Abstract
Duck infectious serositis is an acute and infectious disease caused by Riemerella anatipestifer (R. anatipestifer) that leads to perihepatitis, pericarditis, meningitis, and airbag inflammation in ducks, which causes serious economic losses to the global duck industry. The phoP/phoR is a novel 2-component signal transduction system first reported in gram-negative bacteria, of which phoP acts as a global regulator and virulence factor. In this study, the phoP gene from the R. anatipestifer YM strain was knocked out using homologous recombination technology and replaced with the spectinomycin resistance gene (Spec). The virulence of the R. anatipestifer YMΔphoP strain was reduced by approximately 47,000 times compared to that of the wild-type R. anatipestifer YM strain. Ducks were immunized with live R. anatipestifer YMΔphoP strain by subcutaneous inoculation at a dose of 106 to 107 CFU (0.2 mL per duck) and challenged with the wild-type R. anatipestifer YM strain 14 days later. The protection rate in the immunized group was 100%. The growth characteristics of ducks in the immunized and negative control groups were normal, and the research demonstrated R. anatipestifer YMΔphoP strain have suitable immunogenicity and protective effects. Thus, the study findings suggest that the novel R. anatipestifer YMΔphoP strain may provide a candidate for the development of a gene deletion activated vaccine against duck infectious serositis.
Key words: Riemerella anatipestifer, R. anatipestifer YMΔphoP, Immunity
INTRODUCTION
Riemerella anatipestifer (formerly Pasteurella anatipestifer) is a gram-negative rod-shaped bacterium that mainly infects ducks at 1-8 weeks of age, with particularly high infection rates at 2 to 3 wk of age (Segers et al., 1993; Pathanasophon et al., 1995; Birkey et al., 1998; Hu et al., 2011). Once R. anatipestifer invades the host body, the bacterium multiplies rapidly and reaches various tissues and organs through the blood, causing systemic serositis. The main clinical anatomical manifestations of R. anatipestifer infection are fibrinous pericarditis, perihepatitis, airsacculitis, and meningitis (Liu et al., 2015; Fernandez et al., 2018; Wang et al., 2019a; Yang et al., 2019). Duck infectious serositis was first reported in Long Island, New York in 1932 and subsequently spread throughout Australia, the United Kingdom, the former Soviet Union, and other countries (Hendrickson and Hilbert, 1932). Currently, duck infectious serositis occurs worldwide with high morbidity and mortality rates, and causes considerable economic losses to the duck industry (Cobb and Smith, 2015; Fernandez et al., 2016). Because long-term dependence on antibiotics may lead to drug resistance in pathogenic bacteria and drug residues in meat products (Gao et al., 2014; Tang et al., 2018; Yang et al., 2020), the development and application of safe and efficient vaccines are needed to prevent and control this infectious disease (Kang et al., 2018).
Many R. anatipestifer serotypes have been identified, displaying dynamic distribution in different countries and regions. Serotypes were reported with no cross-protective effects. Sandhu and Harry (1981) reported that serotypes 1, 2, and 5 were the main serotypes in the United States. Many studies have evaluated the use of inactivated vaccines against R. anatipestifer, revealing that their immune effects are directly related to locally circulating serotypes. However, producing inactivated vaccines is expensive, the immunization period is short, and the appropriate bacterial count and adjuvant type must be evaluated in depth. Indeed, a P. anatipestifer vaccine comprising a combination of inactivated Escherichia coli serotype O78 and P. anatipestifer bacterin showed high protection rates in ducks at 10 and 17 d of age but the protective effect only lasted for 2 wk, and research demonstrated that vaccination with aluminum-hydroxide-gel-adsorbed bacterin did not improve immunity compared to that achieved with the nonadjuvanted vaccine. Moreover, inoculation with oil-emulsion bacterin conferred adequate protection up to market age, but it caused local damage at the inoculation site (Sandhu and Layton, 1985). In contrast, live vaccines can induce humoral, cellular, and mucosal immune responses in the body for an extended period of time.
phoP/phoR is a novel 2-component signal transduction first reported in gram-negative bacteria (Wang et al., 2017), and also exists in many gram-positive bacteria, including Bacillus subtilis (Guo et al., 2010) and Mycobacterium tuberculosis (Cimino et al., 2012). The phoP gene is a member of the pho regulator family and is subject to autoregulation via promoter binding (Liu and Hulett, 1997; Sieberi et al., 2020; Singh et al., 2020). PhoP acts as a global regulator and virulence factor, playing important roles in the regulation of upstream and downstream gene regulation. Therefore, the objective of this study was to use homologous recombination technology (Lu et al., 2013; Luo et al., 2015) to replace phoP with the spectinomycin-resistance gene (Spec) in the R. anatipestifer YM strain (serotype 1), evaluate its virulence, and analyze the effects of immunization with different doses of live R. anatipestifer YMΔphoP strain in ducks. Our findings elucidate the safety and efficacy of live R. anatipestifer YMΔphoP strain and demonstrate its potential clinical application for the protection of ducks against R. anatipestifer infection.
MATERIALS AND METHODS
Animals
Five-day-old healthy Cherry Valley ducks were purchased from Yongsheng Duck Company (Wuhan, China) and housed in isolated animal rooms at 28 to 30°C. The ducks were housed in cages with a 12-h light/duck per day with free access to food and water. All animal experiments and procedures were approved by the Research Ethics Committee of Huazhong Agricultural University (approval no. HZAUSW-2018-011).
