Abstract
Understanding the response and tolerance mechanisms of nitrogen (N) stress is essential for the taproot plant of sugar beet. Hence, in this study, low (0.5 and 3 mmol/L; N0.5 and N3), moderate (5 mmol/L; N5; control) and high (10 and 12 mmol/L; N10 and N12) N were imposed to sugar beet to comparatively investigate the growth and physiological changes, and expression pattern of the gene involving ammonia transporting at different seedling stages. The results showed that, different from N5 which could induce maximum biomass of beet seedlings, low N was more likely to inhibit the growth of beet seedlings than high N treatments. Morphological differences and adverse factors increased significantly with extension of stress time, but sugar beet seedlings displayed a variety of physical responses to different N concentrations to adapt to N abnormal. At 14 d, the chlorophyll content, leaf and root surface area, total dry weight and nitrogen content of seedlings treated with N0.5 decreased 15.83%, 53.65%, 73.94%, 78.08% and 24.88% respectively, compared with N12; however, the root shoot ratio increased significantly as well as superoxide dismutase (SOD), peroxidase (POD), glutamine synthetase (GS) activity and malondialdehyde (MDA) and proline content, especially in root. The expression of BvAMT1.2 was also regulated in an N concentration-dependent manner, and was mainly involved in the tolerance of beet leaves to N stress, which significantly positively correlated to GS activity on the basis of its high affinity to N. It can be deduced that the stored nutrients under low N could only maintain relatively stable root growth, and faced difficulty in being transported to the shoots. Sugar beet was relatively resilient to N0.5 stress according to the mean affiliation function analysis. These results provide a theoretical basis for the extensive cultivation of sugar beet in N-stressed soil.
1. Introduction
In the last decade, the N fertilizer utilization rates of rice (Oryza sativa), wheat (Triticum aestivum), and maize (Zea mays) in China have been 39.0%, 34.8%, and 29.1%, respectively [1], which are far below international levels. China’s N fertilizer consumption is only 26% of the world’s consumption to produce 21% of the world’s grain [2]. Higher N application can lead to lower N use efficiency [3] and excessive N input can lead to increased nitrate leaching and environmental pollution [4]. On the contrary, studies have shown that insufficient nutrient availability can seriously affect plant growth [5]. Understanding the response of plants to low and high N stress is crucial for effective agricultural fertilization and selection of environmental resistant varieties.
N is a decisive factor for high yields in agriculture [6]. N is an important component of chlorophyll [7], and it affects photosynthesis and growth rate of plants through influencing N and chlorophyll content and total biomass [8]. Thus, reduction in the photosynthetic capacity of plants induced by N deficiency is one of the most important reasons for inhibited plant growth and development. Roots are not only an important organ for nutrient and water uptake, but are also the first organ to sense adversity signals from soil stressors [9]. Mild N deficiency promotes root elongation and facilitates deep root penetration, while appropriate N application increases root number, biomass, and density; however, excessive N application inhibits root growth [10]. Within a certain range, root biomass and oxidative activity in root increase with increasing N levels [11]. Under adverse stress, plants initiate adaptive changes in physiology and morphology, which affect internal metabolic processes, to maintain survival [12].
Ammonium is a compound of emerging interest because increased CO2 environments are expected to reduce the use of nitrate by C3 species [13]. There are two sources of ammonium in plants, one being nitrate and the other that is taken up directly from the soil via ammonia transporters (AMTs) and assimilated as amino acids via the GS/GOGAT cycle [12]. Glutamine synthetase (GS) is the key enzyme for ammonia assimilation [14] and is responsible for regulating plant nitrogen reuse, which is known to be closely related to seed germination, leaf senescence, and nitrogen accumulation processes [15]. Increased GS activity facilitates plant ammonia assimilation and N translocation, and as a result, NH4+ levels in plant remain consistently low; thus, preventing the toxicity caused by excessive ammonium [16, 17]. The pineapple GS1 gene was introduced into young aspen trees, resulting in improved N assimilation efficiency and growth promotion [18]. With respect to the studies on plants AMTs [19, 20], it was observed that, AMT1.2 had a different regulatory pattern that could respond to both NH4+ or NO3- [19], and mainly functioned in the endodermis, mediating ATP that facilitates the partitioning of NH4+ to shoots [21]. Besides, overexpression of BcAMT1.2 may affect the homeostasis between nitrogen and carbon, thus regulating plant growth [19].
When plants are subjected to stress, the balance between the production and elimination of intercellular reactive oxygen species (ROS) is disrupted, and evolved complex corresponding defense systems [22]. The primary antioxidant enzymes that scavenge ROS in plant cells are peroxidase (POD) and superoxide dismutase (SOD), and the activity of antioxidant enzyme is related to the ability of plants to adapt to adverse stress [23]. One of the products of membrane lipid peroxidation is malondialdehyde (MDA), whose content reflects the degree of membrane damage in plants [24]. Proline is an important osmoregulatory substance and effective hydroxyl radical scavenger in organisms, and can effectively protect plants from stressful conditions [25]. Numerous studies have revealed that N stress impacts plant normal physical metabolic activities, thus eventually decrease biomass accumulation [26]. Plants can ameliorate the damages of N stress by enhancing soluble protein content, and promoting N assimilation [27].
Sugar beet (Beta vulgaris L.) is a biennial heterogeneous pollinated crop, which is important in sugar production and non- food energy supply [28, 29]. Nitrogen is the most important nutrient limiting factor to sugar beet, which growth and taproot development directly related to N level in surrounding environment [30]. It was found that N deficiency led to low yields, but too much N reduced root quality in sugar beet [31, 32]. Presently, there are few records on the response and potential adaptation mechanisms of sugar beet seedlings under reduced and high N environment.
Therefore, in this study, we focused on the growth index, antioxidant enzymes, MDA, as well as proline and functional gene expression under short- and long-term N treatments to determine the intervals of N tolerance and N metabolite response in sugar beet seedlings. The objectives were: (1) to compare the processes of morphological, physical and AMT gene expression modifications of beet seedlings under different N treatment; (2) to determine the correlation between the above factors, and (3) to elucidate the adaptation mechanism of sugar beet to N deficiency or excessive N. The results are useful for the rational use of N fertilizer to achieve N reduction and increased efficiency.
2. Materials and methods
2.1 Experimental materials and culture conditions
Sugar beet ‘92021-1-1’ germplasm from the National Beet Medium-term Gene Bank of Heilongjiang University, which not only had a high germination rate, but also germinated rapidly, emerged clearly, and had robust and vigorous seedlings, was selected for the following nitrogen stress treatments.
Seeds of uniform size and free from pests and diseases were soaked overnight in 2‰ thiram solution and rinsed several times with distilled water. Subsequently, they were sowed in seedling trays containing vermiculite. After 8 d of incubation, the seedlings were transplanted into 0 mmol/L (N deficiency), 0.5 and 3 mmol/L (low N), 5 mmol/L (moderate N), and 10 and 12 mmol/L (high N) modified Hoagland nutrient solutions (S1 Table). Each treatment was conducted in triplicates. Samples were collected after 7, 14, and 20 d of N treatment at 9 A.M, and stored at -80°C after being snap-frozen in liquid N. The hydroponic conditions were 25°C during the day and 18°C at night with a 14 h light/10 h dark cycle and 200 μmol/(m2•s) light intensity.
2.2 Measurement of morphological index of sugar beet
The sugar beet seedlings under different N stresses were observed, and the plant height, root length, and fresh weight were measured carefully. Images of the root system and leaves were obtained using Epson Expression 1680 Scanner (Seiko Epson Corp., Tokyo, Japan) at a resolution of 800 dpi. Morphological index, such as total root surface area, number of root bifurcations, and leaf area were analyzed using the Win Rhizo analysis system. The above-ground and roots were oven-dried at 105°C for 30 min and further dried at 75°C to constant weight. The dry weights were measured and recorded.
