Skip to main content
NCBI home page
Elsevier - PMC COVID-19 Collection logoLink to Elsevier - PMC COVID-19 Collection
. 2022 Dec 2;222:114965. doi: 10.1016/j.bios.2022.114965

Affordable on-site COVID-19 test using non-powered preconcentrator

Jinhwan Kim a,1, Cheonjung Kim a,b,1, Jeong Soo Park a, Na Eun Lee a,c, Seungmin Lee a,d, Sung-Yeon Cho e,f, Chulmin Park e, Dae Sung Yoon d,∗∗, Yong Kyoung Yoo b,∗∗∗, Jeong Hoon Lee a,∗
PMCID: PMC9715458  PMID: 36493723

Abstract

A simple, affordable point of care test (POCT) is necessary for on-site detection of coronavirus disease 2019 (COVID-19). The lateral flow assay (LFA) has great potential for use in POCT mainly because of factors such as low time consumption, low cost, and ease of use. However, it lacks sensitivity and limits of detection (LOD), which are essential for early diagnostics. In this study, we proposed a non-powered preconcentrator (NPP) based on nanoelectrokinetics for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) Antigen (Ag) lateral flow assay. The non-powered preconcentrator is composed of glass fiber-based composite paper and ion permselective material, and it can be simply operated by force balancing gravitational, capillary, and depletion-induced forces. The proposed approach helps enrich the SARS-CoV-2 viral nucleocapsid (N) proteins based on a 10-min operation, and it improved the LOD by up to 10-fold. The corresponding virus enrichment, which was evaluated using the reverse-transcriptase polymerase chain reaction (RT-PCR), revealed an improvement in ΔCt values > 3. We successfully demonstrated the enhancement of the NPP-assisted LFA, we extended to applying it to clinical samples. Further, we demonstrated an affordable, easy-to-implement form of LFA by simply designing NPP directly on the LFA buffer tube.

Keywords: COVID-19, LFA, Preconcentrator, SARS-CoV-2, Sample treatment, Enrichment

1. Introduction

The reverse-transcriptase polymerase chain reaction (RT-PCR) is the most widely adopted approach for the rapid and accurate detection of the coronavirus disease 2019 (COVID-19) mainly because of factors such as high accuracy and sensitivity (Carter et al., 2020; Udugama et al., 2020; van Kasteren et al., 2020; Wolfel et al., 2020). However, a few drawbacks associated with RT-PCR include the high cost, long operation time, and complexity (Lai et al., 2021; Pokharel et al., 2022; Shani-Narkiss et al., 2020; Teymouri et al., 2021). The lateral flow assay (LFA) for the point-of-care test (POCT) could be a rapid, simple, and low-cost approach for detecting SARS-CoV-2; self-testing could alleviate the pressure on central laboratories for COVID-19. The LFA platform meets the WHO (World Health Organization) “ASSURED” criteria (sensitive, specific, user-friendly, rapid and robust, equipment-free, and deliverable to end-users) (Chaouch, 2021; Jiang et al., 2021; Otoo and Schlappi, 2022), and it could potentially satisfy the aforementioned criteria for the point-of-care test (POCT) and applicable various applications (Gong Y et al., 2017; Kim et al., 2017; Kim et al., 2022; Kumar et al., 2018; Li et al., 2020a, Li et al., 2020b).

Two recently published papers demonstrated new diagnostic strategies for handling pandemics, and they showed that the most accurate and ideal COVID-19 detection could be achieved using frequent testing based on low-cost, simple, and rapid approaches mainly because of the ability of SARS-CoV-2 to spread at an exponential rate (Crozier et al., 2021; Mina et al., 2020). A one-time monitored highly sensitive RT-PCR test can potentially detect viral shedding even for longer infection periods up to 17 days, i.e., the convalescence stage with less transmission. Therefore, rapid testing for COVID-19 with high sensitivity will help minimize the virus transmission significantly, particularly in the early detection stage.

However, the low sensitivity of LFA precise diagnostics limits its practical applications. In the case of COVID-19, detecting the SARS-CoV-2 antigen (Ag) in low virus titers (Ct value > 30) using the LFA is difficult, which limits the practical application in cases that involve lower virus titers targeting the early stage of COVID-19.(Escrivá et al., 2021; Gremmels et al., 2021). To overcome the drawback of LFA, several approaches for acquiring enhanced sensitivity and limits of detection (LOD) of LFA have been suggested with signal amplification (Cheng et al., 2017; Wang et al. 2017, Wang et al., 2021a, Wang et al., 2021b), flow control (Alam et al., 2021; Rivas et al., 2014; Sena-Torralba et al., 2020), optimization of LFA (Dighe et al., 2022; Garg et al., 2021; Grant et al., 2020; Yu et al., 2020; Zhang et al., 2021a, Zhang et al., 2021b), and sample enrichment (Kang et al., 2021; Wang et al., 2021a, Wang et al., 2021b; Zhou et al., 2021).