Bacterial Strains, Plasmids, and Culture Conditions
Both the wild-type R. anatipestifer YM (serotype 1) and R. anatipestifer YMΔphoP strains were grown in tryptic soy broth (TSB; Becton Dickinson, Sparks, MD), whereas E. coli X7213 cells were grown in Luria Broth. The incubation temperature was 37°C. The following antibiotics were added as needed: spectinomycin (Sigma-Aldrich, St. Louis, MO; 100 μg/mL), ampicillin (Sigma-Aldrich; 100 μg/mL), and chloramphenicol (Sigma-Aldrich; 50 μg/mL). For the cultivation of E. coli X7213, 50 μg/mL diaminopimelic acid (Sigma-Aldrich) was added to the medium. The pRE112 suicide plasmid was used to construct the gene deletion strain. The pIC333 plasmid was used to amplify the spectinomycin resistance gene (Spec). All strains and plasmids were retrieved from the repository of our laboratory. The primers used in this study are listed in Table 1.
Table 1.
Primers used in this study.
| Name | Sequence (5′-3′) | Use | Reference or Designed |
|---|---|---|---|
| phoPL-F | CTGGTACCCACTATTGCTGATGAGGTTTACCTTGAAAATCAACTAAAG | Amplification of the left arm of phoP | Designed |
| phoPL-R | AACGTGAGTTTTCGTTCCACTGCTTTTGGTCATCTTCTACTAATAATATCCTGTTGCTCAT | ||
| phoP-F | ATGAGCAACAGGATATTATTAGTAGAAGATGACCAAAG | Identification of mutant phoP | Designed |
| phoP-R | ATTTTTAACTAGAAGCCTAAACCCTTCCCCGTGTACATT | ||
| phoPR-F | CAGGTGCTTACTTTTAAAACTACTGTTCGGGGAAGGGTTTAGGCTTCTAGTTAAAAATTAA | Amplification of the right arm of phoP | Designed |
| phoPR-R | AGAGCTCGCACCACTCATTATGATTTTCTTTTGTATTTATTGTTAGAG | ||
| phoP Spec-F | ATGAGCAACAGGATATTATTAGTAGAAGATGACCAAAGCAGTGGAACGAAAACTCACGTT | Amplification of Spec | Designed |
| phoP Spec-R | TTAATTTTTAACTAGAAGCCTAAACCCTTCCCCGCAGTAGTTTTAAAAGTAAGCACCTG | ||
| Spec-F | AAGAAAAAAATAAAATCATGAGTAGAGCAGTGGAACGAA AACTCACGTT | Identification mutant of phoP | Designed |
| Spec-R | GCCCTTAAACCACATTTATAAAAGCCAGTAGTTTTAAAAGTAAGCACCTG |
Construction and Identification of the R. anatipestifer YMΔphoP Strain
The left and right homologous arms (L, R) were amplified using PCR with primer pairs phoPL-F/phoPL-R and phoPR-F/phoPR-R. Spec was amplified using primers phoP Spec-F and phoP Spec-R. The 3 gene fragments were concatenated using overlap extension PCR and digested with KpnI and SacI. The LSR fragment (spectinomycin resistance marker flanked by phoP homologous arms) was ligated into the pRE112 plasmid, resulting in the successful construction of the suicide plasmid pRE112-LSR (Zhao et al., 2016; Guo et al., 2017a). Transformation with E. coli X7213 as the donor strain and wild-type R. anatipestifer YM as the recipient strain was conducted to construct the R. anatipestifer YMΔphoP strain (Figure 1A). The combined and transferred bacterial solution was spread on a TSA plate containing spectinomycin, and a single colony was selected after 5 consecutive passages for identification (Guo et al., 2017b; Gong et al., 2020), using primers Spec-F Spec-R and phoP-F phoP-R.
Figure 1.
Construction of the R. anatipestifer YMΔphoP strain. (A) Diagram of the designed R. anatipestifer YMΔphoP mutant strain. (B) PCR amplification of the left and right homologous arms of the phoP and Spec genes. Lanes 1–3: PCR products of the left homologous arm. Lanes 4–6: PCR products of the right homologous arm. Lanes 7–9: PCR products of the Spec gene. (C) Overlap extension PCR amplification of the left and right homologous arms of the phoP and Spec genes. Lanes 1 and 2: PCR amplification using the left arm, right arm, and Spec gene as templates. (D) Identification of the R. anatipestifer YMΔphoP strain. Lane 1: Identification of deletion strain with phoP primers. Lane 2: Identification of deletion strain with Spec primers. Lane 3: Identification of deletion strain with phoP primers. Lane 4: Identification of deletion strain with Spec primers. RA, Riemerella anatipestifer.
LD50 Determination of Wild-Type R. anatipestifer YM and R. anatipestifer YMΔphoP Strains
The wild-type R. anatipestifer YM and R. anatipestifer YMΔphoP strains were centrifuged at 1,600 × g for 3 min and resuspended in PBS. The bacterial solution for each strain was diluted to five different concentrations, including 109, 108, 107, 106, and 105 CFU/mL. Seven-day-old Cherry Valley ducks were divided into 11 groups (10 ducks per group), with ducks in each group receiving 1 of the 5 concentrations of wild-type R. anatipestifer YM strain, R. anatipestifer YMΔphoP strain, or no treatment (control). Duck feet were injected with 0.2 mL bacterial solution. Phenotypic changes were noted daily after injection, deaths were recorded, and LD50 values were calculated (Hu et al., 2010). The ratio of the LD50 of the deletion strain to that of the wild strain is the fold reduction of the virulence of the deletion strain.
