normal concentration) and 4 g/l naphthalene (high concentration) using a quantitative proteomics-based approach. Comparative analysis of the proteomic data indicated that the expression levels of CatAI, CatBI, and CatBII, which are involved in the catechol ortho-cleavage pathway, were upregulated [27]. This demonstrated that P. putida ND6 is able to survive in the presence of high naphthalene concentrations mainly because of the duplicated catechol ortho-cleavage operons. The two ortho-cleavage operons are regulated by the LysR-type regulatory proteins CatRI and CatRII, respectively. The distance between the two clusters was about 754 kb, and their sequence identity was 73.57%. Based on the previous work in our laboratory, we hypothesized that these two gene clusters have different functions and evolutionary origins, and might regulate each other via genetic cross-talk. In this paper, we compared the function, regulation and evolutionary significance of the two catechol ortho-cleavage gene clusters in P. putida strain ND6.

Materials and Methods

Bacterial Strains, Culture Conditions, Plasmids, Primers and DNA Manipulations

P. putida strain ND6 and mutants were cultured at 30°C and 180 rpm in Luria-Bertani (LB), or in mineral medium (MMB) with 0.2% naphthalene or 0.2% glucose as the carbon source. Escherichia coli strains were grown in LB at 37°C and 180 rpm. Where appropriate, spectinomycin (Sp; 50 mg/l), streptomycin (Sm; 50 mg/l), chloramphenicol (Cm; 25 mg/l), ampicillin (Amp; 50 mg/l), kanamycin (Kan; 50 mg/l), carbenicillin (Cb; 75 mg/l), tetracycline (Tet; 10 mg/l), or gentamicin (Gm; 10 mg/l) was added for selection.

The bacterial strains, plasmids, and primers used in the present study are listed in Tables 1 and 2. All DNA manipulations were performed according to standard procedures [31]. Restriction enzymes, DNA polymerase and T4 DNA ligase were used in accordance with the manufacturers’ specifications.

Table 1.

Strains and plasmids used in this study.

Strains/plasmids Genotype and description Source/reference
E. coli JM109 cloning strain Novagen
S17-1 recA pro hsdR RP4-2-Tc::Mu-Km::Tn7; donor strain for conjugation; [28]
BL21 Expression strain Novagen
P. putida ND6 Cbr [16]
ND6-∆catRI catRI mutant of ND6;Cbr, Kanr This study
ND6-∆catRII catRII mutant of ND6;Cbr, Kanr This study
ND6-∆catA catA mutant of ND6;Cbr, Kanr This study
ND6-∆catAnahH catA and nahH mutant of ND6;Cbr, Kanr, Cmr This study
NC ND6 containing plasmid pDN19lacΩ; Cbr, Spr, Smr This study
NP1 ND6 containing plasmid pDB1; Cbr, Spr, Smr This study
NP2 ND6 containing plasmid pDB2; Cbr, Spr, Smr This study
ND1P1 ND6-∆catRI containing plasmid pDB1; Cbr, Kanr, Spr, Smr This study
ND1P2 ND6-∆catRI containing plasmid pDB2; Cbr, Kanr, Spr, Smr This study
ND2P1 ND6-∆catRII containing plasmid pDB1; Cbr, Kanr, Spr, Smr This study
ND2P2 ND6-∆catRII containing plasmid pDB2; Cbr, Kanr, Spr, Smr This study
Plasmid pUC18-T simple Cloning vector; Ampr TransGen
pEX18Tc Gene replacement; Tcr, oriT+ sacB+ [29]
pDN19lacΩ Broad host range shuttle vector; Spr, Smr [30]
pEASY-Blunt Source of kan gene; Ampr, Kanr TransGen
pXMJ19 Source of cat gene; Ampr, Cmr TransGen
pEX18Tc-RIKm pEX18Tc with ∆catRI::Kanr; Tetr, Kanr This study
pEX18Tc-RIIKm pEX18Tc with ∆catRII::Kanr; Tetr, Kanr This study
pEX18Tc-AKm pEX18Tc with ∆catA::Kanr; Tetr, Kanr This study
pEX18Tc-HCm pEX18Tc with ∆nahH::Cmr; Tetr, Cmr This study
pEX5-catRI CatRI protein expression vector; Kanr This study
pEX5-catRII CatRII protein expression vector; Kanr This study
pUC19c-catBI pUC19c with catBI promoter; Apr This study
pUC19c-catBII pUC19c with catBII promoter; Apr This study
pDBI catI promoter inserted between the EcoRI and BamHI sites of pDN19lacΩ; Spr, Smr This study
pDBII catII promoter inserted between the EcoRI and BamHI sites of pDN19lacΩ; Spr, Smr This study

*Cbr, carbenicillin resistant; Kanr, kanamycin resistant; Cmr, Chloramphenicol resistant; Spr, spectinomycin resistant; Smr, streptomycin resistant; Ampr, ampicillin resistant; Tetr, tetracycline resistant; Gmr, gentamicin resistant.

Table 2.

Primers used in this study.