Among these approaches, the sample enrichment technique has attracted considerable research attention for enhancing sensitivity and LOD (Deng et al., 2021; Huang et al., 2019; Zhang et al., 2021a, Zhang et al., 2021b). The nanoelectrokinetic (NEK)-based method is a promising sample enrichment technique for the preconcentration of charged biomolecules because of its high preconcentration factor (PF), minimal component requirements, and easy implementation in various materials (Lee et al., 2021). As an example of NEK-based sample enrichments, we propose NEK preconcentration in various forms on a paper, such as 2D lateral flow form (Han et al. 2016, 2018; Kim et al., 2017) and 3D origami form(Han et al., 2019; Kim et al., 2019). As an alternate device structure for NEK-based enrichments, we presented a 3D roll-like device structure, i.e., microfluidic paper-based large-volume preconcentrator (μ-LVP), to enhance the micro ribonucleic acid (miRNA) (Lee et al., 2021) and for COVID-19 antibody test (Kim et al., 2022). Although μ-LVP showed considerable improvements for sample preparations, it requires an external power source or battery to operate the preconcentration step. Moreover, in the practical application of SARS-CoV-2 Ag, we observed severe false positive signals, which, in turn, resulted in a decrease in the selectivity during nanoelectrokinetic operation with an electric field. The main reason could be the electric-field induced pH fluctuation during nanoelectrokinetic operation, denaturing antigen–antibody interaction, or causing protein denaturation. We suspected that a second possible reason could be the electric field given that the SARS-CoV-2 Ag is reportedly vulnerable to electric fields and can be easily denatured by an electric field. (Arbeitman et al., 2021). If we could realize the non-powered preconcentrator on paper materials, the preconcentrator could provide wide applications in paper-based microfluidics and detection systems (Carrell et al., 2019; Hu et al., 2019; Li et al., 2020a, Li et al., 2020b; Nishat et al., 2021; Niu et al., 2021; Ruiz et al., 2022; Tian et al., 2018).

In this study, we proposed a non-powered preconcentrator (NPP) that can be simply operated by force balancing gravitational, capillary, and depletion-induced forces, and does not require an external power source or additional equipment. The NPP preconcentrator was combined with an LFA platform to overcome the poor sensitivity and LOD of the LFA (See Fig. 1 ). With the simplicity, low cost, portability, and versatility of the NPP sample enrichment technique, we acquired a 10-fold LOD enhancement using an NPP-assisted commercial SARS-CoV-2 Ag test compared to the commercial LFA (control). In addition to this, the corresponding virus enrichment of NPP was evaluated as ΔCt values > 3 using RT-PCR, which corresponds to a 10-folding enhancement in LOD. Finally, we designed NPP using commercially available sample tubes and integrated it with commercial LFA.

Fig. 1.

Fig. 1

Open in a new tab

Preconcentration and assay procedure. (a) Human nasal sample assay of COVID-19 with the preconcentration. (b) Preconcentration procedure without external power source.

2. Materials & methods

2.1. NPP devices fabrication

To fabricate the NPP, we used glass fiber-based composite paper as a paper-based microfluidic material (Whatman paper, fusion 5TM, GE Healthcare Life Sciences, USA). We used 5% Nafion resin (Sigma-Aldrich, USA) to ensure permselectivity. The fabrication step of the NPP devices is shown in Fig. S1. The Nafion strips were precisely printed on pre-defined Fusion 5 paper (3 × 5 cm) using a custom-made dispenser (BID-02AV, BTM Co., South Korea) that was equipped with a syringe pump (NE-1000 Single Syringe Pump, USA, flow rate setting: 0.6 mL/min). The Nafion resins were then dried on a hot plate at 70 °C for 15 min. We optimized the patterning of Nafion using the optimal infiltration processing, which involved a four-time coating and drying process (Fig. S2). The Nafion coated Fusion 5 paper was then rolled into discs; the rolled discs were sealed with transparent tape (3M Scotch, USA).

The assay protocol of NPP-assisted LFA assay is shown in Fig. 1. In the NPP operation, we did not use any external power sources, unlike other NEK-based preconcentrator that operated with a power source. We only injected samples onto the top of NPP and then waited 10 min for the sample enrichment. The main design parameter maintains the force balances between gravimetric, capillary, and depletion-induced forces. We will discuss the detailed analysis with simulation and experimental results in a separate paper. We achieved the sample enrichment by maintaining the force balance, cutting the enriched plug, and extracting the enriched samples using a commercial extraction buffer. Following the manufacturer's guideline, we monitored the color intensity of the test line after 15 min.

2.2. Fluorescence and LFA colorimetric image analysis

We used Alexa Fluor™ 594 conjugated albumin from bovine serum (BSA, Thermo Fisher Scientific, USA), 1X phosphate buffered saline buffer solution (PBS, Corning, USA) to visualize and assess the overall enrichment. We acquired fluorescence images from a microscope (IX-71, Olympus, Japan) with a charged-coupled device camera (Hamamatsu Co., Japan), and we analyzed these images using ImageJ software (Wayne Rasband, National Institute of Health, Bethesda, USA). In addition to this, we analyzed the impact of the NPP sample enrichment on the performance of the device. For control experiments, we tested the commercial SARS-CoV-2 Ag kit. The color intensities of the test and control lines were analyzed using a custom-made National Instrument (NI) controlled optical system that was operated on the LabVIEW™ software (National Instrument Co., USA) (Fig. S3).