Recovery, Culture, and Preparation of R. anatipestifer YMΔphoP Strain
The R. anatipestifer YMΔphoP strain was inoculated on TSA plates and placed in an incubator at 37°C and 5% CO2 for 48 to 72 h. A single colony of the R. anatipestifer YMΔphoP strain was selected, inoculated into TSB medium, and cultured at 37°C with shaking (180 r/min) until the logarithmic growth phase was reached [optical density at 600 nm (OD600) = 0.8]. Subsequently, the bacterial suspension was centrifuged at 4,200 × g for 10 min at 18 to 25°C, and the pellet was washed 3 times with PBS. The OD600 value of the bacterial solution was then adjusted to 1.0 using PBS.
Assessment of Safety of R. anatipestifer YMΔphoP Strain
Seven-day-old Cherry Valley ducks were randomly divided into 2 groups (10 ducks per group), including a negative control group and an immunized group subcutaneously inoculated with the R. anatipestifer YMΔphoP strain (108 CFU per duck). The growth, behavior, diet intake, and water consumption of the ducks were observed for 7 consecutive days.
Assessment of the Protective Effects of R. anatipestifer YMΔphoP Strain
Seven-day-old Cherry Valley ducks were randomly divided into the following 4 groups (10 ducks per group): groups 1 and 2 were subcutaneously inoculated with the R. anatipestifer YMΔphoP strain at a dose of 106 to 107 CFU; group 3 was the R. anatipestifer YM challenge control group; and group 4 was the negative control group. Blood was collected on d 7 and 14 after immunization, the serum was separated, and the antibody titer was determined by IgY ELISA. Fourteen days after immunization, ducks in groups 1, 2, and 3 were infected with the wild-type R. anatipestifer YM strain at an infection dose of 10 LD50 and observed for 7 consecutive days to determine the protection rate (Chu et al., 2015).
Determination of Serum IgY Antibody Levels in Immunized Ducks
The R. anatipestifer YMΔphoP strain was collected, washed 3 times with PBS, and sonicated. Microplates were then coated to prepare detection plates, and the sera from 14-day-old ducks were added as the primary antibody for 1 h at 37°C. Horseradish peroxidase-labeled goat anti-duck IgY (Luoyang Bai Aotong Experimental Materials Center, Henan, China) was used as a secondary antibody to measure serum IgY antibody levels in immunized ducks. Incubation with the secondary antibody was performed for 1 h at 37°C (Huang et al., 2002; Lobbedey and Schlatterer, 2003; Jia et al., 2009; Huang et al., 2011).
Detection of Serum Cytokine Levels in Immunized Ducks
Blood was collected 72 h after immunization, left to stand at 37°C for 30 min, and centrifuged at 1,600 × g for 10 min to obtain the serum. The expression levels of duck IL-2, IL-4, IL-10, and interferon (IFN)-γ were assessed using specific ELISA kits (BIOSAMITE, Shanghai, China). Serum cytokine levels were calculated from standard curves constructed using the concentration of the standard product as the abscissa and corresponding OD value as the ordinate.
Observation and Pathological Examinations
Ducks inoculated with R. anatipestifer YMΔphoP and wild-type R. anatipestifer YM strains were autopsied to observe pathological changes focusing on changes detected in the heart, liver, spleen, and brain. Additionally, the presence of bleeding, necrosis, and surface cellulose coverage was noted. The corresponding tissues were fixed in formalin, embedded in paraffin, and cut into 4-μm-thick sections for hematoxylin and eosin staining. The sections were observed under a microscope (Gao et al., 2021).
Statistical Analysis
Data are presented as the mean ± SEM. Differences among groups were determined using one-way analysis of variance with GraphPad Prism software (GraphPad Software Inc., San Diego, CA). Results with P-values < 0.05 were considered statistically significant.
RESULTS
Construction and Identification of R. anatipestifer YMΔphoP Strain
The genome of the wild-type R. anatipestifer YM strain was used as the template to amplify the left and right homologous arms of the phoP gene, and agarose gel electrophoresis showed that both bands were detected at approximately 800 bp (Figure 1B). The pIC333 plasmid was used as the template to amplify the Spec gene, and agarose gel electrophoresis revealed a band of approximately 1,100 bp (Figure 1B), which was consistent with our expectations. The Spec gene flanked by the left and right homologous arms of phoP was connected by overlap extension PCR, yielding a band size of 3,000 bp via agarose gel electrophoresis (Figure 1C), as expected. The overlapping fragment was ligated to the pRE112 plasmid for deletion of the phoP gene. The putative phoP deletion and wild-type R. anatipestifer YM strain DNA was amplified with phoP and Spec primers. Electrophoresis of the PCR products demonstrated no amplification of the phoP fragments for the putative phoP deletion strain, but Spec amplification was detected. Conversely, phoP amplification was demonstrated in the wild-type R. anatipestifer YM strain, whereas Spec amplification was not detected. These results demonstrated that the R. anatipestifer YMΔphoP strain was successfully generated (Figure 1D).