Primer name Sequence (5’–3’) Description
RIL-F GTGATGTGGCCGAATGCCTC Used in the creation of ND6-∆catRI mutant
RIL-R CGGCATGAGCATTCGTGTC Used in the creation of ND6-∆catRI mutant
RIR-F GGCCGAAGCCAATGTCGA Used in the creation of ND6-∆catRI mutant
RIR-R GCTTTCGATGCCGGACTTG Used in the creation of ND6-∆catRI mutant
RIIL-F GACGGCCAAGTCGATGGTG Used in the creation of ND6-∆catRII mutant
RIIL-R TAGGCCAGCCGATATCGCT Used in the creation of ND6-∆catRII mutant
RIIR-F CCTGATAGATAGCCGCGTCG Used in the creation of ND6-∆catRII mutant
RIIR-R AGCAAGCGAAGAATGACCAAGG Used in the creation of ND6-∆catRII mutant
AL-F GGGCCGCTTGATCAACGTCGT Used in the creation of ND6-∆AH mutant
AL-R ATCTCAGGCAGGTTGGAAATAG Used in the creation of ND6-∆AH mutant
AR-F CAGTCCGAATACAACCTGCGC Used in the creation of ND6-∆AH mutant
AR-R CCGAAGGCGACAAAGCTGGAG Used in the creation of ND6-∆AH mutant
HL-F GCGCCGCTGGACGTGACAATGC Used in the creation of ND6-∆AH mutant
HL-R TCCAGTACACGCAGTTGCACG Used in the creation of ND6-∆AH mutant
HR-F TTATTTCTTCGACCCGTCCGG Used in the creation of ND6-∆AH mutant
HR-R GGCCGGTCCGACTTTCCAGGT Used in the creation of ND6-∆AH mutant
kan-F GGGCGGTTTTATGGACAGC Used in the creation of ND6-∆catRI, ND6-∆catRII, ND6-∆AH mutant
kan-R CGGTGCTCAACGGGAATC Used in the creation of ND6-∆catRI, ND6-∆catRII, ND6-∆AH mutant
cat-F CTTAAAAAAATTACGCCCCGC Used in the creation of ND6-∆AH mutant
cat-R TGATCGGCACGTAAGAGGTTC Used in the creation of ND6-∆AH mutant
catBIP-F AGCACGGTGCAGGTCTGTTC Used for construction catBI-lacZ fusions
catBIP-R GCCCGAGTGATGCGTTTAC Used for construction catBI-lacZ fusions
catBIIP-F CAAGCTGTTTGAGCAAGGTGTC Used for construction catBII-lacZ fusions
catBIIP-R TAAGGCATCAATACCCATCG Used for construction catBII-lacZ fusions
CatRI-F ACTTGATTGTTGAAGGATT Used for CatRI protein expression
CatRI-R TCAGAGTGCCTGTTGCTC Used for CatRI protein expression
CatRII-F GTGGAGCTCAGGCAT Used for CatRII protein expression
CatRII-R TTATCGATTGATGGTCG Used for CatRII protein expression
q16S-F CGGATCGCAGTCTGCAACTC 16s gene for RT-qPCR
q16S-R ACACCGTGGTAACCGTCCTCC 16s gene for RT-qPCR
qcatAI-F AGGAATGCCTGGACCTGCTCG catAI gene amplification for RT-qPCR
qcatAI-R CGAATGACAACTCGGCAAAGCG catAI gene amplificationfor RT-qPCR
qcatBI-F CTGGCATTGCCTTGTACGG catBI gene amplification for RT-qPCR
qcatBI-R AGGCGCTGTTCGTCCAATG catBI gene amplification for RT-qPCR
qcatCI-F ACATGGACCCGGCCAAGG catCI gene amplification for RT-qPCR
qcatCI-R TCAGCGATCGTCGCTGTG catCI gene amplification for RT-qPCR
qcatAII-F AAGGGCTAATCGGCGAAGTG catAII gene amplification for RT-qPCR
qcatAII-R GCTGTTCGGCAGTCTCAACC catAII gene amplification for RT-qPCR
qcatBII-F GGTGCGGCTCAATCAACG catBII gene amplification for RT-qPCR
qcatBII-R GCCTGGGCTATCTGGGCAG catBII gene amplification for RT-qPCR
qcatCII-F CAAGTGGCTGCCCGCTTG catCII gene amplification for RT-qPCR
qcatCII-R AGCGCTTCGACACTGTCCACA catCII gene amplification for RT-qPCR
catBICI-F GGGCCTGACATTGGACGAAC The region of catBI gene and catCI gene; RT-PCR
catBICI-R ACACAGGCCGTCGACCTCA The region of catBI gene and catCI gene; RT-PCR
catCIAI-F CGTACATGGACATTGAGGTCGA The region of catCI gene and catAI gene; RT-PCR
catCIAI-R AGGTCGAGGAAGTGCTCGATG The region of catCI gene and catAI gene; RT-PCR
catBIICII-F GATCAGCTGCAATGGCACAC The region of catBII gene and catC2 gene; RT-PCR
catBIICII-R AGCGCTTCGACACTGTCC The region of catBII gene and catCII gene; RT-PCR
catCIIAII-F CAAGTGGCTGCCCGCTT The region of catCII gene and catAII gene; RT-PCR
catCIIAII-R CGATAAACAACGTGGTGGCAAC The region of catCII gene and catAII gene; RT-PCR
M13F-11 CGCCAGGGTTTTCCCAGTCACGAC TaqMan primer used for catBI or catBII EMSA and DNase I footprinting template
M13R-12 AGCGGATAACAATTTCACACAGGA TaqMan primer used for catBI or catBII EMSA and DNase I footprinting template
catBI-pe TGTGTTCAATCAGCGCGCTTGTC CatBI gene-specific primer, Primer extension
catBII-pe GCTGCTGTCATTTCAGGTTCCATC CatBII gene-specific primer, Primer extension

Construction of P. putida ND6 Mutants

The suicide vector pEX18Tc was used for gene replacement in Pseudomonas. The catRI replacement vector pEX18Tc-R1Km was constructed by inserting the Kanr cassette into the catRI gene in the pEX18Tc vector to generate a partial deletion from 226 to 440 bp. Similarly, the catRII replacement vector pEX18Tc-RIIKm was constructed by replacing 335 to 407 bp, and the catA replacement vector pEX18Tc-AKm by replacing between 10 to 514 bp. The knockout plasmids pEX18Tc-RIKm, pEX18Tc-RIIKm, and pEX18Tc-AKm were transferred from E. coli S17-1 into P. putida ND6 by intergeneric conjugation , followed by selection on LB + Cb + Kan medium with 20% sucrose to generate the catRI, catRII and catA mutants. The resulting mutant strains were named P. putida ND6-ΔcatRI, ND6-ΔcatRII, and ND6-ΔcatA, respectively.

The nahH replacement vector pEX18Tc-HCm was constructed by inserting the Cmr cassette into the internally deleted nahH gene in the pEX18Tc vector, replacing the sequence between 204 to 742 bp. Finally, the P. putida strain ND6-ΔcatAnahH was obtained.

Time-Courses of Growth, Naphthalene Degradation, and Catechol Dioxygenase Activity

The wild-type ND6, as well as the mutants ND6-ΔcatRI, ND6-ΔcatRII and ND6-ΔcatAnahH, were individually grown in MMB medium with 0.2% naphthalene. Bacterial growth was monitored by measuring the optical density at 600 nm. Naphthalene in the culture broth was extracted twice with an equal volume of dichloromethane, and its concentration was measured according to a published method [32]. The activity of catechol dioxygenases (C12O and C23O) was assayed as described previously [17].

Quantitative Real-Time PCR (RT-qPCR)

The wild-type ND6, as well as the ND6-ΔcatRI and ND6-ΔcatRII mutants were cultured at 30°C in MMB with glucose or naphthalene. Cells were harvested at 25 h (end of the exponential growth phase) and washed with TE buffer. RNA was extracted using the RNAprep Pure Bacteria Kit (Tiangen Biotech, China) and reverse-transcribed into cDNA using the FastKing RT Kit (with gDNase) (Tiangen Biotech). The RT-qPCR was performed following the instructions of the Green Premix Ex Taq II Kit. All RT-qPCR reactions were conducted in three biological and three technical replicates.

Plasmid standards were used for absolute quantification of the corresponding gene fragments. The plasmid copy number was determined according to the molar mass derived from the plasmid and amplicon sequences [33]. For each standard sample, the RT-qPCR system was used to measure the cycle threshold values, which were used to draw a standard curve for each isoform by plotting the cycle threshold values versus the log value of the transcript copy number. Regression equations generated by the system software were used to calculate the transcript copy number for each isoform in each test sample, which was normalized to the value of the 16S rRNA and expressed as the absolute copy number per 1000 copies of 16S transcript. The 95% confidence interval was used to assess the significance of copy number differences, and analysis of variance (ANOVA) was used to assess the significance of the threshold cycle values.