We first measured color signals to set LOD values using the NI-controlled optical system. Then, five individually-trained engineers (Calth Inc. http://www.thecalth.com) observed the colorimetric signal using the standard color chart under the manufacturer's guidelines with 19/20 criteria, which represents the LOD is determined as the lowest concentration where ≥95% (19/20) are positive (https://www.fda.gov/media/137302/download). Finally, we determined the LOD color intensity values in the reader/optical system using labeled information. The LOD line was indicated as an invisible line in Fig. 4b–c.

Fig. 4.

Fig. 4

Open in a new tab

Detection sensitivity of COVID-19 antigen test. (a) Preconcentration and the assay procedure of nucleocapsid protein recombinant (SARS-CoV-2) antigen. (b) Color intensities of the preconcentration with different SARS-CoV-2 Ag concentrations. (c) Selectivity test of COVID-19 assay with the preconcentration. (d–e) Test and the control line images of (d) commercial COVID-19 LFA and (e) NPP-assisted LFA.

2.3. Preparation of SARS-CoV-2 Ag samples

We used commercial SARS-CoV-2 Ag rapid kits (Calth Inc., Republic of Korea) to test the impact of the NPP on the overall performance. We prepared a COVID-19 nucleocapsid protein recombinant antigen (45 kDa, FPZ0516, Fapon Biotech Inc., China, see Table S1), which is regarded as the best COVID-19 Ag's test target protein, using 1 × PBS buffers (LB004, DUKSAN, Republic of Korea) to examine the sensing performance (i.e., LOD and sensitivity curve). We also used Influenza A and B virus samples (Zeptometrix, USA) and the human nasal sample (Trina Bioreactives AG, Swiss) for the cross-reactivity tests. In addition to this, casein (Sigma-Aldrich, USA) of 0.1% to block non-specific binding and 0.1X PBS buffer solution was mixed to SARS-CoV-2 Ag preconcentration and assay.

2.4. RT-PCR for clinical sample assay

For the molecular analysis, we extracted the RNA from the collection disc of NPP and controls using a 30 μL extraction buffer (PCR Direct extracting transport medium, ARCIS, UK). The extracted RNA samples were analyzed using RT-PCR. The RNA was transformed as complementary deoxyribonucleic acid (cDNA) and amplified as DNA using AccuPower® RT-PCR PreMix (BIONEER, South Korea), according to a previous report (the forward primer sequence: TTCGGAAGAGACAGGTACGTTA, the reverse primer sequence: AGCAGTACGCACACAATCG) (Park et al., 2020). The reactions were performed in a thermal cycler (Gentier Mini, Tianlong, China) for 15 min at 50 °C, followed by 94 °C for 3 min, 40 cycles of 94 °C for 30 s, 62 °C for 40 s, 72 °C for 1 min, and a final extension at 72 °C for 10 min.

We prepared the real COVID-19 samples with patient samples from the college of medicine, the Catholic University of Korea (Seoul, Republic of Korea), and the Trina Bioreactives AG (Nänikon, Switzerland). All the samples from Catholic University were collected under the Institutional Review Board of Seoul St. Mary's hospital approved the research 6 protocol with a waiver of informed consent (KC21TIDI0134K). Table S3 shows the detailed sample information.

2.5. Prototype design

For designing the prototype for POCT sample enrichment, we designed the sample enrichment part, which can be easily connected onto the extraction buffer tube, and they are generally used in commercial LFA. We designed the prototype using two components; one for the absorbent part, and the other for the collection part (enrichment part), using Rhinoceros 3D software. The design will be discussed in detail in the results sections (Fig. 6).

Fig. 6.

Fig. 6

Open in a new tab

Preconcentration kit test. (a) Preconcentration kit. Absorbent part assembled with the NPP and a plastic case. Collection disc is located in the center of collection part. Releasing buffer (sky blue) and the extraction buffet reservoir (blue) in releasing part. (b) Buffer tube in a commercialized LFA. (c) Preconcentration (d) the extraction and the assay process. (e) Comparison of 0.05 and 0.1 ng/mL SARS-CoV-2 Ag test with and without the preconcentration.

3. Results & discussion

3.1. Sample enrichment using a non-powered preconcentrator (NPP)

The two important controllable parameters required to balance the gravimetric, capillary, and depletion-induced forces are the depletion-induced and capillary-driven forces. First, we checked the extracting performance of several paper materials because the extraction after enrichment has a significant impact on the performance enhancement. We tested three paper materials, i.e., Whatman grade 1 ™, Whatman grade 6 ™, and Whatman fusion 5 ™. Then we observed that the extraction efficiencies were 95.7, 37, and 17.2% for Whatman Fusion 5, Grade 6, and Grade 1 paper, showing that the Whatman Fusion 5 ™ paper is the best candidate for NPP operations with low sample absorption and excellent sample delivery (Gan et al., 2014; Kim et al., 2022). We confirmed the minimized non-specific binding using Whatman fusion 5 ™.