2.3 Chlorophyll and total nitrogen content determination
Samples weighing 0.5 g were ground to powder with liquid nitrogen. Ten milliliters of 95% ethanol was added to extract chlorophyll by centrifugation at 4°C and 3000 rpm for 15 min. The amount of chlorophyll a (λ = 665) and chlorophyll b (λ = 649) in the samples was determined using a spectrophotometer (UV-1800 240 V, Shimadzu Corporation, Kyoto, Japan) and the amount of chlorophyll was calculated according to the following formula [33].
Where C is the pigment content (mg/L); V is the volume of the extract (ml); N is the dilution multiple; m is the sample mass (g); 1000 indicated 1L = 1000 ml.
The leaves and roots were rinsed with deionized water, oven-dried at 105°C for 30 min and further dried at 65°C until to constant weight. The dried samples (0.1 g) were crushed and ground, and were digested with concentrated sulfuric acid, catalyzing with potassium sulfate and copper sulfate, and. The N content was determined using a Hanon K1100 automatic kjeldahl nitrogen analyzer.
2.4 Antioxidant enzymes and glutamine synthetase activities assay
Superoxide dismutase (SOD) activity was determined using the nitrogen blue tetrazolium method (NBT): briefly, 0.5 g of sample was ground using pre-cooled phosphate buffer (pH = 7.8) and centrifuged at 4000 rpm for 10 min. The supernatant was taken as the SOD crude enzyme solution, using no light as a blank, and the absorbance value was measured at 560 nm on an enzyme calibrator [33].
For peroxidase (POD) activity assay, the reaction solution for determination was prepared by adding 28 μl of 0.2% guaiacol into 50 ml of 0.1 PBS (pH 7.0), heating (37°C) and stirring thoroughly; subsequently, the solution was cooled quickly, and 19 μl of 30% H2O2 was added. The dynamic absorbance at 470 nm was recorded using a UV spectrophotometer [33].
GS activity was measured according to instruction of Nanjing Institute of Built Bioengineering Kit (product no. A047-1-1). The supernatant was obtained after centrifugation at 8000 g for 10 min at 4°C and placed on ice for measurement. Enzyme activity was defined as one unit of enzyme activity per unit mass of sample per milliliter of reaction system, resulting in a change in absorbance value at 540 nm of 0.01 per minute.
2.5 Determination of lipid peroxidation
Lipid peroxidation was analyzed by measuring the content of malondialdehyde (MDA) in leaves and roots of sugar beet seedlings. MDA content was determined by the thiobarbituric acid (TCA) method. Sample of 0.5 g was ground with 5% TCA to obtain a homogenate, which was centrifuged at 3000 rpm for 10 min. Thereafter, 2 ml of supernatant was mixed with 2 ml of 0.67% TBA, and boiled for 30 min at 100°C. MDA was measured using a spectrophotometer (UV-1800 240 V, Shimadzu Corporation, Kyoto, Japan) to determine the absorbance values at wavelengths of 450 nm, 532 nm, 600 nm [33].
2.6 Measurement of protein and proline content
Protein content was determined using a biosharp BCA protein concentration kit (product no. BL521A) and the absorbance value was measured at 562 nm. The sample without BSA was used as a blank. The standard curve using A562 as the vertical coordinate and BSA content as the horizontal coordinate was used to calculate the protein concentration.
The proline content was determined by the acidic ninhydrin method. 0.5 g sample was ground with 3% sulfosalicylic acid, to which, added 2 ml of glacial acetic acid and ninhydrin. The mixture was boiled for 30 min at 100°C and extracted with 4 ml of toluene. The upper layer of red toluene solution was gently aspirated with a pipette, and the absorbance values were recorded using a colorimetry at 520 nm on a spectrophotometer (UV-1800 240 V, Shimadzu Corporation, Kyoto, Japan) using toluene as the blank [33].
2.7 Transcriptional expression of BvAMT1.2 gene
RNA was extracted from sugar beet leaves and roots using the Vazyme #R701-01 kit (Nanjing Novozymes Biotech Co), and the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Reverse Transcription Kit (Beijing All Style Gold Biotechnology Co) was used for the cDNA first strand synthesis. BvGAPDH (NC_024800) was selected as internal reference. To validate the expression of BvAMT1.2 gene, quantitative real-time PCR (qRT-PCR) was performed using SuperReal PreMix Plus kit (TianGen) with three replicates for each sample. The reaction system (20 μl) was: 2×SuperReal PreMix Plus 10 μl, Primer-F 0.6 μl, Primer-R 0.6 μl, and diluted cDNA 1μl. PCR procedure was: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 10 s, annealing at 60°C for 20 s, extension at 72°C for 32 s, 40 cycles; melting curve at 65–95°C. Primers used for qRT-PCR are shown in Table 1. Statistical analysis of gene expression was performed using the 2−ΔΔCT method.
Table 1. qRT-PCR primer sequences.
| Gene | Location | Primer sequence (5’-3’) | |
|---|---|---|---|
| BvAMT1.2 | NC_025815.2 | Forward | CGACTACATTGGCTGGAT |
| Reverse | CAAGGCTCAACTACTGAACAC | ||
| BvGAPDH | NC_024800 | Forward | GCTTTGAACGACCACTTCGC |
| Reverse | ACGCCGAGAGCAACTTGAAC |
2.8 Statistical analysis
The fuzzy mathematical membership function method was used to comprehensively evaluate the adaptation of sugar beet seedlings to N stress. There were "n" N stress levels (n = 1,…, i) and "m" indexes (m = 1,…, j) for each N stress level. The calculation formulas are shown as follows:
| (1) |
| (2) |
Where, Xjmin denotes the minimum value of the adaptation coefficient of N stress for each index of stress level j and Xjmax the maximum value of the adaptation coefficient of N stress for each index of stress level j. The membership function values of all traits under each stress was Ui, and a larger Ui value indicated a stronger ability to adapt to N stress.
Statistical analysis was carried out and means were compared using least significant difference (LSD) test. One-way ANOVA was used with SPSS 26. 0 software and the significance difference in means was analyzed based on the measured values for each trait. To evaluate the effects of the different horizontal nitrogen treatments (sampling time (T), nitrogen treatment (N), and T x N interaction), we analyzed the data using a factorial ANOVA. Data in the graphs are means ± standard deviations (X±S.D.) of three replicates. Mapping was performed using Originlab 8.0.
3. Result
3.1 Effect of different concentrations of nitrogen treatment on the morphology and chlorophyll content of sugar beet seedlings
Significant morphological changes were observed in sugar beet seedlings after 7, 14, and 20 d of N treatments. A standard Hoagland nutrient solution, which provided sufficient N of 5 mmol/L was used as the control. Without N (0 mmol/L), the seedlings could not live and the leaves were yellow and wilted even at 7 d; but the root length increased significantly (Fig 1). Under low N (N0.5 and 3 mmol/L), sugar beet was consistently weaker and smaller as the N concentration decreased, compared with the other treatments. However, high N (N10 and N12 mmol/L) did not influence the growth of seedlings too much, and even after 14 days of stress treatment, the growth potential of the above-ground under high N was better than that of the control. The morphological differences under both low and high N stress were more and more significant with the increasing stress time. Low N was more likely to cause a reduction in the growth of sugar beet seedlings than high N.
Fig 1. Morphological changes of sugar beet seedlings under different nitrogen treatments.
Among all the treatments, the highest chlorophyll content was observed when the seedlings were grown under N5 (Fig 2). High N could accumulate more chlorophyll than low N. The short-term stress of N stresses inhibited the production of chlorophyll more severely than that of long-term N stresses. The changes in chlorophyll content might be due to the N adaptation mechanism of sugar beet seedlings with extension of stress time.
Fig 2. Changes of chlorophyll content in sugar beet seedlings under low and high N stresses.