Expression and Purification of CatRI and CatRII

E. coli BL21 carrying the CatRI and CatRII expression plasmids pEX5-CatRI and pEX5-CatRII were grown overnight in LB medium with kanamycin. The expression was induced overnight at 16°C by adding a final concentration of 0.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG). To purify CatRI and CatRII, cell pellets obtained from 1 liter cultures were collected at 13,000 ×g for 3 min at 4°C and resuspended in 40 ml of binding buffer (50 mM sodium phosphate, 0.3 M NaCl, pH 7.4), and sonicated. The clarified lysate was applied to a nickel-nitrilotriacetic acid (NTA) affinity column and allowed to bind for 1 h, followed by washing with binding buffer containing 10 mM, 30 mM and 60 mM imidazole, and eluting with binding buffer containing 500 mM imidazole. The collected fractions were determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The desalination column Sephadex G-25 (GE, USA) was used to remove the imidazole, and yielded the purified protein. The protein was stored in glycerol at -20°C.

Primer-Extension Assay

The primer extension assay was carried out according to the protocol of Fekete et al., as published previously [34].

Electrophoretic Mobility Shift Assay (EMSA)

The fluorescent 6-fluorescein amidite (FAM)-labeled probes were prepared by amplifying the promoter regions of pUC19c-catBI and pUC19c-catBII by PCR using the primers M13F-11 and M13R-12 (Table 2). The Wizard SV Gel and PCR Clean-Up System (Promega) was used to purify the resulting FAM-labeled probes, which were then quantified using a NanoDrop 2000C instrument (Thermo Fisher Scientifc, USA). The EMSA samples comprised 20 μl of 50 mM Tris-HCl [pH 8.0], 100 mM KCl, 2.5 mM MgCl2, 0.2 mM dithiothreitol (DTT), with 2 μg salmon sperm DNA and 10% glycerol, as well as 40 ng of the probe and the indicated DNA-binding proteins. After incubation for 30 min at 30°C, the mixture was loaded onto a 10% PAGE gel buffered with 0.5×Tris-borate-EDTA (TBE).

DNase I Footprinting

The fluorescent FAM-labeled probes were prepared as described above. The DNase I footprinting assays were conducted as published by Wang et al. [35]. For each assay, 400 ng of the probe in a total volume of 40 μl was mixed with different amounts of the indicated DNA-binding protein. The preparation of the DNA ladder, electrophoresis and data analysis were the same as described before [35], except that the GeneScan-LIZ500 size standard (Applied Biosystems) was used.

Construction of catBI-lacZ and catBII-lacZ Fusions and β-Galactosidase Activity Assays

A 309 bp DNA fragment corresponding to the catRI-catBI intergenic region (from -347 to -39 relative to the catBI initiation codon) and a 330bp DNA fragment corresponding to the catRII-catBII intergenic region (from -358 to -29 relative to the catBII initiation codon) were amplified by PCR to construct catI promoter-lacZ fusion and catII promoter-lacZ fusion, respectively. Two amplified fragments of catI and catII promoter were digested with EcoRI and BamHI, respectively, and inserted into pDN19lacΩ that had been previously cut with the same enzymes. The resulting plasmids, pDBI and pDBII, were transformed into E. coli S17-1 by chemical transformation. The complementation was performed through the conjugation between E. coli S17-1 with plasmid pDBI and pDBII and P. putida ND6, P. putida ND6-ΔcatRI, and ND6-ΔcatRII. Recombinant P. putida was selected on MMB plate containing 0.2% salicylate (w/v %) with Cb, Sp and Sm, and subcultured several times to ensure plasmid stabilization. The β-galactosidase activity was measured according to the method of Green [31].

Phylogenetic Tree and Analysis of Conserved Sequences

Database searches were performed using BLAST at the National Center for Biotechnology Information (NCBI) website. Multiple sequence alignments were performed using Clustal W. Then, a neighbor-joining (NJ) phylogenetic tree was constructed using MEGA software version 5.0, and the branching reliability was tested using bootstrap re-sampling (1,000 pseudo-replicates). Analysis of conserved motifs based on known sequences was conducted using WebLogo to generate LOGO diagrams.

Results

Functional Analysis of the Two Catechol-Degrading Gene Clusters

As mentioned above, the genome of P. putida ND6 encodes two catechol-degrading gene clusters (catRIBICIAI and catRIIBIICIIAII) (Fig. 1). To investigate the possible physiological role of these two orthologous clusters, catA (encoding C12O) and nahH (encoding C23O) from the large plasmid pND6-1, which are responsible for catechol ring cleavage [16], were knocked out. The obtained double-mutant strain ND6-ΔcatAnahH was still able to grow on naphthalene by employing the catechol-degrading gene clusters in the genome as a backup, although the C12O activity dropped from 74.60 to 43.02 U/mg (Fig. 2). Furthermore, to examine the relative roles of the catI and catII clusters in catechol metabolism, we disrupted the catRI and catRII regulatory genes and examined the properties of the resulting strains. The ability of these strains to use naphthalene as the sole carbon source was tested in growth and degradation experiments. Interestingly, inactivation of catRI or catRII had no obvious effect on the strains’ ability to utilize naphthalene (Fig. 3).

Fig. 1. Genetic, regulatory and biochemical connections of naphthalene catabolism in P. putida ND6.

Fig. 1

The figure sketches the pathways involved in the naphthalene catabolism of P. putida ND6: the upstream operon (nahABCDEF) for the conversion of naphthalene into salicylate; the downstream operon for the conversion of salicylate into catechol and eventually into intermediates of the central carbon metabolism. Catechol metabolism can proceed via either the ortho- or the meta-cleavage pathway. Both pathways converge towards catechol and diverge at that point, as this compound can be cleaved between positions 1 and 2 by catA, whereas nahH cleaves between positions 2 and 3. The three catA genes are located on the chromosome and large plasmid, respectively.

Fig. 2. Naphthalene-degradation phenotype and catechol dioxygenase enzyme activities of P. putida ND6 and the ND6-ΔcatAnahH mutant.

Fig. 2

Naphthalene (0.2%, w/v %) was provided as the sole carbon source. The small figure shows the C12O and C23O enzyme activity of P. putida ND6 and ND6-ΔcatAnahH.

Fig. 3. Growth and naphthalene-degradation curves of P. putida ND6 wild type, as well as the mutants ND6-ΔcatRI and ND6-ΔcatRII.

Fig. 3

Naphthalene (0.2%, w/v) was provided as the sole carbon source.

Transcriptional Analysis of the Two Catechol-Degrading Gene Clusters

The cDNA of P. putida ND6 was used as template to amplify the intergenic regions of the catBICIAI and catBIICIIAII operons. The results indicated that either the catBICIAI or catBIICIIAII cluster can be co-transcribed (Fig. 4). However, the results of RT-qPCR revealed that the transcription of the downstream genes catCI and catAI was higher than that of catBI (Fig. 5A), suggesting that catCI and catAI were independently transcribed, while the catBICIAI cluster was co-transcribed. A similar phenomenon was also observed in the cluster catBIICIIAII (Fig. 5A).