LD50 Determination Using Wild-Type R. anatipestifer YM and R. anatipestifer YMΔphoP Strains
The ducks began to die on day 1 after inoculation with the wild-type R. anatipestifer YM strain. The number of deaths peaked on d 2 to 3 and decreased on d 4 to 5, with no deaths observed on d 6 to 7. The surviving ducks did not move, preferring instead to rest in their nests. In contrast, ducks inoculated with the R. anatipestifer YMΔphoP strain showed normal behavior after inoculation, with no changes in diet or water consumption. Deaths were observed only on d 3 and 4. The LD50 of the wild-type R. anatipestifer YM strain was 3.98 × 104 CFU, compared to 1.88 × 109 CFU for the R. anatipestifer YMΔphoP strain. The virulence of the phoP deleted strain was reduced by approximately 47,000 times compared to that of the wild-type R. anatipestifer YM strain (Table 2).
Table 2.
LD50 values for wild-type R. anatipestifer YM and R. anatipestifer YMΔphoP strains.
| Strains | Dose | Survived/Total | LD50 (CFU) |
|---|---|---|---|
| Wild-type R. anatipestifer | 1.0 × 105 | 2/10 | 3.98 × 104 |
| 1.0 × 106 | 1/10 | ||
| 1.0 × 107 | 0/10 | ||
| 1.0 × 108 | 0/10 | ||
| 1.0 × 109 | 0/10 | ||
| R. anatipestifer YMΔphoP | 1.0 × 105 | 10/10 | 1.88 × 109 |
| 1.0 × 106 | 10/10 | ||
| 1.0 × 107 | 10/10 | ||
| 1.0 × 108 | 9/10 | ||
| 1.0 × 109 | 7/10 | ||
| Negative control group | n/a | 10/10 | n/a |
CFU, colony-forming units; LD50, 50% lethal dose; n/a, not applicable; R. anatipestifer, Riemerella anatipestifer.
Safety of R. anatipestifer YMΔphoP Strain
Ducks inoculated with R. anatipestifer YMΔphoP bacterial suspension were observed for 7 consecutive days, revealing no abnormalities in their appearance, behavior, or inoculation site, and no changes in the amount of water or food consumed.
Protective Effects of R. anatipestifer YMΔphoP Strain
All ducks in the immunized groups survived, regardless of the dose, whereas those in the R. anatipestifer YM challenge group died within 1 to 7 d (Table 3, Figure 2). The ducks grew normally and had no clinical symptoms caused by R. anatipestifer YM inoculation. The indirect ELISA results revealed that the serum from the immunized groups contained higher levels of antibodies than that from the negative control and R. anatipestifer YM challenge groups. Additionally, serum levels of all tested cytokines in the immunized groups were significantly increased at 72 h compared to those in the negative control and R. anatipestifer YM challenge groups (Figure 3).
Table 3.
Protective effects of the R. anatipestifer YMΔphoP gene deletion strain.
| Group | Immune dose (CFU) | Infectious dose (CFU) | Survived/Total | Survival% |
|---|---|---|---|---|
| Low dose | 1.0 × 106 | 1.0 × 106 | 10/10 | 100 |
| High dose | 1.0 × 107 | 1.0 × 106 | 10/10 | 100 |
| YM challenge | n/a | 1.0 × 106 | 0/10 | 0 |
| Negative control | n/a | n/a | 10/10 | 100 |
R. anatipestifer, Riemerella anatipestifer; cfu, colony forming units; n/a, not applicable.
Figure 2.
Protection and antibody levels for different groups. IgY antibody levels in ducks on days 7 and 14. All data are expressed as the mean ± SEM of 3 independent experiments. ⁎⁎⁎⁎P < 0.0001.
Figure 3.
Determination of serum cytokine levels in different groups, as measured by ELISA. (A) IFN-γ, (B): IL-2, (C): IL-4, (D): IL-10. All data are expressed as the mean ± SEM of 3 independent experiments. ⁎⁎⁎⁎P < 0.0001; *P < 0.05.
Observation and Pathological Examination
Ducks in the immunized and negative control groups exhibited normal tissues (Figure 4A, B), whereas those in the R. anatipestifer YM challenge group showed enlarged liver tissue, symptoms of fibrinous pericarditis, perihepatitis, and meningitis, as well as cerebral hemorrhage. Pathological examinations revealed large amounts of inflammatory substances in the epicardium, extensive fatty degeneration of liver cells, necrosis of some spleen cells, and small amounts of a red homochromatic substance in the splenic nodules. Additionally, some neurons exhibited pyknotic pyknosis, deep staining, and appeared neurotropic (Figure 4C).
Figure 4.
Staining results for histopathological sections from the ducks. (A, B) Left to right, Observations from tissue sections from the immunized and negative control groups. (C) Abnormal myocardial structure with large amounts of viscous material in the epicardial membrane. Abnormal liver tissue structures, with extensive steatosis of the liver cells. Some spleen cells were necrotic, and a small amount of red homogeneous material was detected in the splenic nodules. Some neurons were pyknotic and hyperchromatic, showing neurotropic effects. The tissues were stained with hematoxylin and eosin (200 ×).