Note: control: N5; low N: N0.5 and N3; high N: N10 and N12; Different letters indicated significant difference among treatments (P<0.05) in the same day, F(T) indicated the F value for duration of treatment, F(N) indicated the F value of N concentration, and F(T×N) denoted F-value for the interaction of stress time and intensity. * and ** indicated significant (P < 0. 05) and (P < 0. 01), respectively. The same below.
3.2 Analysis of morphological traits of sugar beet under different nitrogen stresses
As shown in Table 2, there was no significant difference among N treatments on plant height at 7 d; however, N0.5 significantly promoted sugar beet root elongation (by 17.54%) (P < 0.05) compared with the control (N5), and significantly inhibited the growth of leaf surface area (to 68.44%, P < 0.05). At 14 and 20 d, seedlings under N5 exhibited relatively excellent growth performance among all the treatments, while both low and high N treatments significantly inhibited the plant height and root elongation. From these morphological changes, low N restricted the whole growth of sugar beet more than high N.
Table 2. Changes in the growth of sugar beet seedlings under different N treatments.
| Treatment | Nitrogen stress | Plant height (cm) | Total root length (cm) | Total leaf area (cm2/Plant) | Total root surface area (cm2/Plant) |
|---|---|---|---|---|---|
| 7 days | N0.5 | 3.633±0.551a | 15.633±0.814a | 2.750±0.101d | 22.330±1.979ab |
| N3 | 3.533±0.503a | 11.200±0.529b | 5.487±1.669c | 13.830±7.131bc | |
| N5 | 4.533±0.503a | 13.300±0.819b | 8.713±1.679ab | 27.853±10.228a | |
| N10 | 4.333±0.379a | 12.633±1.662b | 10.733±1.082a | 11.240±2.126c | |
| N12 | 4.100±0.608a | 12.033±1.518b | 8.207±0.491b | 25.657±1.831a | |
| 14 days | N0.5 | 4.400±0.529c | 14.500±2.587b | 17.103±1.488b | 39.790±14.137b |
| N3 | 4.567±0.896c | 13.367±2.194b | 22.790±2.967ab | 60.893±18.965b | |
| N5 | 9.900±1.277a | 34.667±7.286a | 39.003±5.079ab | 140.283±84.256a | |
| N10 | 8.500±0.520ab | 20.400±2.287b | 61.960±6.045a | 212.573±12.290a | |
| N12 | 8.133±0.907b | 15.700±4.194b | 36.900±22.733ab | 152.713±34.151a | |
| 20 days | N0.5 | 5.033±0.723c | 13.500±1.375c | 55.060±10.000b | 321.853±228.267a |
| N3 | 5.900±1.836c | 10.767±1.234c | 92.437±66.039b | 376.830±38.965a | |
| N5 | 16.767±1.601a | 33.133±3.296a | 244.797±82.461a | 506.347±140.680a | |
| N10 | 16.300±0.500a | 34.000±5.292a | 196.773±35.786ab | 625.690±197.370a | |
| N12 | 13.633±1.320b | 26.633±4.464b | 157.460±119.305ab | 459.047±88.552a | |
| Level of significance | |||||
| Treatment (T) | 235.523** | 41.797** | 43.974** | 91.385** | |
| Nitrogen (N) | 80.674** | 32.009** | 3.654* | 4.348** | |
| T×N | 23.383** | 12.570** | 2.994* | 1.121 | |
Note: control: N5; low N: N0.5 and N3; high N: N10 and N12; different letters in the same column denote significant differences between different N concentrations in the same day at p< 0.05. F(T) indicated the F value for duration of treatment, F(N) indicated the F value of N concentration, and F(T×N) denoted F-value for the interaction of stress time and intensity.
* and ** indicated significant differences at P < 0.05 and P < 0.01, respectively. The same below.
3.3 Influence of different concentrations of nitrogen treatment on the biomass of sugar beet
After 7- and 14-days N treatments, the accumulation of biomass of seedlings was directly proportional to the increase of nitrogen concentration from 0.5 to 10 mmol/L. However, seedlings under N5 showed the largest leaf and root dry weight after 20 days N treatments. In the whole process of high N treatments, N12 restricted the biomass accumulation of sugar beet more than N10. However, root to shoot ratio exhibited different trend, and low N treatment could promote the root elongation (Table 3).
Table 3. Effects of different nitrogen treatments on sugar beet biomass.
| Treatment | Nitrogen stress | Leaf dry weight (g/Plant) | Root dry weight (g/Plant) | Total dry weight (g/Plant) | Root to shoot ratio |
|---|---|---|---|---|---|
| 7 days | N0.5 | 0.004±0.001c | 0.002±0.001a | 0.006±0.001c | 0.639±0.127a |
| N3 | 0.005±0.002bc | 0.001±0.000b | 0.006±0.002c | 0.222±0.096bc | |
| N5 | 0.007±0.002ab | 0.001±0.001b | 0.008±0.002bc | 0.150±0.043c | |
| N10 | 0.009±0.001a | 0.003±0.001a | 0.011±0.001a | 0.317±0.101b | |
| N12 | 0.008±0.001a | 0.001±0.001b | 0.009±0.002ab | 0.126±0.016c | |
| 14 days | N0.5 | 0.012±0.003b | 0.004±0.001b | 0.016±0.003b | 0.378±0.038ab |
| N3 | 0.017±0.004b | 0.007±0.002b | 0.025±0.006b | 0.422±0.068a | |
| N5 | 0.060±0.044ab | 0.020±0.015ab | 0.081±0.059ab | 0.336±0.057ab | |
| N10 | 0.083±0.031a | 0.028±0.011a | 0.111±0.042a | 0.332±0.004ab | |
| N12 | 0.056±0.016ab | 0.018±0.008ab | 0.073±0.023ab | 0.308±0.056b | |
| 20 days | N0.5 | 0.039±0.014c | 0.014±0.003c | 0.053±0.017c | 0.389±0.077a |
| N3 | 0.060±0.023c | 0.023±0.011c | 0.083±0.034c | 0.369±0.070a | |
| N5 | 0.532±0.108a | 0.163±0.055a | 0.695±0.152a | 0.307±0.083a | |
| N10 | 0.362±0.070b | 0.100±0.019b | 0.462±0.089b | 0.275±0.003a | |
| N12 | 0.285±0.051b | 0.111±0.025ab | 0.396±0.075b | 0.387±0.019a | |
| Level of significance | |||||
| Treatment (T) | 174.079** | 91.502** | 160.179** | 3.960* | |
| Nitrogen (N) | 36.007** | 16.416** | 31.897** | 13.399** | |
| T×N | 24.974** | 11.754** | 22.188** | 9.070** | |
3.4 Low and high nitrogen stresses restricted nitrogen content in sugar beet seedlings
In general, the N content of the above-ground of sugar beet seedlings was greater than that in the roots. Compared to the control of N5, N content in leaves and roots of sugar beet decreased with the deepening of low N stress, and such phenomenon was more apparent after 20 days treatments. The reduction in total N content of sugar beet seedlings at N0.5 was 64.40%, 33.90%, and 42.63% at 7, 14 and 20 d, respectively. High N supply of N10 and N12 could not enhanced the nitrogen content of seedlings, compared with N5 (Table 4).