Fig. 4. Agarose gel plots were used to determine the transcription patterns of the two cat gene clusters.

Fig. 4

M1: Tiangen DNA Marker I; M2: Tiangen DNA Marker II; Lane1: Band of the catBI-catCI intergenic region DNA fragment; Lane 2: Band of the catCI-catAI intergenic region DNA fragment; Lane 3: Band of the catBI-catAI intergenic region DNA fragment; Lane 4: Band of the catBII-catCII intergenic region DNA fragment; Lane 5: Band of the catCII-catAII intergenic region DNA fragment; Lane 6: Band of the catBII-catAII intergenic region DNA fragment; Lane 7: negative control.

Fig. 5. Copy number determination by absolute RT-qPCT using plasmid standards.

Fig. 5

Transcript copy number of genes per 1000 mRNA transcript copies of the 16S rRNA in ND6 (A), ND6-ΔcatRI (B), and ND6-ΔcatRII (C). *p < 0.05, **p < 0.01, ***p < 0.001 between cells grown on naphthalene and on glucose. (D) Transcript copy number of two cat gene clusters per 1000 mRNA transcript copies of the 16S rRNA in ND6, ND6-ΔcatRI and ND6-ΔcatRII. Different superscript letters indicate statistically significant differences among experimental groups (p < 0.05; Duncan’s multiple range test). Either naphthalene (N-) or glucose (G-) was provided as the sole carbon source. Bars show the standard errors of the means.

In the naphthalene medium, the activity of transcription (Fig. 5A) and expression levels (Fig. 2, small figure) of three catA genes and C12O were much higher than nahH gene and C23O. Therefore, the naphthalene metabolism of P. putida ND6 proceeds via catechol cleavage in both the ortho and meta positions, whereby the ortho-cleavage pathway is the main cleavage pathway. The transcriptional levels of the ortho-cleavage pathways (catAI, catBI catCI, catAII, catBII, catCII, catA) were all increased in naphthalene medium, while that of meta-cleavage pathways (nahH) was not (Fig. 5A). It indicates that the ortho-cleavage pathways can be induced by naphthalene or its metabolites but the meta-cleavage pathway apparently cannot. Furthermore, we measured the transcriptional levels of catI and catII in the mutant strains ND6-ΔcatRI and ND6-ΔcatRII, following cultivation in the presence of glucose or naphthalene. For the ND6-ΔcatRI strain (only catRII is functional), the transcriptional levels of catBI were significantly decreased, while the catBII gene cluster could still be induced (Fig. 5B). For the ND6-ΔcatRII strain (only catRI is functional), the transcriptional level of catBII was also decreased while the catBI gene cluster could still be induced (Fig. 5C). This result demonstrated that CatRI and CatRII are the native regulatory proteins of the catI cluster and the catII cluster, respectively.

To investigate their possible regulatory roles, the impacts of catRI and catRII were further analyzed by determining the transcriptional levels of all six catechol-degradation genes in wild-type ND6 and the mutants when grown with naphthalene as the sole carbon source. When either catRI or catRII was knocked out, the transcription of the catI or catII cluster could still be detected (Fig. 5D). It indicates that CatRI and CatRII might cross-regulate the transcription of each other's target genes, and explains that the naphthalene degradation curves of ND6-ΔcatRI and ND6-ΔcatRII did not exhibit significant changes (Fig. 3).

Promoter Structure of the Two Catechol-Degrading Gene Clusters

The primer-extension assay indicated that the transcription start site (TSS) of catI is located at a G nucleotide (Fig. 6). Surprisingly, the primer extension assay of catII failed three times based on reliable methods, probably because the transcript abundance of the catII cluster is particularly low.

Fig. 6. Results of the primer-extension assay.

Fig. 6

Characterization of the cat1 transcription start site (TTS) using the primer extension assay. The primer extension experiments used the primer catBI-pe (Table 2), which was designed to bind downstream of the catBI initiation codon. Comparison of the sequencing results of the cDNA (above) and the genomic DNA (below) to determine the TSS (marked with a red asterisk).

The CatRI and CatRII binding regions were also studied using DNase I footprinting (Fig. 7). Purified CatRI was incubated with a 408 bp fragment labeled with FAM, with a sequence corresponding to the promoter region of catI, and the resulting complexes were treated with DNase I, followed by DNA fragment analysis by capillary electrophoresis. The binding sequence of the CatRII-catBII complex was assessed using the same method, and a 403 bp FAM-labeled DNA fragment was incubated with purified CatRII. In the absence of CCM, CatRI protected a continuous 26 bp region that had also been determined to be located from -137 to -112 relative to the catBI codon (Fig. 7A). CatRII protected a continuous 25 bp region that had also been determined to be located from -137 to -113 relative to the catBI initiation codon (Fig. 7C). In the presence of CCM, CatRI protected a continuous 48 bp region that was determined to be located from -137 to -90 relative to the catBI initiation codon (Fig. 7B). CatRII protected a continuous 41 bp region that was determined to be located from -137 to -97 relative to the catBI initiation codon (Fig. 7D). These results demonstrated that CCM has a significant effect on the DNA binding mode of CatR. In the absence of CCM, CatR bound the repression binding site (RBS), which might be associated with the negative regulation of itself. In the presence of CCM, CatR occupied an adjacent downstream site (Fig. 8), designated as the activation binding site (ABS) [36, 37]. Like most LysR proteins, the DNA-binding sites of CatRI and CatRII invariably contain incomplete inverted repeats (G-N11-A) or inverted repeats (T-N11-A), respectively [38]. The results also indicated that the -35 and -10 regions of the cat promoter were important for promoter activity but not for CatR binding.

Fig. 7. DNase I footprinting analysis of CatRI (A, B) binding to the catBI promoter and CatRII (C, D) binding to the catBII promoter with or without CCM.

Fig. 7

Based on these results and earlier reports on bacterial promoter prediction [39], we identified the promoter structure of the two catechol-degrading gene clusters (Fig. 8). The putative TSS of catI was consistent with the primer-extension experiment, and the putative TSS of catII was located 67 bp upstream of the catBII initiation codon. Other motifs of the catI and catII promoters were identified by comparing to the reported conserved sequences recognized by RNA polymerase [11, 13, 19, 23, 40, 41], including the –35 element (positions –35 to –30, if the transcriptional start site is denoted as +1), the –10 element (positions –12 to –7) and the discriminator element (Dis; –6 to –4) (Fig. 8).

Fig. 8. Structure of the catBI and catBII promoter regions.

Fig. 8

(A) The promoter region of the catI gene cluster. (B) The promoter region of the catII gene cluster. The transcription start site is shown as +1. The predicted discriminator element (Dis), initiation codon (arrows, the direction represents the direction of transcription), and -10 and -35 regions of the promoter were also designated above the sequence. The promoter regions of catI and catII protected by CatRI or CatRII from DNase I digestion without CCM, called the repression binding site (RBS), are marked with black solid lines; the extended protected region in the presence of CCM, called the activation binding site (ABS), is marked with the black dotted line.