Second, we fabricated an NPP device using a Whatman Fusion 5™ paper and controlled the depletion-induced force by controlling the portion of Nafion on the cross-sectional area (Fig. S1). We coated Nafion strips a constant width of 1 mm, and we then controlled the thickness using the coating number. The cross-sectional view showed the unrolled NPP with the layered Nafion/Fusion 5™ paper (Fig. S2). The increased coating number indicates the increase in Nafion portion through the cross-sectional area since we rolled Whatman Fusion 5™ paper after Nafion coating. Therefore, by simply increasing the Nafion coating number, we could increase the depletion-induced forces, and this helped prevent the charged particle from freely passing out while decreasing the capillary forces acting on the water transported through the cross-sectional area by capillary force. As shown in Fig. S2, we optimized the optimal coating number as four. The Whatman Fusion 5™ paper has a higher wicking speed (0.105 cm/s) than Grade 1(0.007 cm/s) by 15-fold. The force balancing with a higher wicking speed accelerated the enrichment, and thus, the NPP process could be completed within 10 min.

In Fig. 2 , we show the enrichment process of the NPP and rolled cylinder structure (RCS). As a control experiment, we prepared the RCS without Nafion strip lines, and we therefore performed RCS for the control experiment (Fig. 2a). We prepared 400 μL Alexa Fluor 594TM conjugated bovine serum albumin (594-BSA) of 0.1 mg/mL using a 0.1X PBS buffer solution to study visualize the enrichment process. After the injection of the sample onto the top of the RCS (Fig. 2a) and NPP (Fig. 2b), we monitored the enrichment of BSA using fluorescence microscopy.

Fig. 2.

Fig. 2

Open in a new tab

BSA sample preconcentration. Image of preconcentration (a) without and (b) with Nafion pattern. Fluorescence images of the BSA for observation of accumulation (a) without and (b) with Nafion pattern. (c) Fluorescence intensity graph about preconcentrated BSA sample in the collection disc. (d) Distribution graph according to distance with BSA preconcentration on RSC and NPP surface.

The 594-BSA revealed clear enhanced signals on the upper side of NPP (Fig. 2b) whereas RCS showed no significant fluorescent signals after 10 min of operation (Fig. 2a). We observed slight fluorescence signals across the NPP due to the absorption of fluorescence. With NPP operating time (10 min), we acquired the preconcentration factor over 10-fold (Fig. 2c). Each sample was tested five times. We observed that the accumulation of BSA is only located on the top collection disc part by NPP, indicating that the force balancing the samples contributes to the enrichment without significant losses, even without external electrical and mechanical components (Fig. 2d).

3.2. NPP optimization

We optimized the design parameters that would help achieve the best performance, i.e., a collection disc, layered Nafion strip, and absorbent region (Fig. 3 ). First, we tested the impact of the length of the collection disc on the preconcentration factor. By fixing the total length of NPP as 3 cm, we designed four different collection disc lengths—1, 2, 3, and 4 mm. We injected 400 μL of 594-BSA sample and monitored the fluorescence intensity of BSA accumulation after 10 min. Fig. 3a showed that the 1 mm length of the collection disk showed higher fluorescence intensity, which represents the preconcentrator factor (PF).

Fig. 3.

Fig. 3

Open in a new tab

Optimization of the preconcentration. Fluorescence intensity graph according to (a) collection disc length, (b) device length, and (c) sample volume.

We designed four different absorbent region lengths as 2, 3, 4, and 5 cm, with a fixed collection disc length of 1 mm (Fig. 3b). After injecting the BSA sample of 300 μL onto the top of NPP, we observed a higher fluorescence of BSA accumulation by fluorescence intensity for the length of 3 cm.

Finally, we evaluated the impact of the injecting sample volume on preconcentration performance. We tested the injection volume of BSA with 200, 300, 400, and 500 μL, with a fixed total length (3 cm) and collection disc (1 mm), After 10 min, we observed that the fluorescence intensity reached a maximum at 400 μL (Fig. 3c), indicating that this volume is sufficient for acquiring higher preconcentration factors.

3.3. SARS-CoV-2 Ag preconcentration and assay

To validate the performance enhancement via NPP sample enrichment, we carried out a COVID-19 LFA assay with NPP sample enrichment (Fig. 4). As a control experiment, we also conducted the assay using a commercial COVID-19 Ag kit. We prepared nucleocapsid protein recombinant (SARS-CoV-2) antigens using five different concentrations (0.01 ng/mL to 1 ng/mL) and 0.1X PBS buffer solution (Fig. 4). We enriched 400 μL of each sample into a final volume of 13 μL, which corresponds to a 30-fold enrichment. Using the positively charged nucleocapsid proteins, we were able to enhance LOD ∼10-fold.

We injected 400 μL SARS-CoV-2 nucleocapsid Ag onto the top of NPP (Fig. 4a). After 10 min of the enrichment operation, we cut the collection disc (enriched part) with a hand-held cutter. Then, the collection disc was transferred to commercial LFA. Finally, 100 μL commercial extraction buffer was passed through the pipette and assayed using commercial LFA following the manufacturer's guidelines. We conducted the control experiment using a commercial LFA. To evaluate the analytical sensitivity and LOD enhancement facilitated by the NPP, we showed assay results both from commercial LFA and NPP-assisted LFA (Fig. 4b). We observed the test/control line after 15 min according to the manufacturer's guidelines to determine the sensitivity and LOD. The total assay time of NPP-assisted LFA assay was within 25 min, which included an additional 10-min enrichment process with a 15-min commercial assay time.