Table 4. Effects of nitrogen treatments on nitrogen content of sugar beet seedlings.
| Treatment | Nitrogen stress | Root N contents (%) | Leaf N contents (%) | Total N contents (%) |
|---|---|---|---|---|
| 7 days | N0.5 | 1.296±0.163c | 1.588±0.082b | 2.884±0.148c |
| N3 | 2.476±0.167b | 3.423±0.297a | 5.899±0.138b | |
| N5 | 3.863±0.288a | 4.239±0.194a | 8.102±0.459a | |
| N10 | 3.468±0.310a | 3.496±0.962a | 6.965±1.257ab | |
| N12 | 3.676±0.028a | 3.848±0.391a | 7.524±0.408a | |
| 14 days | N0.5 | 2.853±0.047d | 3.339±0.467c | 6.192±0.430d |
| N3 | 3.481±0.187c | 3.391±0.313c | 6.872±0.481c | |
| N5 | 4.628±0.061a | 4.741±0.342a | 9.369±0.381a | |
| N10 | 4.508±0.046a | 4.389±0.055ab | 8.897±0.015a | |
| N12 | 4.279±0.099b | 3.963±0.180b | 8.242±0.241b | |
| 20 days | N0.5 | 2.380±0.037e | 3.049±0.131c | 5.429±0.094d |
| N3 | 2.769±0.023d | 3.067±0.078c | 5.837±0.097c | |
| N5 | 4.798±0.021a | 4.664±0.067ab | 9.463±0.082a | |
| N10 | 4.502±0.013c | 4.770±0.041a | 9.272±0.046b | |
| N12 | 4.581±0.035b | 4.548±0.121b | 9.129±0.155b | |
| Level of significance | ||||
| Treatment (T) | 19.831** | 223.280** | 71.700** | |
| Nitrogen (N) | 46.819** | 445.539** | 154.936** | |
| T×N | 5.231** | 10.835** | 7.768** | |
3.5 Changes in protective enzyme activities and malondialdehyde of sugar beet seedlings treated with different concentrations of nitrogen
With increased stress time, both low and high N treatments significantly promoted SOD activity in roots and leaves (P < 0.05), compared with N5 (Fig 3A and 3B). All the N stresses could promote POD activity (P < 0.05), which in sugar beet roots was greater than that in leaves, and its activity did not increase or decrease significantly with the duration of each stress treatment (Fig 3C and 3D). However, compared with the control, as the N stress deepened, the production of MDA in leaves and roots increased significantly (P < 0.05), irrespective of low or high N stress (Fig 3E and 3F). On the whole, low N treatment could significantly induce SOD and POD activities and MDA content than high N, especially at N0.5.
Fig 3.
SOD activity (a and b), POD activity (c and d) and MDA content (e and f) in sugar beet seedlings under different nitrogen stresses.
3.6 Glutamine synthetase, proline and protein in sugar beet seedlings responded to different nitrogen stresses
With the aggravation of N stress, the protein content in roots increased first (7 and 14 d) and then decreased (20 d); however, the change in protein content in leaves was opposite. Low N treatments either promoted or inhibited protein accumulation in leaves and roots of sugar beet more significantly than high N treatment (Fig 4A and 4B). Compared with N5, both low and high N treatments could significantly promote GS activity (Fig 4C and 4D) in leaves and roots (P < 0.05), and there was the highest GS activity in seedlings after 14 days of 0.5 mmol/L N treatment. With the N stress time increasing, different from the decreased tendency of the proline content in sugar beet leaves, the proline content in roots increased first and then decreased (Fig 4E and 4F). Compared with N5, 0.5, 3, 10 and 12 mmol/L N promoted proline accumulation significantly (P < 0.05) in roots and leaves of sugar beet, especially N0.5.
Fig 4. GS activity, protein and proline content of sugar beet seedlings under different nitrogen treatments.
3.7 Low and high nitrogen stress regulated the transcriptional expression of BvAMT1.2 in sugar beet
The expressional pattern of BvAMT1.2 gene was investigated using qRT-PCR in sugar beet under different N treatments. Compared with the control, BvAMT1.2’s transcript was induced more significantly by 0.5 mmol/L low N treatment than high N, especially in leaves (Fig 5). There was a maximum of 3.24-or 9.23- fold of BvAMT1.2 up-regulated by N0.5 at 7 d in roots (Fig 5A) or 14 d in leaves (Fig 5B).
Fig 5.
The relative expression pattern of BvAMT1.2 in sugar beet roots (a) and leaves (b) under different nitrogen treatments by qRT-PCR.
3.8 Correlation analysis of growth and physiological index and BvATM1.2 expression in sugar beet under different nitrogen treatments
The correlations (r, from—0.995 to 0.999) between the different traits were estimated (Table 5). The total plant N content was significantly positively correlated with plant height (r = 0.980, p < 0.01), and leaf dry weight, root dry weight, and total dry weight (p < 0.05); however, it significantly negatively correlated (p < 0.05) with SOD, POD and MDA. The expression of BvAMT1.2 in leaves exhibited significant positive correlation (p < 0.05) with SOD, POD, GS, proline and MDA in leaves, and MDA and GS in roots; and there was a significant negative correlation (p < 0.05) between the expression of BvAMT1.2 in leaves and plant height, total dry weight and root N content.
Table 5. Correlation analysis between different indexes responsive to N stress in sugar beet.
| Correlation analysis | Chl | PH | RL | LA | TRSA | LDW | RDW | TDW | RSR | LNC | RNC | TNC | RSOD | LSOD | RPOD | LPOD | MR | ML | SPR | SPL | RGS | LGS | FPR | FPL | AMT1.2 R | AMT1.2 L |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Chl | 1.000 | |||||||||||||||||||||||||
| PH | 0.722 * | 1.000 | ||||||||||||||||||||||||
| RL | 0.951 | 0.792 | 1.000 | |||||||||||||||||||||||
| LA | -0.399 | 0.232 | -0.129 | 1.000 | ||||||||||||||||||||||
| TRSA | 0.285 | 0.837 | 0.415 | 0.618 | 1.000 | |||||||||||||||||||||
| LDW | 0.387 | 0.889* | 0.524 | 0.583 | 0.992** | 1.000 | ||||||||||||||||||||
| RDW | 0.387 | 0.874 | 0.521 | 0.573 | 0.991** | 0.998** | 1.000 | |||||||||||||||||||
| TDW | 0.399 | 0.888* | 0.535 | 0.572 | 0.990** | 0.999** | 0.999** | 1.000 | ||||||||||||||||||
| RSR | -0.293 | -0.819 | -0.415 | -0.505 | -0.774 | -0.791 | -0.747 | -0.771 | 1.000 | |||||||||||||||||
| LNC | 0.643 | 0.953* | 0.672 | 0.216 | 0.895* | 0.918* | 0.919* | 0.922* | -0.716 | 1.000 | ||||||||||||||||
| RNC | 0.781 | 0.972** | 0.875 | 0.228 | 0.803 | 0.869 | 0.865 | 0.874 | -0.699 | 0.923* | 1.000 | |||||||||||||||
| TNC | 0.719 | 0.980** | 0.778 | 0.225 | 0.870 | 0.914* | 0.912* | 0.918* | -0.722 | 0.985** | 0.976** | 1.000 | ||||||||||||||
| RSOD | -0.913* | -0.749 | -0.978** | 0.072 | -0.443 | -0.546 | -0.556 | -0.563 | 0.313 | -0.668 | -0.868 | -0.772 | 1.000 | |||||||||||||
| LSOD | -0.763 | -0.992** | -0.837 | -0.213 | -0.828 | -0.885* | -0.878 | -0.889* | 0.748 | -0.954* | -0.993** | -0.990** | 0.816 | 1.000 | ||||||||||||