DISCUSSION
R. anatipestifer is a major bacterial pathogen that causes economic losses in duck farming worldwide. Drugs offer a highly effective means by which to control this disease; however, drug resistance can develop with long-term drug use. Thus, few effective drugs target R. anatipestifer in many geographic areas, resulting in increased healthcare costs, deficits in food safety, and increased risk to human health. Vaccination is an effective strategy for preventing and controlling infectious serositis in ducks (Rubbenstroth et al., 2009; Tomida et al., 2019). Higgins et al. (2000) studied the cellular immune response mechanism of formalin-inactivated and live attenuated serotype 2 R. anatipestifer vaccines, reporting that the isolated wild-type strain was less pathogenic after being passaged 62 times in liquid and solid medium. After immunization of young ducks using drinking water, aerosol, or subcutaneous inoculation, analysis of serum titers using ELISA demonstrated that the attenuated vaccine induced high levels of immune antibodies that persisted for a long time compared to inoculation with the inactivated vaccine. Lymphocyte transfer tests also indicated that the attenuated vaccine induced a strong cellular immune response (Dou et al., 2018). Compared with the above study, The R. anatipestifer YMΔphoP strain was constructed by homologous recombination, which mainly has a protective effect on ducks infected with serotype 1. Since the experimental animals were vaccinated with the R. anatipestifer YMΔphoP live vaccine, they were capable of exhibiting humoral immunity and cellular immunity, which protected the ducks from R. anatipestifer infection. This is supported by our result of significantly increased serum levels of all tested cytokines. The cytokines produced after immunization include IL-2 and IFN-γ secreted by Th1 cells that mediate cellular immunity and IL-4 and IL-10 secreted by Th2 cells that mediate humoral immunity. The research indicates that the R. anatipestifer YMΔphoP strain can effectively enhance humoral immunity and cellular immune response.
Researchers have developed a live vaccine for the prevention of R. anatipestifer serotypes 1 and 2 (Kang et al., 2018). However, the vaccine requires 2 oral doses for immunization, which is costly for farmers. Wang et al. (2014, 2016) used a strain with pncA gene deletion as a vaccine candidate and obtained 90% protection after 2 vaccinations. Liu et al. (2016, 2018) employed homologous recombination to produce a virulence gene deletion strain. After knocking out the ΔB739_1343 gene, the virulence of the live vaccine candidate strain was decreased by approximately 10,000 times and the protection rate was 83.3%. Moreover, we previously generated a Cas9 gene deletion strain by homologous recombination that demonstrated protective effects and a 317-fold reduction in virulence. Although the protection rate of the Cas9 gene deletion strain reached 80% through intranasal inoculation, subcutaneous inoculation only achieved a protection rate of 30% (Wang et al., 2019b). In the current study, the virulence of the phoP deletion strain was reduced by approximately 47,000 times, and ducks were immunized with the live R. anatipestifer YMΔphoP strain by subcutaneous inoculation. The live R. anatipestifer YMΔphoP strain only requires one dosage for immunization, and the rate of protection to ducks could reach 100%. Compared to the existing methods, the vaccine described herein provides better protection, requires fewer immunizations, and uses lower immunization dosages.
Several inactivated vaccine products are commercially available in China. The production process for inactivated vaccines utilizes inactivated bacteria, resulting in suitable safety profiles. Xu et al. (2020) reported that prokaryotic ompA protein, as a predominant immunogenic protein of R. anatipestifer, was an immunizing antigen but only provided partial protection against challenge with R. anatipestifer. Studies with deletion strains of R. anatipestifer have shown that the main biochemical characteristics of the ∆phoP/phoR double gene deletion strain are similar to those of the wild-type R. anatipestifer YM strain, albeit with significantly reduced virulence and host tissue invasion capacity. Indeed, the double gene deletion strain showed an LD50 > 1010 CFU, suggesting that the strain was avirulent. However, no effective protection was achieved after ducks were immunized with the ∆phoP/phoR double gene deletion strain, suggesting that the double-component deletion strain lost both virulence and immunogenicity (Lu. T, unpublished). The ∆phoP gene deletion strain obtained in this study showed 100% protection against serotype 1 R. anatipestifer infection in ducks, while the virulence was reduced by 47,000 times. The reason that the protection effect of the phoP deletion strain was 100% and ∆phoP/phoR deletion strain had less protection effect needs further study. The phoP gene of RA is a virulence gene that has been identified using in vivo antigen technology. In the current study, homologous recombination and combined transfer were used to replace the phoP target gene with the Spec gene, yielding the R. anatipestifer YMΔphoP strain. This strain showed greatly reduced virulence and resulted in high antibody production after inoculation in ducks. Furthermore, ducks immunized with this strain were protected against infection by the wild-type strain. Overall, these findings suggest that R. anatipestifer YMΔphoP could be used as a vaccine candidate strain, thereby establishing a basis for further studies on gene deletion live vaccines for duck infectious serositis. The R. anatipestifer YMΔphoP strain exhibited a suitable level of safety and protective effects against the epidemic strain. Future studies will explore the protective effects of different vaccination doses on ducks. Additionally, the cross-protection effect of the R. anatipestifer YMΔphoP strain against other R. anatipestifer serotypes needs to be further verified owing to the large number of pathogenic serotypes. Thus, future research should employ proteomics to screen ectoproteins with cross-protection against various pathogenic RA serotypes and investigate aspects related to subunit vaccines.
ACKNOWLEDGMENTS
This work was supported by grants from the National Natural Science Foundation of China (No. 31872498 to Z.L.) and the Wuhan Science and Technology Bureau (grant no. 2015020101010070 to Z.L.).
DISCLOSURES
The authors declare that they have no conflicts of interest.