Transcriptional Cross-Regulation between the Two Catechol-Degrading Gene Clusters

The regulatory proteins CatRI and CatRII were cloned into a vector to introduce six histidine residues at the C-terminus of the protein, and were expressed and purified from E. coli as described in the Materials and Methods section. The binding abilities of CatRI and CatRII to the upstream regulatory regions of catI and catII were studied by EMSA using a concentration gradient of CCM (Fig. 9). As expected, the addition of 60 ng CatRI to 40 ng of the labeled probe caused a strong shift in the mobility of the catI promoter fragment (Fig. 9A). Notably, CatRI could also strongly bind to the catII promoter region (Fig. 9C). By contrast, CatRII was able to specifically bind the catII and catI promoter regions, but the binding stability of the CatRII-catII and CatRII-catI complexes was obviously reduced (Figs. 9B and 9D). These results support the hypothesis that CatRI and CatRI might cross-regulate the transcription of each other's target genes. In addition, CCM did not affect the binding of CatRI to the corresponding target regions, which was in agreement with previous reports [10, 13]. However, the binding regions in the presence and absence of CCM might be different. As can be seen in Figs. 9B anddding CCM to the reaction mixture decreased the intensity of the DNA band, indicating that CatRII recognizes and binds to the catII and catI promoters when CCM is at a lower concentration.

Fig. 9. EMSA of CatRI and CatRII binding to the catI and catII promoters, respectively.

Fig. 9

(A) EMSA of CatRI binding to the catI promoter. (B) EMSA of CatRII binding to the catII promoter. (C) EMSA of CatRI binding to the catII promoter. (D) EMSA of CatRII binding to the catI promoter. The first lane contains the free fragment, lanes 2-7 contain labeled probe and CatRI or CatRII protein, with 0, 0.1, 1.0, 10, 100, and 500 μM muconic acid, respectively. The concentration of the labeled probe was fixed at 40 ng.

Promoter Activity Analysis of the Two Catechol-Degrading Gene Clusters

The primer extension assay indicated that there might be significant differences in the abundance of transcripts between the catI and catII clusters. To test this idea, the promoter activities of catI and catII (transcriptionally fused to the lacZ gene in pDN19lacΩ) were examined using the classical reporter β-galactosidase (Table 3).

Table 3.

Determination of relative promoter activities via β-galactosidase expression (measured in Miller units).

Strains NC NP1 NP2 ND1P1 ND1P2 ND2P1 ND2P2
MMB + glucose 8.37 151.30 15.89 8.09 9.45 196.37 8.19
MMB + naphthalene 8.30 199.31 11.52 11.87 9.94 297.38 11.54

*The β-galactosidase activity was determined in the following strains: NC (ND6 containing pDN19lacΩ); NP1 (ND6 containing pDN19lacΩ + catI promoter); NP2 (ND6 containing pDN19lacΩ + catII promoter); ND1P1 (ND6-ΔcatRI containing pDN19lacΩ + catI promoter); ND1P2 (ND6-ΔcatRI containing pDN19lacΩ + catII promoter); ND2P1 (ND6-ΔcatRII containing pDN19lacΩ + catI promoter); ND2P2 (ND6-ΔcatRII containing pDN19lacΩ + catII promoter).

As expected, in strain NP2 (ND6 wild type containing the catII promoter-lacZ fusion), the β-galactosidase activity was low in both glucose and naphthalene media. By contrast, the β-galactosidase activity of strain NP1 (ND6 wild type containing the catI promoter-lacZ fusion) was very high, indicating that the catI promoter is much stronger than the catII promoter. The activity of the catII promoter in cells grown on glucose or naphthalene showed little variation, probably because the transcript abundance was too low. The β-galactosidase activity of NP1 cells grown on glucose was approximately 75.9% of the activity of cells grown on naphthalene, indicating that naphthalene or its metabolites can slightly induce the catI promoter but are not necessary for its activity.

To confirm the function of CatRI, we introduced the plasmid pDBI (pDN19lacΩ + catI promoter) and plasmid pDBII (pDN19lacΩ+catII promoter) into ND6-ΔcatRI and ND6-ΔcatRII, respectively, resulting in the strains ND1P1 and ND1P2. A drastic reduction of β-galactosidase activity was observed in ND1P1, whereby the promoter activity of catI was almost equal to that of the control strain NC (ND6 containing pDN19lacΩ) in glucose-grown cells, but the catI promoter could be still induced slightly in naphthalene-grown cells. This result suggested CatRII might function as a backup regulator. Interestingly, the promoter activity of catII was also decreased in the CatRI mutant (ND1P2) compared with NP2, suggesting that CatRI might competitively bind the promoter region of catII and initiate transcription more effectively in the wild-type ND6. On the other hand, we found that the β-galactosidase activity of ND2P1 (ND6-ΔcatRII containing pDN19lacΩ + catI promoter) was obviously higher than that of NP1, both on glucose and on naphthalene. This result suggested that CatRI could bind the catII promoter and initiate transcription more efficiently with or without the inducer when CatRII is unavailable. All these results were in agreement with the EMSA results. Through in vitro and in vivo experiments, we have confirmed that two regulatory proteins CatRI and CatRII have interactive regulation on the catI and catII gene clusters, and CatRI has a stronger regulatory and activation effect on the gene clusters than CatRII.

Evolutionary Analysis of the Two Catechol-Degrading Gene Clusters and Their Promoter Regions

To analyze the diversity of the two catechol-degrading gene clusters in the ND6 genome, 24 sequences of different cat gene clusters were downloaded from NCBI to construct a phylogenetic tree (Fig. 10). Overall, the phylogenetic analysis showed that the cat gene clusters have significant phylogenetic diversity, and could be divided into two main groups depending on the genus. Most Pseudomonas spp. have two cat clusters, which constituted one group, including catI and catII of the ND6 strain. In the Pseudomonas spp. group, most second copies of the cat gene clusters, including catRIIBIICIIAII of P. putida ND6, formed a monophyletic clade. By contrast, most cat1 gene clusters, including catRIBICIAI of P. putida ND6, formed a separate clade, indicating that catI and catII of ND6 have different evolutionary origins. Interestingly, in three Burkholderia sp. strains (GenBank: CP001052.1, GenBank: AB035483.1 and GenBank: CP026112.1), catA was found to be transcribed individually while catR-catB-catC was transcribed in the opposite direction, which is different from the common order catB-catC/catA-catA/catC. Therefore, the expression of C12O, encoded by catA, must be very adaptable to respond to the environment. However, gene clusters with different transcription sequences have a far-reaching relationship. Consistent with a previous study[38], analysis of an alignment of nine intergenic regions of catB downloaded from NCBI confirmed the presence of two types of binding motifs, with conserved sequences T-N11-A and mutant sequences G-N11-A (Fig. 11). In agreement with a report by Parsek et al. [37], the mutation of a T to a G resulted in an increase in the binding of CatRI to both the catBI and catBII promoters (Fig. 9).