| RPOD | -0.914* | -0.912* | -0.964** | 0.004 | -0.626 | -0.713 | -0.712 | -0.722 | 0.553 | -0.844 | -0.965** | -0.916* | 0.950* | 0.947* | 1.000 | |||||||||||
| LPOD | -0.877 | -0.941* | -0.903* | -0.008 | -0.709 | -0.778 | -0.781 | -0.788 | 0.579 | -0.921* | -0.972** | -0.962** | 0.895* | 0.970** | 0.983** | 1.000 | ||||||||||
| MR | -0.830 | -0.889* | -0.817 | 0.043 | -0.717 | -0.767 | -0.781 | -0.781 | 0.479 | -0.935* | -0.919* | -0.946* | 0.834 | 0.925* | 0.926* | 0.976** | 1.000 | |||||||||
| ML | -0.786 | -0.946 | -0.778 | -0.024 | -0.782 | -0.824 | -0.827 | -0.831 | 0.628 | -0.977** | -0.934* | -0.976** | 0.764 | 0.958* | 0.910* | 0.970** | 0.980** | 1.000 | ||||||||
| SPR | 0.977** | 0.632 | 0.952* | -0.409 | 0.151 | 0.266 | 0.261 | 0.278 | -0.238 | 0.500 | 0.708 | 0.604 | -0.904* | -0.674 | -0.864 | -0.789 | -0.706 | -0.656 | 1.000 | |||||||
| SPL | 0.923* | 0.456 | 0.843 | -0.549 | 0.055 | 0.152 | 0.175 | 0.175 | 0.084 | 0.428 | 0.578 | 0.505 | -0.861 | -0.535 | -0.762 | -0.717 | -0.713 | -0.601 | 0.913* | 1.000 | ||||||
| RGS | -0.707 | -0.804 | -0.617 | 0.150 | -0.681 | -0.699 | -0.713 | -0.710 | 0.442 | -0.915* | -0.778 | -0.870 | 0.619 | 0.819 | 0.770 | 0.871 | 0.944* | 0.949* | -0.540 | -0.588 | 1.000 | |||||
| LGS | -0.552 | -0.753 | -0.491 | -0.016 | -0.767 | -0.762 | -0.785 | -0.774 | 0.413 | -0.911* | -0.735 | -0.849 | 0.531 | 0.774 | 0.681 | 0.803 | 0.904* | 0.904* | -0.364 | -0.456 | 0.970** | 1.000 | ||||
| FPR | -0.820 | -0.562 | -0.783 | 0.273 | -0.362 | -0.429 | -0.467 | -0.456 | -0.013 | -0.627 | -0.696 | -0.671 | 0.866 | 0.655 | 0.796 | 0.804 | 0.854 | 0.735 | -0.745 | -0.904* | 0.744 | 0.706 | 1.000 | |||
| FPL | -0.768 | -0.989** | -0.827 | -0.184 | -0.829 | -0.883* | -0.878 | -0.887* | 0.729 | -0.967** | -0.988** | -0.995 | 0.809** | 0.998** | 0.944* | 0.976** | 0.943* | 0.973** | -0.669 | -0.547 | 0.851 | 0.808 | 0.674 | 1.000 | ||
| AMT1.2 R | -0.298 | -0.442 | -0.244 | -0.059 | -0.621 | -0.591 | -0.639 | -0.612 | 0.056 | -0.680 | -0.483 | -0.604 | 0.365 | 0.497 | 0.426 | 0.557 | 0.716 | 0.655 | -0.111 | -0.356 | 0.787 | 0.895* | 0.692 | 0.537 | 1.000 | |
| AMT1.2 L | -0.625 | -0.893* | -0.641 | -0.183 | -0.876 | -0.893* | -0.907* | -0.903* | 0.586 | -0.983** | -0.889* | -0.959 | 0.670** | 0.912* | 0.817 | 0.906* | 0.952* | 0.964** | -0.468 | -0.471 | 0.939* | 0.959* | 0.711 | 0.931* | 0.798 | 1.000 |
Note: * or ** indicated statistical difference significance at p < 0.05 or p < 0.01 among the treatments by Duncan’s multiple range tests.
Chl: Chlorophyll; PH: Plant Height; RL: Total root length; LA: Total leaf area; TRSA: Total root surface area; LDW: Leaf dry weight; RDW: Root dry weight; TDW: Total dry weight; RSR: Root to shoot ratio; LNC: Leaf N contents; RNC: Root N contents; TNC: Total N contents; RSOD: Root SOD activity; LSOD: Leaf SOD activity; RPOD: POD activity in root; LPOD: POD activity in leaf; MR: MDA in root; ML: MDA in leaf; SPR: Soluble protein in root; SPL: Soluble protein in leaf; RGS: Root GS activity; LGS: Leaf GS activity; FPR: Free proline in root; FPL: Free proline in leaf; AMT1.2 R: Root BvAMT1.2 expression; AMT1.2 L. Leaf BvAMT1.2 expression
3.9 Comprehensive evaluation of different nitrogen stresses on sugar beet seedlings
A single indicator was used to evaluate the adaptation mechanism of sugar beet seedlings to high and low N treatments. The growth of seedlings was affected by a combination of multiple factors; therefore, the fuzzy mathematical affiliation function method was used to comprehensively evaluate the 26 indexes, such as chlorophyll, plant height, leaf surface area, root length, root surface area, root to shoot ratio, SOD, POD, and GS activity, of sugar beet seedlings under low and high N treatments (as in Table 6). Based on the mean value of the affiliation function, the ability to adapt to N stress was in the order of: N0.5> N10> N12> N3.
Table 6. Comprehensive evaluation of different nitrogen stress ability in sugar beet seedling stage.
| Indexes | Nitrogen stress treatments | |||
|---|---|---|---|---|
| N0.5 | N3 | N10 | N12 | |
| Chlorophyll | 0.0000 | 0.1878 | 0.1917 | 0.2022 |
| Plant height | 0.0000 | 0.0304 | 0.7455 | 0.6787 |
| Total root length | 0.0532 | 0.0000 | 0.3302 | 0.1095 |
| Total leaf area | 0.4882 | 0.0000 | 1.0000 | 0.4413 |
| Total root surface area | 0.0000 | 0.1221 | 1.0000 | 0.6536 |
| Leaf dry weight | 0.0001 | 0.0706 | 1.0000 | 0.6198 |
| Root dry weight | 0.0004 | 0.1254 | 1.0000 | 0.5835 |
| Total dry weight | 0.0001 | 0.0948 | 1.0000 | 0.6000 |
| Root to shoot ratio | 0.6141 | 1.0000 | 0.2106 | 0.0001 |
| Leaf N contents | 0.0000 | 0.3538 | 0.9324 | 0.8034 |
| Root N contents | 0.0000 | 0.0371 | 0.7489 | 0.4451 |
| Total N contents | 0.0000 | 0.2140 | 0.8513 | 0.6451 |
| SOD activity in root | 0.9720 | 0.9255 | 0.5497 | 1.0000 |
| SOD activity in leaf | 1.0000 | 0.9186 | 0.2468 | 0.4326 |
| POD activity in root | 1.0000 | 0.9205 | 0.4806 | 0.7024 |
| POD activity in leaf | 1.0000 | 0.7750 | 0.3750 | 0.5500 |
| MDA content in root | 1.0000 | 0.5719 | 0.2864 | 0.4768 |
| MDA content in leaf | 1.0000 | 0.6368 | 0.2736 | 0.3343 |
| Soluble protein in root | 0.0001 | 0.0001 | 0.0001 | 0.0001 |
| Soluble protein in leaf | 0.0431 | 0.4292 | 0.1833 | 0.0000 |
| GS activity in root | 1.0000 | 0.3517 | 0.2528 | 0.2198 |
| GS activity in leaf | 1.0000 | 0.2222 | 0.0000 | 0.1389 |
| Free proline in root | 1.0000 | 0.4125 | 0.4042 | 0.8875 |
| Free proline in leaf | 1.0000 | 0.8544 | 0.2427 | 0.4078 |
| BvAMT1.2 expression in root | 1.0000 | 0.1070 | 0.0000 | 0.4340 |
| BvAMT1.2 expression in leaf | 1.0000 | 0.4966 | 0.0013 | 0.2507 |
| Membership function mean value | 0.5066 | 0.3792 | 0.4734 | 0.4468 |
| Ranking | 1 | 4 | 2 | 3 |
4. Discussion
4.1 Potential adaptive mechanisms of morphological and biomass response of sugar beet seedlings to different nitrogen stress levels
Nitrogen is a major nutrient that crops absorb from the soil, and it is closely related to crop growth and development. In this study, N supply could also adversely influence sugar beet seedlings, resulted in significant morphological differences under both low and high N stresses, similarly to the findings of Xin [34]. At low N (N0.5 and N3) treatments, beet seedlings exhibited N deficiency traits, including leaf yellowing, plant height and biomass inhibition; under N starvation (N0), the seedlings were almost devoid of normal nutrient supply and could not survive.