References
- Bickey S.M., Liu W., Zhang X., Duggan M.F., Hulett F.M. Pho signal transduction network reveals direct transcriptional regulation of one two-component system by another two-component regulator: Bacillus Subtilis PhoP directly regulates production of ResD. Mol. Microbiol. 1998;30:943–953. doi: 10.1046/j.1365-2958.1998.01122.x. [DOI] [PubMed] [Google Scholar]
- Chu C.-Y., Liu C.-H., Liou J.-J., Lee J.-W., Cheng L.-T. Development of a subunit vaccine containing recombinant Riemerella Anatipestifer outer membrane protein a and CpG ODN adjuvant. Vaccine. 2015;33:92–99. doi: 10.1016/j.vaccine.2014.11.010. [DOI] [PubMed] [Google Scholar]
- Cimino M., Thomas C., Namouchi A., Dubrac S., Gicquel B., Gopaul D.N. Identification of DNA binding motifs of the Mycobacterium tuberculosis PhoP/PhoR two-component signal transduction system. PLoS One. 2012;7:e42876. doi: 10.1371/journal.pone.0042876. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cobb S.P., Smith H. The spread of non-OIE-listed avian diseases through international trade of chicken meat: an assessment of the risks to New Zealand. Rev. Sci. Tech. 2015;34:795–812. doi: 10.20506/rst.34.3.2396. [DOI] [PubMed] [Google Scholar]
- Dou Y., Yu G., Wang X., Wang S., Li T., Tian M., Qi J., Ding C., Yu S. The Riemerella Anatipestifer M949_RS01035 gene is involved in bacterial lipopolysaccharide biosynthesis. Vet. Res. 2018;49:93. doi: 10.1186/s13567-018-0589-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fernandez C.P., Afrin F., Flores R.A., Kim W.H., Jeong J., Kim S., Lillehoj H.S., Min W. Identification of duck IL-4 and its inhibitory effect on IL-17A expression in R. Anatipestifer-stimulated splenic lymphocytes. Mol. Immunol. 2018;95:20–29. doi: 10.1016/j.molimm.2018.01.009. [DOI] [PubMed] [Google Scholar]
- Fernandez C.P., Kim W.H., Diaz J.A.R., Jeong J., Afrin F., Kim S., Jang H.-K., Lee B.-H., Yim D., Lillehoj H.S., Min W. Upregulation of duck interleukin-17A during Riemerella Anatipestifer infection. Dev. Comp. Immunol. 2016;63:36–46. doi: 10.1016/j.dci.2016.05.009. [DOI] [PubMed] [Google Scholar]
- Gao J., Ye C., Zhu L., Tian Z., Yang Z. A homolog of glyceraldehyde-3-phosphate dehydrogenase from Riemerella Anatipestifer is an extracellular protein and exhibits biological activity. J. Zhejiang Univ. Sci. B. 2014;15:776–787. doi: 10.1631/jzus.B1400023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gao Q., Lu S., Wang M., Jia R., Chen S., Zhu D., Liu M., Zhao X., Yang Q., Wu Y., Zhang S., Huang J., Mao S., Ou X., Sun D., Tian B., Cheng A. Putative Riemerella Anatipestifer outer membrane protein H affects virulence. Front. Microbiol. 2021;12 doi: 10.3389/fmicb.2021.708225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gong Y., Yang Y., Chen Y., Sun B., Xue Y., Xu X., Wang X., Islam N., Du X., Hu Q. Characterization of the hemolytic activity of Riemerella Anatipestifer. Microbiology. 2020;166:436–439. doi: 10.1099/mic.0.000896. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guo Q., Li S., Lu X., Li B., Ma P. PhoR/PhoP two component regulatory system affects biocontrol capability of Bacillus subtilis NCD-2. Genet. Mol. Biol. 2010;33:333–340. doi: 10.1590/S1415-47572010005000032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guo Y., Hu D., Guo J., Li X., Guo J., Wang X., Xiao Y., Jin H., Liu M., Li Z., Bi D., Zhou Z. The role of the regulator Fur in gene regulation and virulence of Riemerella Anatipestifer assessed using an unmarked gene deletion system. Front. Cell. Infect. Microbiol. 2017;7:382. doi: 10.3389/fcimb.2017.00382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guo Y., Hu D., Guo J., Wang T., Xiao Y., Wang X., Li S., Liu M., Li Z., Bi D., Zhou Z. Riemerella Anatipestifer type IX secretion system is required for virulence and gelatinase secretion. Front. Microbiol. 2017;8:2553. doi: 10.3389/fmicb.2017.02553. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hendrickson J.M., Hilbert K.F. A new and serious septicaemic disease of young ducks with a description of the causative organism Pfeifferella Anatipestifer. Cornell Vet. 1932;22:239–252. [Google Scholar]
- Higgins D., Henry R.R., Zounev Z.V. Duck immune responses to Riemerella Anatipestifer vaccines. Dev. Comp. Immunol. 2000;24:153–167. doi: 10.1016/s0145-305x(99)00070-1. [DOI] [PubMed] [Google Scholar]
- Hu Q., Han X., Zhou X., Ding C., Zhu Y., Yu S. OmpA is a virulence factor of Riemerella Anatipestifer. Vet. Microbiol. 2011;150:278–283. doi: 10.1016/j.vetmic.2011.01.022. [DOI] [PubMed] [Google Scholar]