Fig. 10. Phylogenetic analysis of cat gene clusters.

Fig. 10

The phylogenetic tree was generated using MEGA 5.0 with maximum parsimony and 1000 bootstrap replicates. Reference DNA sequences were selected by BLAST searches in the NCBI database.

Fig. 11. LOGO diagrams of the binding sites occupied by CatR.

Fig. 11

The sequence was derived from the catR-B intergenic region of the reported catRBCA gene clusters, including P. putida PRS2000 [13], P. putida RB1 [11], Pseudomonas resinovorans strain CA10 [40], Acinetobacter lwoffii K24 [41], Frateuria sp. ANA-18 [19, 23], and P. putida ND6. The LOGO diagrams were built using all the predicted binding sites for the respective CatR in all studied genomes in all catR-B intergenic regions. The sequence between the two dashed lines is an inverted repeat (T-N11-A ) or an incomplete inverted repeat (G-N11-A ). The T/G and A residues of the T/G-N11-A motif were marked in red and green, respectively.

Discussion

A number of aerobic biodegradation pathways of aromatic compounds like phenol, benzoate, or naphthalene converge into catechol ring cleavage [42]. Our previous study showed that each C12O isozyme in P. putida ND6, encoded by the separate catA genes on the chromosome and the large pND6-1 plasmid, belonged to independent branches of the phylogenetic tree and have different enzymatic properties [17]. The two catA genes located on the chromosome (Fig. 1) were found to significantly contribute to the fitness of the host strain that is adapted to high concentrations of naphthalene [27]. The phenotypic determination showed that the growth curve of P. putida ND6-ΔcatAnahH decreased slightly compared to the wild type, indicating that the two catechol ortho-cleavage clusters in the genome play an important role but are not the only genes with this function. In nature, many bacteria grow and develop by catechol ortho- and meta-cleavage pathways to adapt to the presence of aromatics in the environment [3, 43]. The results of RT-qPCR and the catechol dioxygenase enzyme activity assay supported this idea. In addition to P. putida ND6, many other strains, especially of Pseudomonas and Burkholderia spp., possess multiple cat gene clusters. In Burkholderia sp. strain TH2, although catA2 is not indispensable for the growth on 2CB, the presence of the cat2 gene cluster is beneficial [44]. Similar observations were made in Acinetobacter lwoffii K24, and Frateuria species ANA-18 [19]. Thus, the presence of multiple cat genes or clusters in the same cell is a widespread phenomenon[14] that may help the host adapt to changing environments by either reducing the intracellular concentration of catechol, which is a toxic intermediate of the degradation of various aromatic compounds, or by substituting for each other to circumvent harmful mutations [3].

It is interesting to note the different arrangement of cat genes in Fig. 10. Most of them are arranged in the order catB-catC/catA-catA/catC, while the catR gene is divergently transcribed from the operon. Furthermore, the catA gene is transcribed separately from catR-catB-catC as arranged in Paraburkholderia terrae strain DSM 17804, Burkholderia sp. strain TH2 and Paraburkholderia phytofirmans strain PsJN. At the same time, we found that catA is under independent transcriptional regulation in the ND6 strain, while the catBCA operon is co-transcribed. Consequently, we assumed that individual transcription of the catA gene might be important and not an accidental evolutionary event. Notably, catA encodes the rate-limited enzyme C12O in the catechol ortho-cleavage pathway, so the abundance of C12O should be regulated sensitively and quickly to adapt to the concentration of the substrate. Therefore, the independent transcription of catA might represent a positively selected genetic adaptation [3].

The intricate regulatory interplay of multiple cat gene clusters suggests an intimate mutual adaptation [45]. For instance, CatR is able to activate the clcABD promoter but ClcR cannot activate the catBCA promoter in P. putida PRS2000 [46]. As a result, transcription from the clc promoter is repressed by the TCA-cycle intermediates succinate, citrate and fumarate, while the presence of these organic acids does not affect the transcription from the cat promoter. This difference provides some flexibility to respond to different environmental signals in addition to the presence of the inducer [47]. Similarly, the question of how the two catBCA gene clusters are regulated in P. putida ND6 was investigated. We found that the core transcriptional activation mechanisms of the two ortho-cleavage operons are conserved. First, both can be induced by CCM. Second, CatRI and CatRII are the native regulatory proteins of the catI cluster and catII cluster, respectively. Third, in the absence of CCM, CatRI and CatRII bind to the RBS, which contains a T/G-N11-A motif, presumably allowing CatR to negatively regulate its own expression, while in the presence of CCM, CatRI and CatRII occupy an adjacent downstream site, designated as the ABS. Based on these conserved characters, CatRI and CatRII share functional similarities which allow them to complement each other’s mutants at the transcriptional level. Different from CatR and ClcR of P. putida, CatRI and CatRII can activate the promoters of the other, which provides another level of flexibility to respond to harmful mutations of each regulator. Additionally, EMSA demonstrated that CatRI binds to both the catI and catII promoters with high affinity, while CatRII binds weakly. These observations were confirmed by lacZ transcriptional-fusion expression experiments, which indicated that CatRI might competitively bind the promoter region of catII and initiate transcription more effectively (Table 3). A mutation in the binding motif from T-N11-A (catII) to G-N11-A (catI) may explain the difference of binding characteristics. In conclusion, the two cat gene clusters in P. putida ND6 can cross-regulate each other as a result of similar evolutionary origins, but they diverged due to the accumulation of mutations that appear to be evolutionarily advantageous.

In this study, we found that the catCI/catCII and catAI/catAII genes are transcribed independently, in addition to the co-transcription of the catBCA operon. We are conducting further experiments to demonstrate why and how the regulation of cat genes in P. putida ND6 is so complex.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (Grant Nos. 21477163 and 31670512), and the Natural Science Basic Research Plan in Shaanxi Province of China (Grant No. 2018JM3039).

Footnotes

Conflict of Interest

The authors have no financial conflicts of interest to declare.