Root structure plays an essential function in plant resistance to abiotic stress by sensing outside atmosphere [35]. Previous studies have shown that low N promotes root elongation and facilitated deep root penetration; moderate N increases root number, biomass, and density; while high N inhibits root growth [10, 36, 37]. In this study, under short-term stress, low N inhibited the accumulation of above-ground biomass and root surface area of beet and promoted root length to some extent; while high N stress inhibited leaf production and root surface area, but the effects on biomass did not differ significantly between different N treatments. It seems that the growth of sugar beet under N stress was connected to the duration and concentration of N treatments. This result is similar to the results of Chen et al. [38], where with reduced N, the root system of black cottonwood adjusted in response to stress reaction, leading to enhanced transfer of substances from the fallen leaves to the roots. However, with extended periods of stress, the substances produced by the leaves was not sufficient for root development; therefore, decelerating the root development. As shown in Table 5, plant height and dry weight were significantly positively correlated with N content, and there was significant positive correlation between root surface area and leaf parameters (LDW and LNC). This further suggests that leaf growth depend on the root system for mineral elements, and the growth of the root system needs more nutrients from photosynthesis.
The significant increase in the root to shoot ratio under short-term low N treatment might be due to the change in dry matter accumulated by the sugar beet during growth, even though a certain ratio change existed between above-ground and underground parts at normal growth conditions. Sattelmacher [39] concluded that the growth of crop roots and the above-ground parts is influenced by the balance between carbohydrates and N. From the principle of proximate allocation, the growth of above-ground is limited by N and the root growth by carbon. Thus, N deficiency severely inhibited the accumulation of above-ground biomass, and a large amount of carbon was allocated to the root system to promote root growth and allow the accumulation of underground biomass to capture N. Excessive N application has been shown to delay buckwheat senescence so that carbohydrates and nitrogen could be accumulated in the nutrient organs, but was not a conducive "reservoir" transfer; thus reducing buckwheat yield [40]. Besides, the N content in sugar beet seedlings was highly dependent on the level of N supply, which is consistent with the results of Xin [41].
4.2 Regulatory changes in the physiological response and functional gene participation in the tolerance adaptation of sugar beet seedlings to different nitrogen stresses
Plants can adapt to N abnormal not only by efficient N uptaking and utilization, but also through the N allocation to maintain higher chlorophyll content and photosynthetic productivity. Our results showed that both low and high N inhibited chlorophyll synthesis in sugar beet seedlings, especially after 14 days N treatment. This was likely due to the unstable growth of sugar beet seedlings under external stress, disrupting the internal integrity and stability, which in turn influenced photosynthesis [42]. He et al. discovered that N restriction affects photosynthesis by reducing chlorophyll, leading to starch accumulation and causing damage to photosynthetic membranes [43].
In response to adverse stress, plants produce oxygen radicals that induce membrane lipid reactions and generate harmful substances, such as MDA [44], and correspondingly, plant cells evolve antioxidant systems that scavenge ROS to maintain homeostasis [45]. SOD and POD are extremely important enzymes in such antioxidant defense system [46, 47]. Lack or excess of N can promote the development of ROS and cause oxidative stress [48]. With the aggravation of N stress, excessive ROS resulted in cell membrane peroxidation by MDA accumulation, and inhibited of beets’ physiology; however, both low and high N treatments promoted POD and SOD activities, which suggested that these two enzymes participated in anti-oxidation of sugar beet to such stressful conditions. This study also showed that under short-term N stress, the SOD and POD activities in the roots were higher than those in the leaves, and the opposite under long-term stress treatments. These results are similar to the findings of studies on tea trees [47], in which stress effect of plants are transported from the root system to the above-ground. In general, sugar beets can actively create their defense mechanisms to scavenge ROS due to N stress.
It was also found that both low and high N stresses promoted the production of proline sugar beet, where low N promoted higher proline content to regulate the osmotic environment and reduce the damage caused by adversity stress [49]. Biomass accumulation is known to be associated with protein synthesis, and protein synthesis is one of the main targets for controlling growth in response to environmental changes [50]. In this study, we found that both low and high N treatments significantly promoted the production of beet root protein under 7 and 14 d N stress, which possibly induced excess production of stress responsive proteins, consequently increasing plant adaptation ability to stressful conditions [51].
GS could promote the release of ammonia cycle and enhanced plant tolerance to N deficiency under culture conditions [52]. In this study, either low or high N stress promoted GS activity of sugar beet, and GS activity was highly significantly positively correlated with BvAMT1.2 gene expression in both leaves and roots (P < 0.01). BvAMT1.2 was regulated in a N concentration-dependent manner. These results indicated that the BvAMT1.2 gene was more strongly involved in the regulation of N stress in sugar beet by playing a role in the extraction of photorespiratory ammonium—which escapes from the mitochondria—and the entry of xylem ammonium [53].
5. Conclusions
In all, sugar beet seedlings enable themselves to adapt better to low than high N supply through biological processes such as ROS reduction, protein synthesis, antioxidant enzyme activity regulation, BvAMT1.2 gene expression and assimilating and translocating ammonium, thus conferring the tolerance to maintain optimum growth and development of sugar beet. This study elucidated the responsive mechanism of N-mediated determinants of sugar beet seedling growth, and provided a new idea for improving N use efficiency in sugar beet (Fig 6).
Fig 6. Schematic model of stress growth of sugar beet seedlings under low and high nitrogen conditions.