- Hu Q., Han X., Zhou X., Ding S., Ding C., Yu S. Characterization of biofilm formation by Riemerella Anatipestifer. Vet. Microbiol. 2010;144:429–436. doi: 10.1016/j.vetmic.2010.02.023. [DOI] [PubMed] [Google Scholar]
- Huang B., Kwang J., Loh H., Frey J., Tan H.-M., Chua K.-L. Development of an ELISA using a recombinant 41 kDa partial protein (P45N′) for the detection of Riemerella Anatipestifer infections in ducks. Vet. Microbiol. 2002;88:339–349. doi: 10.1016/s0378-1135(02)00123-2. [DOI] [PubMed] [Google Scholar]
- Huang Z., Fang J., Gu J., Yan Y., Zhou J. Development of a capture ELISA to determine kinetics of soluble CD25 following in vitro and in vivo stimulation of duck peripheral blood monocytes. Vet. Immunol. Immunopathol. 2011;140:102–109. doi: 10.1016/j.vetimm.2010.11.021. [DOI] [PubMed] [Google Scholar]
- Jia R., Cheng A., Wang M., Qi X., Zhu D., Ge H., Luo Q., Liu F., Guo Y., Chen X. Development and evaluation of an antigen-capture ELISA for detection of the UL24 antigen of the duck enteritis virus, based on a polyclonal antibody against the UL24 expression protein. J. Virol. Methods. 2009;161:38–43. doi: 10.1016/j.jviromet.2009.05.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kang M., Seo H.-S., Soh S.-H., Jang H.-K. Immunogenicity and safety of a live Riemerella Anatipestifer vaccine and the contribution of IgA to protective efficacy in Pekin Ducks. Vet. Microbiol. 2018;222:132–138. doi: 10.1016/j.vetmic.2018.07.010. [DOI] [PubMed] [Google Scholar]
- Liu J., Qiu H., Zhu Z., Zou T. Antibacterial, anti-inflammatory, and antioxidant effects of Yinzhihuang injection. Biomed. Mater. Eng. 2015;26:S2123–S2132. doi: 10.3233/BME-151518. [DOI] [PubMed] [Google Scholar]
- Liu M., Huang M., Shui Y., Biville F., Zhu D., Wang M., Jia R., Chen S., Sun K., Zhao X., Yang Q., Wu Y., Chen X., Cheng A. Roles of B739_1343 in iron acquisition and pathogenesis in Riemerella Anatipestifer CH-1 and evaluation of the RA-CH-1ΔB739_1343 mutant as an attenuated vaccine. PLoS One. 2018;13 doi: 10.1371/journal.pone.0197310. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu M., Wang M., Zhu D., Wang M., Jia R., Chen S., Sun K., Yang Q., Wu Y., Chen X., Biville F., Cheng A. Investigation of TbfA in Riemerella Anatipestifer using plasmid-based methods for gene over-expression and knockdown. Sci. Rep. 2016;6:37159. doi: 10.1038/srep37159. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu W., Hulett F.M. Bacillus Subtilis PhoP binds to the PhoB tandem promoter exclusively within the phosphate starvation-inducible promoter. J. Bacteriol. 1997;179:6302–6310. doi: 10.1128/jb.179.20.6302-6310.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lobbedey L., Schlatterer B. Development and application of an ELISA for the detection of duck antibodies against Riemerella Anatipestifer antigens in egg yolk of vaccines and in serum of their offspring. J. Vet. Med. Ser. B. 2003;50:81–85. doi: 10.1046/j.1439-0450.2003.00624.x. [DOI] [PubMed] [Google Scholar]
- Lu F., Miao S., Tu J., Ni X., Xing L., Yu H., Pan L., Hu Q. The role of TonB-dependent receptor TbdR1 in Riemerella Anatipestifer in iron acquisition and virulence. Vet. Microbiol. 2013;167:713–718. doi: 10.1016/j.vetmic.2013.08.020. [DOI] [PubMed] [Google Scholar]
- Luo H., Liu M., Wang L., Zhou W., Wang M., Cheng A., Jia R., Chen S., Sun K., Yang Q., Chen X., Zhu D. Identification of ribosomal RNA methyltransferase gene ErmF in Riemerella Anatipestifer. Avian Pathol. 2015;44:162–168. doi: 10.1080/03079457.2015.1019828. [DOI] [PubMed] [Google Scholar]
- Pathanasophon P., Sawada T., Tanticharoenyos T. New serotypes of Riemerella Anatipestifer isolated from ducks in Thailand. Avian Pathol. 1995;24:195–199. doi: 10.1080/03079459508419059. [DOI] [PubMed] [Google Scholar]
- Rubbenstroth D., Ryll M., Behr K.-P., Rautenschlein S. Pathogenesis of Riemerella Anatipestifer in turkeys after experimental mono-infection via respiratory routes or dual infection together with the avian metapneumovirus. Avian Pathol. 2009;38:497–507. doi: 10.1080/03079450903349220. [DOI] [PubMed] [Google Scholar]
- Sandhu T., Harry E.G. Serotypes of Pasteurella Anatipestifer isolated from commercial White Pekin ducks in the United States. Avian Dis. 1981;25:497–502. [PubMed] [Google Scholar]
- Sandhu T.S., Layton H.W. Laboratory and field trials with formalin-inactivated Escherichia Coli (O78)-Pasteurella Anatipestifer bacterin in White Pekin ducks. Avian Dis. 1985;29:128–135. [PubMed] [Google Scholar]