In Fig. 4b, the red square represents the color intensities of the NPP-assisted LFA test line, and the gray circle indicates that of commercial LFA. Using the NPP-assisted LFA, we observed the increase in color intensity for all concentrations, showing the enhanced assay performance. To set the LOD values that are represented by the invisible line in Fig. 4b, we first measured color signals using custom-built imaging system. Next, five individually trained engineers (Calth Inc. http://www.thecalth.com) observed the colorimetric signal using the standard color chart to determine the LOD. Finally, we determined the LOD color intensity values in the reader/optical system using labeled information. We observed a clear enhancement of the colorimetric signals with NPP-assisted enrichment process (Fig. 4e) compared with commercial one (Fig. 4d). The LOD from the color intensity versus concentration plot shows a higher LOD of NPP-assisted LFA (>10-fold) compared to the LFA without preconcentration, and this indicates the massive potential of the NEK-assisted enrichment process for POCT.

3.4. SARS-CoV-2 Ag specificity test

To study the specificity and undesirable false positive signal from NPP operations, we prepared one protein (BSA), two viruses (Influenza A and Influenza B), and two buffers (normal nasal and buffer only), and we tested five different samples that did not contain any SARS-CoV-2 Ag (Fig. 4c).

First, we evaluated the color intensity of the commercial LFA using a 0.1 ng/mL SARS-CoV-2 Ag. We did not observe any visible color signals. Then, using the NPP-assisted preconcentration, we acquired visible color signals, which indicate the signal enhancement without any undesirable denaturation of target nucleocapsid protein given that we performed NPP-assisted LFA without any electric field.

Second, to further examine whether cross-reactivity happens after NPP-assisted enrichment, we assayed using NPP-assisted LFA with one protein (BSA), two viruses (Influenza A and Influenza B), and two buffers (normal nasal and buffer only), and we did not observe any cross-reactivity, thus indicating good selectivity.

3.5. Clinical sample test

We validated the assay enhancement using an NPP-assisted LFA in the previous section. Although we successfully demonstrated the efficacy of the NPP-assisted LFA with diluted standard samples, we needed to verify if the NPP-assisted LFA could be extended onto real patient samples (Fig. 5 ). In Fig. 5a, we show the assay protocol, which included sample collection, NPP enrichment, and commercial LFA assay. The only step added to the commercial LFA test is the 10-min NPP enrichment process. We diluted the real COVID-19 patient samples to demonstrate the performance in low Ag concentration. Table S2 shows the detailed sample information. We included low concentration samples to validate the performance of the NEK-LFA because the commercial LFA cannot detect those low Ag concentrations.

Fig. 5.

Fig. 5

Open in a new tab

Clinical sample test of COVID-19 antigen test. (a) Sample enrichment and the assay procedure of human nasal sample. (b) Color intensity graph according to diluted sample concentration with the preconcentration. (c) Test and the control line images by enhanced signal with NPP-assisted LFA. (d) Fluorescence intensities of the cycles with RT-PCR test of the preconcentrated COVID-19 sample. (e) Clinical sample evaluations using 10 samples (n = 5 for positive and n = 5 for healthy controls), showing the enhanced assay performance with NPP enrichment.

We increased the colorimetric signal with the NPP-assisted LFA by concentrating target sample, and we enhanced the LOD by adapting the NPP enrichment step (Fig. 5b–d). First, we demonstrated the ability of NPP-assisted LFA using a patient (female, 63 years). With two diluted samples (500-fold and 100-fold dilutions), we significantly enhanced the colorimetric signal via NPP enrichment, indicating the ability to extend the sensitivity and LOD of the NPP-assisted LFA with real human nasal sample (Fig. 5b–c). Moreover, we tested the NPP-assisted function for the virus concentration using RT-PCR (Fig. 5d). Generally, a lower Ct value indicates higher virus titers. Without NPP, the samples with dilution from the patient sample (male, 59 years) showed lower virus titers (Ct = 33.51). However, they significantly increased the concentrations (Ct = 30.43), representing an 8-fold increase in the overall concentration. Clinical samples include inhibitors, and this may have an adverse impact on the performance of the immunoassay (LFA test) and molecular assay (RT-PCR). We expect that removing inhibition could be another parameter that enhances the Ct values in RT-PCR. To show the clinical ability, we tested the assay with NPP-assisted LFA using 10 clinical samples (n = 5 for positive and n = 5 for healthy controls) (Fig. 5e). We observed that the colorimetric signals are significantly enhanced with NPP-assisted LFA, compared with those of commercial LFA (sample #6∼#10 in Fig. 5e). In contrast to SARS-CoV-2 positive patient samples, samples from healthy controls (sample #1∼#5) showed no signal enhancements with NPP-assisted LFA, representing no false-positive signals via NPP enrichment process.

3.6. Prototype of NPP for POCT

In most commercialized LFAs, a flexible tube that contains extraction buffers is generally used based on the manufacturer's guidelines. In a routine assay process, nasal/nasopharyngeal swab samples or saliva samples that extracted the viral protein in an extraction buffer tube were collected, and the diluted samples were applied to the commercial LFA. To suffice low-cost requirements, we attempted to design sample enrichment gadgets directly onto the extraction tube (Fig. 6). Consequently, we do not require any external power source, battery, or pump for sample enrichment. The only additional action that is required is turning the test-tubes upside down. In Fig. 6a, we illustrated four components of NPP. The commercial LFA includes the buffer tube (Fig. 6b) and injection part (part 1 in Fig. 6a). For the NPP enrichment, we added two parts—the absorbent part (2) and the collection part (3). We designed the releasing part (4) by modifying the commercial buffer tube to deliver the two buffers sequentially.