Supporting information
(DOCX)
Abbreviations
- N
Nitrogen
- LN
Low Nitrogen
- T
Treatment
- GS
Glutamine synthetase
- ROS
Reactive oxygen species
- POD
peroxidase
- SOD
Superoxide dismutase
- MDA
malondialdehyde
- Pro
Proline
- TCA
Thiobarbituric acid
- PCR
Polymerase chain reaction
- qRT-PCR
Quantitative Real-time PCR
- AMTs
Ammonia transporter proteins
- r
Correlations
- Chl
Chlorophyll
- PH
Plant Height
- RL
Total root length
- LA
Total leaf area
- TRSA
Total root surface area
- LDW
Leaf dry weight
- RDW
Root dry weight
- TDW
Total dry weight
- RSR
Root to shoot ratio
- LNC
Leaf N contents
- RNC
Root N contents
- TNC
Total N contents
- RSOD
Root SOD activity
- LSOD
Leaf SOD activity
- RPOD
POD activity in root
- LPOD
POD activity in leaf
- MR
MDA in root
- ML
MDA in leaf
- SPR
Soluble protein in root
- SPL
Soluble protein in leaf
- RGS
Root GS activity
- LGS
Leaf GS activity
- FPR
Free proline in root
- FPL
Free proline in leaf
- AMT1.2 R
Root BvAMT1.2 expression
- AMT1.2 L
Leaf BvAMT1.2 expression
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
DL was financially supported by the Natural Science Foundation of Heilongjiang Province of China (LH2019C057), and Scientific Research Foundation of the Higher Education Institutions of Heilongjiang Province (KJCX201920). WX was financially supported by the National sugar industry technology system project (CARS-170102), the Sugar Beet Germplasm Resources Safe Preservation Program (19221878) and the Innovative Training Plan for Young Talents in Heilongjiang Ordinary Undergraduate Colleges and Universities (UNPYSCT-2020). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Yu F,Shi W. Nitrogen use efficiencies of major grain crops in China in recent 10 years. Acta Pedologica Sinica. 2015; 52(6):1311–1324. 10.11766/trxb201501270058. [DOI] [Google Scholar]
- 2.Zhang Y, Liu H, Lei Q, Zhai L, Liu S, Wang H, et al. International research on farmland nitrogen application based on global bibliometrical analysis. J Eco Environ. 2015; 24(08):1415–1424. 10.16258/j.cnki.1674-5906.2015.08.024. [DOI] [Google Scholar]
- 3.Ma H, Yang T, Niu X, Hou Z, Ma X. Sound water and nitrogen management decreases nitrogen losses from a drip-fertigated cotton field in Northwestern China. Sustainability. 2021; 13(2):1002. 10.3390/su13021002. [DOI] [Google Scholar]
- 4.Duan J, Shao Y, He L, Li X, Hou G, Li S, et al. Optimizing nitrogen management to achieve high yield, high nitrogen efficiency and low nitrogen emission in winter wheat. Sci Total Environ. 2019; 697:134088. doi: 10.1016/j.scitotenv.2019.134088 [DOI] [PubMed] [Google Scholar]
- 5.Gruber B, Giehl R, Friedel S, Wirén N. Plasticity of the arabidopsis root system under nutrient deficiencies. Plant Physiol. 2013; 163(1):161–179. doi: 10.1104/pp.113.218453 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Lai Z, Fan J, Yang R, Xu X, Liu L, Li S, et al. Interactive effects of plant density and nitrogen rate on grain yield, economic benefit, water productivity and nitrogen use efficiency of drip-fertigated maize in northwest China. Agr Water Manage. 2022; 263:107453. 10.1016/j.agwat.2021.107453. [DOI] [Google Scholar]
- 7.Bloom A. The increasing importance of distinguishing among plant nitrogen sources. Curr Opin Plant Biol. 2015; 25:10–16. doi: 10.1016/j.pbi.2015.03.002 [DOI] [PubMed] [Google Scholar]
- 8.Wen S, Liu B, Long S, Gao S, Liu Q, Liu T, et al. Low nitrogen level improves low-light tolerance in tall fescue by regulating carbon and nitrogen metabolism. Environ Exp Bot. 2022; 194:104749. 10.1016/j.envexpbot.2021.104749. [DOI] [Google Scholar]
- 9.Funing M, Dan X, Jianshu Z, Yong L, Chuanzao M. Molecular mechanisms of root development in rice. Rice. 2019; 12(1):1–10. doi: 10.1186/s12284-018-0262-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Herrera L R, Shane M, López‐Bucio J. Nutritional regulation of root development. Wires Dev Biol. 2015; 4(4):431–443. 10.1002/wdev.183. [DOI] [PubMed] [Google Scholar]
- 11.Ju C, Buresh R, Wang Z, Zhang H, Liu L, Yang J, et al. Root and shoot traits for rice varieties with higher grain yield and higher nitrogen use efficiency at lower nitrogen rates application. Field Crop Res. 2015; 175:47–55. 10.1016/j.fcr.2015.02.007. [DOI] [Google Scholar]
- 12.Ge X L, Zhang L, Du J J, Wen S S, Qu G Z, Hu J J. Transcriptome analysis of Populus euphratica under salt Treatment and PeERF1 gene enhances salt tolerance in transgenic Populus alba × Populus glandulosa. Int J Mol Sci. 2022; 23(7):3727. 10.3390/ijms23073727. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Rubioasensio J S,Bloom A J. Inorganic nitrogen form: a major player in wheat and arabidopsis responses to elevated CO2. J Exp Bot. 2017; 68(10):2611–2625. 10.1093/jxb/erw465. [DOI] [PubMed] [Google Scholar]
- 14.Yang X L, Nian J Q, Xie Q J, Feng J, Zhang F X, Jing H W, et al. Rice ferredoxin-dependent glutamate synthase regulates nitrogen–carbon metabolomes and is genetically differentiated between japonica and indica subspecies. Mol Plant. 2016; 9(11):1520–1534. doi: 10.1016/j.molp.2016.09.004 [DOI] [PubMed] [Google Scholar]
- 15.Tabuchi M, Abiko T, Yamaya T. Assimilation of ammonium ions and reutilization of nitrogen in rice (Oryza sativa L.). J Exp Bot. 2007; 58(9):2319–2327. doi: 10.1093/jxb/erm016 [DOI] [PubMed] [Google Scholar]
- 16.Bittsánszky A, Pilinszky K, Gyulai G, Komives T. Overcoming ammonium toxicity. Plant Sci. 2015; 231:184–190. doi: 10.1016/j.plantsci.2014.12.005 [DOI] [PubMed] [Google Scholar]
- 17.Bao A, Zhao Z, Ding G, Shi L, Xu F, Cai H, et al. Accumulated expression level of cytosolic glutamine synthetase 1 gene (OsGS1;1 or OsGS1;2) alter plant development and the carbon-nitrogen metabolic status in Rice. Plos One. 2014; 9(4):e95581. doi: 10.1371/journal.pone.0095581 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Man H M, Boriel R, Kirby E K G. Plant environmental adaptation || characterization of transgenic poplar with ectopic expression of pine cytosolic glutamine synthetase under conditions of varying nitrogen availability. New Phytol. 2005; 167(1):31–39. 10.2307/3694325. [DOI] [PubMed] [Google Scholar]
- 19.Zhu Y, Huang X, Hao Y, Su W, Liu H, Sun G, et al. Ammonium Transporter (BcAMT1.2) Mediates the Interaction of Ammonium and Nitrate in Brassica campestris. Front Plant Sci. 2020; 10:1776. doi: 10.3389/fpls.2019.01776 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.McDonald T R,Ward J M. Evolution of electrogenic ammonium transporters (AMTs). Front Plant Sci. 2016; 7(352). doi: 10.3389/fpls.2016.00352 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Duan F, Giehl RFH, Geldner N, Salt DE, von Wirén N. Root zone–specific localization of AMTs determines ammonium transport pathways and nitrogen allocation to shoots. PLoS Biol. 2018; 16(10): e2006024. doi: 10.1371/journal.pbio.2006024 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Singh A, Mehta S, Yadav S, Nagar G, Ghosh R, Roy A, et al. How to cope with the challenges of environmental stresses in the era of global climate change: an update on ROS stave off in plants. Int J Mol Sci. 2022; 23(4):1995. doi: 10.3390/ijms23041995 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Suzuki N,Katano K. Coordination between ROS regulatory systems and other pathways under heat stress and pathogen attack. Front Plant Sci. 2018; 9:490. doi: 10.3389/fpls.2018.00490 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Sun S, Yao X, Liu X, Qiao Z, Liu Y, Li X, et al. Brassinolide can improve drought tolerance of maize seedlings under drought stress: By inducing the photosynthetic performance, antioxidant capacity and ZmMYB gene expression of maize seedlings. J Soil Sci Plant Nut. 2022:1–13. 10.1007/s42729-022-00796-x. [DOI] [Google Scholar]