- Segers P., Mannheim W., Vancanneyt M., De Brandt K., Hinz K.H., Kersters K., Vandamme P. Riemerella Anatipestifer Gen. Nov., Comb. Nov., the causative agent of septicemia anserum exsudativa, and its phylogenetic affiliation within the Flavobacterium-Cytophaga RRNA homology group. Int. J. Syst. Bacteriol. 1993;43:768–776. doi: 10.1099/00207713-43-4-768. [DOI] [PubMed] [Google Scholar]
- Sieberi B.M., Omwenga G.I., Wambua R.K., Samoei J.C., Ngugi M.P. Screening of the dichloromethane: methanolic extract of Centella Asiatica for antibacterial activities against Salmonella Typhi, Escherichia Coli, Shigella Sonnei, Bacillus Subtilis, and Staphylococcus Aureus. Sci. World J. 2020;2020 doi: 10.1155/2020/6378712. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Singh P.R., Vijjamarri A.K., Sarkar D. Metabolic switching of Mycobacterium tuberculosis during hypoxia is controlled by the virulence regulator phoP. J. Bacteriol. 2020;202:e00705–e00719. doi: 10.1128/JB.00705-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tang T., Wu Y., Lin H., Li Y., Zuo H., Gao Q., Wang C., Pei X. The drug tolerant persisters of Riemerella Anatipestifer can be eradicated by a combination of two or three antibiotics. BMC Microbiol. 2018;18:137. doi: 10.1186/s12866-018-1303-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tomida J., Fujiwara N., Naka T., Morita Y., Sawabe E., Tojo N., Kikuchi K., Kawamura Y. Spodiobacter Cordis Gen. Nov. Sp. Nov., a member of the family Flavobacteriaceae isolated from patients with infective endocarditis. Microbiol. Immunol. 2019;63:111–118. doi: 10.1111/1348-0421.12673. [DOI] [PubMed] [Google Scholar]
- Wang X., Ding C., Wang S., Han X., Hou W., Yue J., Zou J., Yu S. The AS87_04050 gene is involved in bacterial lipopolysaccharide biosynthesis and pathogenicity of Riemerella Anatipestifer. PLoS One. 2014;9 doi: 10.1371/journal.pone.0109962. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang X., Liu B., Dou Y., Fan H., Wang S., Li T., Ding C., Yu S. The Riemerella Anatipestifer AS87_01735 gene encodes nicotinamidase pncA, an important virulence factor. Appl. Environ. Microbiol. 2016;82:5815–5823. doi: 10.1128/AEM.01829-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Y., Lu T., Yin X., Zhou Z., Li S., Liu M., Hu S., Bi D., Li Z. A novel RAYM_RS09735/RAYM_RS09740 Two-component signaling system regulates gene expression and virulence in Riemerella Anatipestifer. Front. Microbiol. 2017;8:688. doi: 10.3389/fmicb.2017.00688. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Y., Yin X., Zhou Z., Hu S., Li S., Liu M., Wang X., Xiao Y., Shi D., Bi D., Li Z. Cas9 regulated gene expression and pathogenicity in Riemerella Anatipestifer. Microb. Pathog. 2019;136 doi: 10.1016/j.micpath.2019.103706. [DOI] [PubMed] [Google Scholar]
- Wang Y., Zhang Y., Cui Y., Sun Z., Zhou Z., Hu S., Li S., Liu M., Meng X., Xiao Y., Shi D., Bi D., Li Z. Identification of an integrase that responsible for precise integration and excision of Riemerella Anatipestifer genomic island. Front. Microbiol. 2019;10:2099. doi: 10.3389/fmicb.2019.02099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu X., Xu Y., Miao S., Jiang P., Cui J., Gong Y., Tan P., Du X., Islam N., Hu Q. Evaluation of the protective immunity of Riemerella Anatipestifer OmpA. Appl. Microbiol. Biotechnol. 2020;104:1273–1281. doi: 10.1007/s00253-019-10294-3. [DOI] [PubMed] [Google Scholar]
- Yang D., Mai K., Zhou Q., Zhu Y., Xing J., Luo C., Liu S., Zhou Q., Huang W., Luo J., Liu J. The protective efficacy of specific egg yolk immunoglobulin Y(IgY) against Riemerella Anatipestifer infections. Vet. Microbiol. 2020;243 doi: 10.1016/j.vetmic.2020.108642. [DOI] [PubMed] [Google Scholar]
- Yang S., Dong W., Li G., Zhao Z., Song M., Huang Z., Fu J., Jia F., Lin S. A recombinant vaccine of Riemerella Anatipestifer OmpA fused with duck IgY Fc and Schisandra Chinensis polysaccharide adjuvant enhance protective immune response. Microb. Pathog. 2019;136 doi: 10.1016/j.micpath.2019.103707. [DOI] [PubMed] [Google Scholar]
- Zhao X., Liu Q., Zhang J., Luo Y., Luo Y., Liu Q., Li P., Kong Q. Identification of a gene in Riemerella Anatipestifer CH-1 (B739-2187) that contributes to resistance to polymyxin b and evaluation of its mutant as a live attenuated vaccine. Microb. Pathog. 2016;91:99–106. doi: 10.1016/j.micpath.2015.12.001. [DOI] [PubMed] [Google Scholar]