For the operation (Fig. 6c), we collected the swabbed samples, released them onto a tube, and then turned the tube upside down after connecting the filter parts. Finally, after the 10-min NPP operation, we replaced the absorbent part with a tube cap; we then tested the LFA assay (Fig. 6d). To verify the feasibility of the prototype, we tested the NPP-assisted LFA assay on two prepared samples (0.05 and 0.1 ng/mL), and we showed the signal enhancement on these samples (Fig. 6e). A further optimization is needed to maximize NPP design. However, we could suggest the first nanoelectrokinetic device with a simplified design.

4. Conclusion

We demonstrated a non-powered nanoelectrokinetic preconcentration that can be directly used in the COVID-19 LFA kit. To meet the acceptable criteria of WHO, we suggested an inexpensive sample enrichment technique directly applicable to commercial LFA. We tested the NPP enrichment directly onto a commercial buffer tube and demonstrated the enrichment without any electrical component or external pump. As a result, we acquired an enhancement of LOD by up to 10-fold in COVID-19 detection with the 10 min-NPP operations; moreover, we acquired an enhanced Ct value (ΔCt ∼3) from the RT-PCR. We expected the additional cost to be less than 10 cents, given that NPP requires a small budget for sample preparation. Thus, it is highly affordable compared to other paper-based and microfluidic chips. Through further investigation, we expect that the NPP enrichment technique could meet WHO's desirable criteria for the point of care test (POCT) with a sensitivity of >90%, a specificity of >99%, Ct ≥ 30, and an assay time <20 min. In order for this NPP enrichment technique to be commercialized, the tests for application to other analysis equipment and the tests for application to other samples will be needed.

CRediT authorship contribution statement

Jinhwan Kim: Conceptualization, Methodology, Investigation, Formal analysis, Writing – review & editing. Cheonjung Kim: Methodology, Validation, Formal analysis, Writing – review & editing. Jeong Soo Park: Methodology, Formal analysis. Na Eun Lee: Formal analysis, Investigation. Seungmin Lee: Formal analysis. Sung-Yeon Cho: Clinical samples. Chulmin Park: Clinical samples. Dae Sung Yoon: Supervision, Writing – review & editing. Yong Kyoung Yoo: Conceptualization, Supervision, Writing – review & editing. Jeong Hoon Lee: Conceptualization, Supervision, Project administration, Writing – review & editing.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

This research was supported by the Bio & Medical Technology Development Program of the National Research Foundation (NRF) funded by the Korean government (MSIT) (No. 2021M3E5E3080743). J.H. Lee was supported by a research grant from Kwangwoon University in 2022.

Footnotes

Appendix A

Supplementary data related to this article can be found at https://doi.org/10.1016/j.bios.2022.114965.

Appendix A. Supplementary data

The following is the supplementary data related to this article:

Multimedia component 1
mmc1.docx (1.7MB, docx)

Data availability

No data was used for the research described in the article.