REFERENCES

  • 1.Linger JG, Vardon DR, Guarnieri MT, Karp EM, Hunsinger GB, Franden MA, et al. Lignin valorization through integrated biological funneling and chemical catalysis. Proc. Natl. Acad. Sci. USA. 2014;111:12013–12018. doi: 10.1073/pnas.1410657111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Mallick S. Biodegradation of acenaphthene by Sphingobacterium sp. strain RTSB involving trans-3-carboxy-2-hydroxybenzylidenepyruvic acid as a metabolite. Chemosphere . 2019;219:748–755. doi: 10.1016/j.chemosphere.2018.12.046. [DOI] [PubMed] [Google Scholar]
  • 3.Setlhare B, Kumar A, Mokoena MP, Olaniran AO. Catechol 1,2-Dioxygenase is an analogue of Homogentisate 1,2-Dioxygenase in Pseudomonas chlororaphis Strain UFB2. Int. J. Mol. Sci. 2018;20:61. doi: 10.3390/ijms20010061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Singh SN, Kumari B, Upadhyay SK, Mishra S, Kumar D. Bacterial degradation of pyrene in minimal salt medium mediated by catechol dioxygenases: enzyme purification and molecular size determination. Bioresour. Technol. 2013;133:293–300. doi: 10.1016/j.biortech.2013.01.068. [DOI] [PubMed] [Google Scholar]
  • 5.Wackett LP. Pseudomonas putida a versatile biocatalyst. Nat. Biotechnol. 2003;21:136–138. doi: 10.1038/nbt0203-136. [DOI] [PubMed] [Google Scholar]
  • 6.Jimenez JI, Perez-Pantoja D, Chavarria M, Diaz E, de Lorenzo V. A second chromosomal copy of the catA gene endows Pseudomonas putida mt-2 with an enzymatic safety valve for excess of catechol. Environ. Microbiol. 2014;16:1767–1778. doi: 10.1111/1462-2920.12361. [DOI] [PubMed] [Google Scholar]
  • 7.Caposio P, Pessione E, Giuffrida G, Conti A, Landolfo S, Giunta C, et al. Cloning and characterization of two catechol 1,2-dioxygenase genes from Acinetobacter radioresistens S13. Res. Microbiol. 2002;153:69–74. doi: 10.1016/S0923-2508(01)01290-6. [DOI] [PubMed] [Google Scholar]
  • 8.Harwood CS, Parales RE. The beta-ketoadipate pathway and the biology of self-identity. Annu. Rev. Microbiol. 1996;50:553–590. doi: 10.1146/annurev.micro.50.1.553. [DOI] [PubMed] [Google Scholar]
  • 9.Tumen-Velasquez MP, Laniohan NS, Momany C, Neidle EL. Engineering CatM, a LysR-type transcriptional regulator, to respond synergistically to two effectors. Genes (Basel) 2019;10:421. doi: 10.3390/genes10060421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Parsek MR, Shinabarger DL, Rothmel RK, Chakrabarty AM. Roles of CatR and cis,cis-muconate in activation of the catBC operon, which is involved in benzoate degradation in Pseudomonas putida. J. Bacteriol. 1992;174:7798–7806. doi: 10.1128/JB.174.23.7798-7806.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chugani SA PM, Hershberger CD, Murakami K, Ishihama A, Chakrabarty AM. Activation of the catBCA promoter: probing the interaction of CatR and RNA polymerase through in vitro transcription. J. Bacteriol. 1997;179:2221–2227. doi: 10.1128/JB.179.7.2221-2227.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Tover A, Ojangu EL, Kivisaar M. Growth medium composition-determined regulatory mechanisms are superimposed on CatR-mediated transcription from the pheBA and catBCA promoters in Pseudomonas putida. Microbiology. 2001;147:2149–2156. doi: 10.1099/00221287-147-8-2149. [DOI] [PubMed] [Google Scholar]
  • 13.Rothmel RK, Aldrich TL, Houghton JE, Coco WM, Ornston LN, Chakrabarty AM. Nucleotide sequencing and characterization of Pseudomonas putida catR: a positive regulator of the catBC operon is a member of the LysR family. J. Bacteriol. 1990;172:922–931. doi: 10.1128/JB.172.2.922-931.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kohlstedt M, Starck S, Barton N, Stolzenberger J, Selzer M, Mehlmann K, et al. From lignin to nylon: cascaded chemical and biochemical conversion using metabolically engineered Pseudomonas putida. Metab. Eng. 2018;47:279–293. doi: 10.1016/j.ymben.2018.03.003. [DOI] [PubMed] [Google Scholar]
  • 15.Pi H, Helmann JD. Genome-wide characterization of the fur regulatory network reveals a link between catechol degradation and bacillibactin metabolism in Bacillus subtilis. mBio. 2018;9:e01451–18. doi: 10.1128/mBio.01451-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Li S, Zhao H, Li Y, Niu S, Cai B. Complete genome sequence of the naphthalene-degrading Pseudomonas putida strain ND6. J. Bacteriol. 2012;194:5154–5155. doi: 10.1128/JB.01190-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Li S, Qin K, Li H, Guo J, Li D, Liu F, et al. Cloning and characterisation of four catA genes located on the chromosome and large plasmid of Pseudomonas putida ND6. Electronic J. Biotechnol. 2018;34:83–90. doi: 10.1016/j.ejbt.2018.06.001. [DOI] [Google Scholar]
  • 18.Kim SI, Leem SH, Choi JS, Chung YH, Kim S, Park YM, et al. Cloning and characterization of two catA genes in Acinetobacter lwoffii K24. J. Bacteriol. 1997;179:5226–5231. doi: 10.1128/JB.179.16.5226-5231.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Murakami S, Takashima A, Takemoto J, Takenaka S, Shinke R, Aoki K. Cloning and sequence analysis of two catecholdegrading gene clusters from the aniline-assimilating bacterium Frateuria species ANA-18. Gene. 1999;226:189–198. doi: 10.1016/S0378-1119(98)00560-5. [DOI] [PubMed] [Google Scholar]
  • 20.Suzuki K, Ichimura A, Ogawa N, Hasebe A, Miyashita K. Differential expression of two catechol 1,2-dioxygenases in Burkholderia sp. strain TH2. J. Bacteriol. 2002;184:5714–5722. doi: 10.1128/JB.184.20.5714-5722.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Tian M, Du D, Zhou W, Zeng X, Cheng G. Phenol degradation and genotypic analysis of dioxygenase genes in bacteria isolated from sediments. Braz. J. Microbiol. 2017;48:305–313. doi: 10.1016/j.bjm.2016.12.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yoon YH, Yun SH, Park SH, Seol SY, Leem SH, Kim SI. Characterization of a new catechol branch of the beta-ketoadipate pathway induced for benzoate degradation in Acinetobacter lwoffii K24. Biochem. Biophys. Res. Commun. 2007;360:513–519. doi: 10.1016/j.bbrc.2007.05.132. [DOI] [PubMed] [Google Scholar]
  • 23.Takashima A, Murakami S, Takenaka S, Aoki K. Regulation by two CatR proteins that differ in binding affinity to catB promoters expressing two cat gene clusters. Biosci. Biotechnol. Biochem. 2001;65:2146–2153. doi: 10.1271/bbb.65.2146. [DOI] [PubMed] [Google Scholar]