- 25.Alvarez M E, Savouré A, Szabados L. Proline metabolism as regulatory hub. Trends Plant Sci. 2022; 27(1):39–55. doi: 10.1016/j.tplants.2021.07.009 [DOI] [PubMed] [Google Scholar]
- 26.Shah J M, Asgher Z, Zeng J, Quan X, Ali E, Shamsi I H, et al. Growth and physiological characterization of low nitrogen responses in Tibetan wild barley (Hordeum spontaneum) and cultivated barley (Hordeum vulgare). J Plant Nutr. 2017; 40(6):861–868. 10.1080/01904167.2016.1262405. [DOI] [Google Scholar]
- 27.Zhao X, Wang W, Xie Z, Gao Y, Wang C, Rashid M M, et al. Comparative analysis of metabolite changes in two contrasting rice genotypes in response to low-nitrogen stress. Crop J. 2018; 6(5):464–474. 10.1016/j.cj.2018.05.006. [DOI] [Google Scholar]
- 28.Peleman J D,Voort J R V d. Breeding by design. Trends Plant Sci. 2003; 8(7):330–334. doi: 10.1016/S1360-1385(03)00134-1 [DOI] [PubMed] [Google Scholar]
- 29.Welson L, Jony E S, Miguel J M Y, José E G, Emanoel F d S, Araújo J. Beet cultivation with saline effluent from fish farming. Rev Bras Eng Agríc Ambient. 2016; 20(1):62–66. 10.1590/1807-1929/agriambi.v20n1p62-66. [DOI] [Google Scholar]
- 30.Varga I, Jović J, Rastija M, Markulj Kulundžić A, Zebec V, Lončarić Z, et al. Efficiency and Management of Nitrogen Fertilization in Sugar Beet as Spring Crop: A Review. Nitrogen. 2022; 3(2):170–185. 10.3390/nitrogen3020013. [DOI] [Google Scholar]
- 31.Hosseini L, Maleki A, Mozafari A, Mirzaeiheydari M, Sadeghi-Shoae M. Evaluation of Water and Nitrogen Use Efficiency, Digestibility and Some Quantitative and Qualitative Characteristics of Forage Beet Cultivars Under Different Irrigation Methods and Nitrogen Levels. Gesunde Pflanzen. 2022; 74(1):177–191. 10.1007/s10343-021-00601-2. [DOI] [Google Scholar]
- 32.Hergert G W. Sugar beet fertilization. Sugar Tech. 2010; 12(3):256–266. 10.1007/s12355-010-0037-1. [DOI] [Google Scholar]
- 33.Wang X K,Huang J L. Principle and technology of plant physiological and biochemical experiment. 2015: Higher Education Press. [Google Scholar]
- 34.Xin W, Zhang L N, Gao J P, Zhang W Z, Yi J, Zhen X X, et al. Adaptation mechanism of roots to low and high nitrogen revealed by proteomic analysis. Rice. 2021; 14(1):1–14. 10.1186/s12284-020-00443-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Karlova R, Boer D, Hayes S, Testerink C. Root plasticity under abiotic stress. Plant Physiol. 2021; 187(3):1057–1070. doi: 10.1093/plphys/kiab392 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Song X, Wan F, Chang X, Zhang J, Sun M, Liu Y. Effects of nutrient deficiency on root morphology and nutrient allocation in Pistacia chinensis Bunge seedlings. Forests. 2019; 10(11):1035. 10.3390/f10111035. [DOI] [Google Scholar]
- 37.Walch-Liu P, Ivanov I, Filleur S, Gan Y B, Tony R, Forde B. Nitrogen regulation of root branching. Ann Bot-London. 2006; 97(5):875–881. doi: 10.1093/aob/mcj601 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Chen C, Chu Y, Huang Q, Ding C, Zhang W, Li B, et al. Morphological and physiological plasticity response to low nitrogen stress in black cottonwood (Populus deltoides Marsh.). J Forestry Res. 2022; 33(1):51–62. 10.1007/s11676-021-01338-4. [DOI] [Google Scholar]
- 39.Sattelmacher B, Gerendas J, Thoms K, Brück H, Bagdady N H. Interaction between root growth and mineral nutrition. Environ Exp Bot. 1993; 33(1):63–73. 10.1016/0098-8472(93)90056-L. [DOI] [Google Scholar]
- 40.He P Y, Zhang Y, Zhou L, Huang K F, Huang X Y. Effects of drought stress and nitrogen fertilizer regulation on morphology, physiological characteristics and yield of Fagopyrum tataricum. China J Appl Envir Biol. 2021:1–11. 10.19675/j.cnki.1006-687x.2020.10052. [DOI] [Google Scholar]
- 41.Xin W, Zhang L N, Zhang W Z, Gao J P, Yi J, Zhen X X, et al. An integrated analysis of the rice transcriptome and metabolome reveals root growth regulation mechanisms in response to nitrogen availability. Int J Mol Sci. 2019; 20(23):5893. doi: 10.3390/ijms20235893 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Huang Z A, Jiang D A, Yang Y, Sun J W, Jin S H. Effects of nitrogen deficiency on gas exchange, chlorophyll fluorescence, and antioxidant enzymes in leaves of rice plants. Photosynthetica. 2004; 42(3):357–364. 10.1023/B:PHOT.0000046153.08935.4c. [DOI] [Google Scholar]
- 43.He L, Teng L, Tang X, Long W, Wang Z, Wu Y, et al. Agro-morphological and metabolomics analysis of low nitrogen stress response in Axonopus compressus. Aob Plants. 2021; 13(4):plab022. doi: 10.1093/aobpla/plab022 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Zheng H, Zhang X, Ma W, Song J, Rahman S U, Wang J, et al. Morphological and physiological responses to cyclic drought in two contrasting genotypes of Catalpa bungei. Environ Exp Bot. 2017; 138:77–87. 10.1016/j.envexpbot.2017.02.016. [DOI] [Google Scholar]
- 45.Li R, Jia Z, Trush M A. Defining ROS in biology and medicine. React Oxyg Species (Apex). 2016; 1(1):9. doi: 10.20455/ros.2016.803 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Lu Z J, Zhang Y Q, Zhang C. The seedling growth and root physiological traits of Fagopyrum tataricum cultivars under drought stress. Acta Botanica Boreali-Occidentalia Sinica. 2018; 38(1):112–120. 10.7606/j.issn.1000-4025.2018.01.0112. [DOI] [Google Scholar]
- 47.Lin Z H, Zhong Q S, You X M, Chen Z I, Chen C S, Shan R Y, et al. Antioxidant enzyme activity and growth of tea plants (Camellia sinensis L.) as affected by low-nitrogen stress. Acta Tea Sinica. 2019; 60(2):57–63. [Google Scholar]
- 48.Yañez-Mansilla E, Cartes P, Reyes-Díaz M, Ribera-Fonseca A, Rengel Z, Alberdi M. Leaf nitrogen thresholds ensuring high antioxidant features of Vaccinium corymbosum cultivars. J Soil Sci Plant Nut. 2015; 15(3):574–586. 10.4067/S0718-95162015005000025. [DOI] [Google Scholar]
- 49.Wang J, Liang X H, Wang Z X, Ni J Y, Yang S Q, Zheng Y, et al. Response of different genotype tobacco antireversal physiological indicators to low nitrogen stress. Agr sci Jiangsu. 2020; 48(21):97–103. [Google Scholar]
- 50.Wang Z Q, Xu X Y, Gong Q Q, Xie C, Fan W, Yang J L, et al. Root proteome of rice studied by iTRAQ provides integrated insight into aluminum stress tolerance mechanisms in plants. J Proteomics. 2014; 98:189–205. doi: 10.1016/j.jprot.2013.12.023 [DOI] [PubMed] [Google Scholar]
- 51.Erice G, Louahlia S, Irigoyen J J, Sanchez-Diaz M, Avice J C. Biomass partitioning, morphology and water status of four alfalfa genotypes submitted to progressive drought and subsequent recovery. J Plant Physiol. 2010; 167(2):114–120. doi: 10.1016/j.jplph.2009.07.016 [DOI] [PubMed] [Google Scholar]
- 52.Hirel B, Bertin P, Quilleré I, Bourdoncle W, Attagnant C, Dellay C, et al. Towards a better understanding of the genetic and physiological basis for nitrogen use efficiency in maize. Plant Physiol. 2001; 125(3):1258–1270. doi: 10.1104/pp.125.3.1258 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Wirén N V, Lauter F R, Ninnemann O, Gillissen B, Walch-Liu P, Engels C, et al. Differential regulation of three functional ammonium transporter genes by nitrogen in root hairs and by light in leaves of tomato. Plant J. 2000; 21:167–175. doi: 10.1046/j.1365-313x.2000.00665.x [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(DOCX)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.