References

  1. Alam N., Tong L., He Z., Tang R., Ahsan L., Ni Y. Cellulose. 2021;28(13):8641–8651. doi: 10.1007/s10570-021-04083-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Arbeitman C.R., Rojas P., Ojeda-May P., Garcia M.E. Nat. Commun. 2021;12(1):5407. doi: 10.1038/s41467-021-25478-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Carrell C., Kava A., Nguyen M., Menger R., Munshi Z., Call Z., Nussbaum M., Henry C. Microelectron. Eng. 2019;206:45–54. [Google Scholar]
  4. Carter L.J., Garner L.V., Smoot J.W., Li Y., Zhou Q., Saveson C.J., Sasso J.M., Gregg A.C., Soares D.J., Beskid T.R., Jervey S.R., Liu C. ACS Cent. Sci. 2020;6(5):591–605. doi: 10.1021/acscentsci.0c00501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chaouch M. Rev. Med. Virol. 2021;31(6):e2215. doi: 10.1002/rmv.2215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cheng Z., Choi N., Wang R., Lee S., Moon K.C., Yoon S.-Y., Chen L., Choo J. ACS Nano. 2017;11(5):4926–4933. doi: 10.1021/acsnano.7b01536. [DOI] [PubMed] [Google Scholar]
  7. Crozier A., Rajan S., Buchan I., McKee M. BMJ. 2021;372:n208. doi: 10.1136/bmj.n208. [DOI] [PubMed] [Google Scholar]
  8. Deng Y., Jiang H., Li X., Lv X. Microchim. Acta. 2021;188(11):379. doi: 10.1007/s00604-021-05037-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dighe K., Moitra P., Alafeef M., Gunaseelan N., Pan D. Biosens. Bioelectron. 2022;200 doi: 10.1016/j.bios.2021.113900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Escrivá B.F., Mochón M.D.O., González R.M., García C.S., Pla A.T., Ricart A.S., García M.M., Aranda I.T., García F.G., Cardona C.G. J. Clin. Virol. 2021;143 doi: 10.1016/j.jcv.2021.104941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gan W., Zhuang B., Zhang P., Han J., Li C.-X., Liu P. LChip. 2014;14(19):3719–3728. doi: 10.1039/c4lc00686k. [DOI] [PubMed] [Google Scholar]
  12. Garg M., Sharma A.L., Singh S. Biosens. Bioelectron. 2021;171 doi: 10.1016/j.bios.2020.112703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gong Y H.J., Choi J.R., You M., Zheng Y., Xu B., Wen T., Xu F. Int. J. Nanomed. 2017;12:4455–4466. doi: 10.2147/IJN.S135735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Grant B.D., Anderson C.E., Williford J.R., Alonzo L.F., Glukhova V.A., Boyle D.S., Weigl B.H., Nichols K.P. Anal. Chem. 2020;92(16):11305–11309. doi: 10.1021/acs.analchem.0c01975. [DOI] [PubMed] [Google Scholar]
  15. Gremmels H., Winkel B.M.F., Schuurman R., Rosingh A., Rigter N.A.M., Rodriguez O., Ubijaan J., Wensing A.M.J., Bonten M.J.M., Hofstra L.M. EClinicalMedicine. 2021;31 doi: 10.1016/j.eclinm.2020.100677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Han S.I., Hwang K.S., Kwak R., Lee J.H. Lab Chip. 2016;16(12):2219–2227. doi: 10.1039/c6lc00499g. [DOI] [PubMed] [Google Scholar]
  17. Han S.I., Lee D., Kim H., Yoo Y.K., Kim C., Lee J., Kim K.H., Kim H., Lee D., Hwang K.S., Yoon D.S., Lee J.H. Anal. Chem. 2019;91(16):10744–10749. doi: 10.1021/acs.analchem.9b02201. [DOI] [PubMed] [Google Scholar]
  18. Han S.I., Yoo Y.K., Lee J., Kim C., Lee K., Lee T.H., Kim H., Yoon D.S., Hwang K.S., Kwak R., Lee J.H. Sensor. Actuator. B Chem. 2018;268:485–493. [Google Scholar]
  19. Hu J., Xiao K., Jin B., Zheng X., Ji F., Bai D. Biotechnol. Bioeng. 2019;116(10):2764–2777. doi: 10.1002/bit.27106. [DOI] [PubMed] [Google Scholar]
  20. Huang Y., Xu T., Wang W., Wen Y., Li K., Qian L., Zhang X., Liu G. Microchim. Acta. 2019;187(1):70. doi: 10.1007/s00604-019-3822-x. [DOI] [PubMed] [Google Scholar]
  21. Jiang N., Tansukawat N.D., Gonzalez-Macia L., Ates H.C., Dincer C., Güder F., Tasoglu S., Yetisen A.K. ACS Sens. 2021;6(6):2108–2124. doi: 10.1021/acssensors.1c00669. [DOI] [PubMed] [Google Scholar]
  22. Kang J., Jang H., Yeom G., Kim M.-G. Anal. Chem. 2021;93(2):992–1000. doi: 10.1021/acs.analchem.0c03822. [DOI] [PubMed] [Google Scholar]
  23. Kim C., Yoo Y.K., Han S.I., Lee J., Lee D., Lee K., Hwang K.S., Lee K.H., Chung S., Lee J.H. Lab Chip. 2017;17(14):2451–2458. doi: 10.1039/c7lc00036g. [DOI] [PubMed] [Google Scholar]
  24. Kim C., Yoo Y.K., Lee N.E., Lee J., Kim K.H., Lee S., Kim J., Park S.J., Lee D., Lee S.W., Hwang K.S., Han S.I., Lee D., Yoon D.S., Lee J.H. Biosens. Bioelectron. 2022;212 doi: 10.1016/j.bios.2022.114385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kim H., Lee K.H., Han S.I., Lee D., Chung S., Lee D., Lee J.H. Lab Chip. 2019;19(23):3917–3921. doi: 10.1039/c9lc00796b. [DOI] [PubMed] [Google Scholar]