  • 24.Ahn IS, Ghiorse WC, Lion LW, Shuler ML. Growth kinetics of Pseudomonas putida G7 on naphthalene and occurrence of naphthalene toxicity during nutrient deprivation. Biotechnol. Bioeng. 1998;59:587–594. doi: 10.1002/(SICI)1097-0290(19980905)59:5<587::AID-BIT9>3.0.CO;2-6. [DOI] [PubMed] [Google Scholar]
  • 25.Sota M, Yano H, Ono A, Miyazaki R, Ishii H, Genka H, et al. Genomic and functional analysis of the IncP-9 naphthalenecatabolic plasmid NAH7 and its transposon Tn4655 suggests catabolic gene spread by a tyrosine recombinase. J. Bacteriol. 2006;188:4057–4067. doi: 10.1128/JB.00185-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Dennis JJ, Zylstra GJ. Complete sequence and genetic organization of pDTG1, the 83 kilobase naphthalene degradation plasmid from Pseudomonas putida strain NCIB 9816-4. J. Mol. Biol. 2004;341:753–768. doi: 10.1016/j.jmb.2004.06.034. [DOI] [PubMed] [Google Scholar]
  • 27.Li SS, Hu X, Zhao H, Li YX, Zhang L, Gong LJ, et al. Quantitative analysis of cellular proteome alterations of Pseudomonas putida to naphthalene-induced stress. Biotechnol. Lett. 2015;37:1645–1654. doi: 10.1007/s10529-015-1828-y. [DOI] [PubMed] [Google Scholar]
  • 28.Park W, Jeon CO, Hohnstock-Ashe AM, Winans SC, Zylstra GJ, Madsen EL. Identification and characterization of the conjugal transfer region of the pCg1 plasmid from naphthalene-degrading Pseudomonas putida Cg1. Appl. Environ. Microbiol. 2003;69:3263–3271. doi: 10.1128/AEM.69.6.3263-3271.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. A broad-host-range Flp-FRT recombination system for sitespecific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene. 1998;212:77–86. doi: 10.1016/S0378-1119(98)00130-9. [DOI] [PubMed] [Google Scholar]
  • 30.Totten PA, Lory S. Characterization of the type a flagellin gene from Pseudomonas aeruginosa PAK. J. Bacteriol. 1990;172:7188–7199. doi: 10.1128/JB.172.12.7188-7199.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Green M R, Sambrook J. Molecular Cloning: A Laboratory Manual. 4th ed. Cold Spring Harbor Laboratory; 2012. [Google Scholar]
  • 32.Li S, Li X, Zhao H, Cai B. Physiological role of the novel salicylaldehyde dehydrogenase NahV in mineralization of naphthalene by Pseudomonas putida ND6. Microbiol. Res. 2011;166:643–653. doi: 10.1016/j.micres.2011.01.003. [DOI] [PubMed] [Google Scholar]
  • 33.Paulin MM, Novinscak A, St-Arnaud M, Goyer C, DeCoste NJ, Prive JP, et al. Transcriptional activity of antifungal metaboliteencoding genes phlD and hcnBC in Pseudomonas spp. using RT-qPCR. FEMS Microbiol. Ecol. 2009;68:212–222. doi: 10.1111/j.1574-6941.2009.00669.x. [DOI] [PubMed] [Google Scholar]
  • 34.Fekete RA, Miller MJ, Chattoraj DK. Fluorescently labeled oligonucleotide extension: a rapid and quantitative protocol for primer extension. Biotechniques. 2003;35:90–94. doi: 10.2144/03351rr01. 97-98. [DOI] [PubMed] [Google Scholar]
  • 35.Wang Y, Cen XF, Zhao GP, Wang J. Characterization of a new GlnR binding box in the promoter of amtB in Streptomyces coelicolor inferred a PhoP/GlnR competitive binding mechanism for transcriptional regulation of amtB. J. Bacteriol. 2012;194:5237–5244. doi: 10.1128/JB.00989-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Chugani SA PM, Chakrabarty AM. Transcriptional repression mediated by LysR-type regulator CatR bound at multiple binding sites. J. Bacteriol. 1998;172:922–931. doi: 10.1128/JB.180.9.2367-2372.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Parsek MR, Ye RW, Pun P, Chakrabarty AM. Critical nucleotides in the interaction of a LysR-type regulator with its target promoter region catBC promoter activation by CatR. J. Biol. Chem. 1994;269:11279–11284. doi: 10.1016/S0021-9258(19)78122-8. [DOI] [PubMed] [Google Scholar]
  • 38.Goethals K, Van Montagu M, Holsters M. Conserved motifs in a divergent nod box of Arhizobium caulinodans ORS571 reveal a common structure in promoters regulated by LysR-type proteins. Proc. Natl. Acad. Sci. USA. 1992;89:1646–1650. doi: 10.1073/pnas.89.5.1646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Browning DF, Busby SJ. Local and global regulation of transcription initiation in bacteria. Nat. Rev. Microbiol. 2016;14:638–650. doi: 10.1038/nrmicro.2016.103. [DOI] [PubMed] [Google Scholar]
  • 40.Nojiri H, Maeda K, Sekiguchi H, Urata M, Shintani M, Yoshida T, et al. Organization and transcriptional characterization of catechol degradation genes involved in carbazole degradation by Pseudomonas resinovorans strain CA10. Biosci. Biotechnol. Biochem. 2002;66:897–901. doi: 10.1271/bbb.66.897. [DOI] [PubMed] [Google Scholar]
  • 41.Kim SI, Ha KS, Leem SH. Differential organization and transcription of the cat2 gene cluster in aniline-assimilating Acinetobacter lwoffii K24. J. Biosci. Bioeng. 1999;88:250–257. doi: 10.1016/S1389-1723(00)80005-5. [DOI] [PubMed] [Google Scholar]
  • 42.Vesely M, Knoppova M, Nesvera J, Patek M. Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis. Appl. Microbiol. Biotechnol. 2007;76:159–168. doi: 10.1007/s00253-007-0997-6. [DOI] [PubMed] [Google Scholar]
  • 43.Chettri B, Singh AK. Kinetics of hydrocarbon degradation by a newly isolated heavy metal tolerant bacterium Novosphingobium panipatense P5:ABC. Bioresour. Technol. 2019;294:122190. doi: 10.1016/j.biortech.2019.122190. [DOI] [PubMed] [Google Scholar]
  • 44.Zhao H, Chen D, Li Y, Cai B. Overexpression, purification and characterization of a new salicylate hydroxylase from naphthalene-degrading Pseudomonas sp. strain ND6. Microbiol. Res. 2005;160:307–313. doi: 10.1016/j.micres.2005.02.004. [DOI] [PubMed] [Google Scholar]
  • 45.Suvorova IA, Gelfand MS. Comparative genomic analysis of the regulation of aromatic metabolism in betaproteobacteria. Front. Microbiol. 2019;10:642. doi: 10.3389/fmicb.2019.00642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Parsek MR, McFall SM, Shinabarger DL, Chakrabarty AM. Interaction of two LysR-type regulatory proteins CatR and ClcR with heterologous promoters: functional and evolutionary implications. Proc. Natl. Acad. Sci. USA. 1994;91:12393–12397. doi: 10.1073/pnas.91.26.12393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.McFall SM, Chugani SA, Chakrabarty AM. Transcriptional activation of the catechol and chlorocatechol operons: variations on a theme. Gene. 1998;223:257–267. doi: 10.1016/S0378-1119(98)00366-7. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Microbiology and Biotechnology are provided here courtesy of Korean Society for Microbiology and Biotechnology

RESOURCES