  26. Kumar S., Bhushan P., Krishna V., Bhattacharya S. Biomicrofluidics. 2018;12(3) doi: 10.1063/1.5035113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lai C.-C., Wang C.-Y., Ko W.-C., Hsueh P.-R. J. Microbiol. Immunol. Infect. 2021;54(2):164–174. doi: 10.1016/j.jmii.2020.05.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lee D., Lee J.W., Kim C., Lee D., Chung S., Yoon D.S., Lee J.H. Biosens. Bioelectron. 2021;176 doi: 10.1016/j.bios.2020.112904. [DOI] [PubMed] [Google Scholar]
  29. Li J., Ma B., Fang J., Zhi A., Chen E., Xu Y., Yu X., Sun C., Zhang M. Foods. 2020;9(1):27. doi: 10.3390/foods9010027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Li Z., You M., Bai Y., Gong Y., Xu F. Small Methods. 2020;4(4) [Google Scholar]
  31. Mina M.J., Parker R., Larremore D.B. N. Engl. J. Med. 2020;383(22) doi: 10.1056/NEJMp2025631. [DOI] [PubMed] [Google Scholar]
  32. Nishat S., Jafry A.T., Martinez A.W., Awan F.R. Sensor. Actuator. B Chem. 2021;336 [Google Scholar]
  33. Niu J., Bao Z., Wei Z., Li J.X., Gao B., Jiang X., Li F. Anal. Chem. 2021;93(8):3959–3967. doi: 10.1021/acs.analchem.0c04883. [DOI] [PubMed] [Google Scholar]
  34. Otoo J.A., Schlappi T.S. Biosensors. 2022;12(2):124. doi: 10.3390/bios12020124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Park M., Won J., Choi B.Y., Lee C.J. Exp. Mol. Med. 2020;52(6):963–977. doi: 10.1038/s12276-020-0452-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Pokharel S., White L.J., Sacks J.A., Escadafal C., Toporowski A., Mohammed S.I., Abera S.C., Kao K., Melo Freitas M.D., Dittrich S. PLOS Global Public Health. 2022;2(3) doi: 10.1371/journal.pgph.0000293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Rivas L., Medina-Sánchez M., de la Escosura-Muñiz A., Merkoçi A. Lab Chip. 2014;14(22):4406–4414. doi: 10.1039/c4lc00972j. [DOI] [PubMed] [Google Scholar]
  38. Ruiz R.A., Gonzalez J.L., Vazquez-Alvarado M., Martinez N.W., Martinez A.W. Anal. Chem. 2022;94(25):8833–8837. doi: 10.1021/acs.analchem.2c01534. [DOI] [PubMed] [Google Scholar]
  39. Sena-Torralba A., Ngo D.B., Parolo C., Hu L., Álvarez-Diduk R., Bergua J.F., Rosati G., Surareungchai W., Merkoçi A. Biosens. Bioelectron. 2020;168 doi: 10.1016/j.bios.2020.112559. [DOI] [PubMed] [Google Scholar]
  40. Shani-Narkiss H., Gilday O.D., Yayon N., Landau I.D. medRxiv. 2020 [Google Scholar]
  41. Teymouri M., Mollazadeh S., Mortazavi H., Naderi Ghale-noie Z., Keyvani V., Aghababaei F., Hamblin M.R., Abbaszadeh-Goudarzi G., Pourghadamyari H., Hashemian S.M.R., Mirzaei H. Pathol. Res. Pract. 2021;221 doi: 10.1016/j.prp.2021.153443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tian T., Bi Y., Xu X., Zhu Z., Yang C. Anal. Methods. 2018;10(29):3567–3581. [Google Scholar]
  43. Udugama B., Kadhiresan P., Kozlowski H.N., Malekjahani A., Osborne M., Li V.Y.C., Chen H., Mubareka S., Gubbay J.B., Chan W.C.W. ACS Nano. 2020;14(4):3822–3835. doi: 10.1021/acsnano.0c02624. [DOI] [PubMed] [Google Scholar]
  44. van Kasteren P.B., van der Veer B., van den Brink S., Wijsman L., de Jonge J., van den Brandt A., Molenkamp R., Reusken C., Meijer A. J. Clin. Virol. 2020;128 doi: 10.1016/j.jcv.2020.104412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wang C., Shi D., Wan N., Yang X., Liu H., Gao H., Zhang M., Bai Z., Li D., Dai E., Rong Z., Wang S. Analyst. 2021;146(12):3908–3917. doi: 10.1039/d1an00304f. [DOI] [PubMed] [Google Scholar]
  46. Wang L., Wang X., Cheng L., Ding S., Wang G., Choo J., Chen L. Biosens. Bioelectron. 2021;189 doi: 10.1016/j.bios.2021.113360. [DOI] [PubMed] [Google Scholar]
  47. Wang X., Choi N., Cheng Z., Ko J., Chen L., Choo J. Anal. Chem. 2017;89(2):1163–1169. doi: 10.1021/acs.analchem.6b03536. [DOI] [PubMed] [Google Scholar]
  48. Wolfel R., Corman V.M., Guggemos W., Seilmaier M., Zange S., Muller M.A., Niemeyer D., Jones T.C., Vollmar P., Rothe C., Hoelscher M., Bleicker T., Brunink S., Schneider J., Ehmann R., Zwirglmaier K., Drosten C., Wendtner C. Nature. 2020;581(7809):465–469. doi: 10.1038/s41586-020-2196-x. [DOI] [PubMed] [Google Scholar]
  49. Yu S., Nimse S.B., Kim J., Song K.-S., Kim T. Anal. Chem. 2020;92(20):14139–14144. doi: 10.1021/acs.analchem.0c03202. [DOI] [PubMed] [Google Scholar]
  50. Zhang C., Zheng T., Wang H., Chen W., Huang X., Liang J., Qiu L., Han D., Tan W. Anal. Chem. 2021;93(7):3325–3330. doi: 10.1021/acs.analchem.0c05059. [DOI] [PubMed] [Google Scholar]
  51. Zhang Q., Fang L., Jia B., Long N., Shi L., Zhou L., Zhao H., Kong W. TrAC, Trends Anal. Chem. 2021;144 [Google Scholar]
  52. Zhou Y., Wu Y., Ding L., Huang X., Xiong Y. TrAC, Trends Anal. Chem. 2021;145 doi: 10.1016/j.trac.2021.116452. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.docx (1.7MB, docx)

Data Availability Statement

No data was used for the research described in the article.

Articles from Biosensors & Bioelectronics are provided here courtesy of Elsevier

RESOURCES