Skip to main content
Cancer Control: Journal of the Moffitt Cancer Center logoLink to Cancer Control: Journal of the Moffitt Cancer Center
. 2022 Dec 2;29:10732748221143879. doi: 10.1177/10732748221143879

Polymorphisms in IL-17A Gene and Susceptibility of Colorectal Cancer in Bangladeshi Population: A Case-Control Analysis

Md Robiul Islam 1,2,#, Md Abdul Aziz 2,#, Mohammad Shahriar 1, Mohammad Safiqul Islam 3,4,✉
PMCID: PMC9720807  PMID: 36458977

Abstract

Objective

Interleukin-17A (IL-17A) genetic polymorphisms are associated with multiple cancer types, including colorectal cancer (CRC). However, no previous study was performed in the Bangladeshi population to evaluate the association. Our study aimed to find the association between two IL-17A variants (rs10484879 C/A and rs3748067 G/A) and susceptibility of CRC.

Methods and Materials

This retrospective case-control study comprised 292 CRC patients and 288 age, sex, and BMI matched healthy volunteers. Genotyping of both variants was done by the tetra-primer ARMS-PCR method, and the results were analyzed by the SPSS software package (version-25.0).

Results

Logistic regression analysis indicated that in case of IL-17A rs10484879 polymorphism, AC and AA genotype carriers showed 2.44- and 3.27-times significantly increased risk for CRC development (OR = 2.44, P = .0008 and OR = 3.27, P = .0133, individually). A significant association was also observed for AC + AA genotype (OR = 2.58, P = .0001). Again, over-dominant and allelic model revealed statistically significant link to CRC risk (OR = 2.13, P = .0035 and OR = 2.22, P = .001). For rs3748067 polymorphism, AG and AA genotype carriers showed 2.30- and 2.45-times enhanced risk for CRC (OR = 2.30, P = .005 and OR = 2.45, P = .031). A statistically significant association was also observed for AG + AA genotype (OR = 2.35, P = .001), over-dominant model (OR = 2.05, P = .014), and allelic model (OR = 2.11, P = .0004).

Conclusion

This study highlights that IL-17A rs10484879 and rs3748067 polymorphisms may be associated with CRC development. However, further functional research with larger samples may reveal more statistically significant outcomes.

Keywords: colorectal cancer, IL-17A, association, polymorphism, ARMS-PCR

Background

Colorectal cancer (CRC) is considered one of the most prevalent carcinomas that mainly affects the areas of the digestive tract.1 This malignancy is accounted for almost 10% of worldwide occurrences and more than 9% of mortalities by the year 2020. Based on aging projections, population explosion, and human development, the global burden of new cases with CRC is supposed to exceed 3 million within the next 20 years.2 In 2020, colorectal cancer cases (including anus) were more than 1.9 million, where the death number was about 935000, representing about 1 in ten cancer cases and deaths. In terms of incidence, it ranks about 3rd but 2nd in the case of mortality.3

CRC risk factors have been found to be heterogeneous across anatomical locations. Smoking, for example, is linked to a higher chance of proximal colon and rectal cancers but not distal colon cancer.4 Physical exertion is reciprocal to the risk of distal and proximal colon tumor but not tumor of the rectum.5 The distinguished pathogenic loads, matching microbiological products, and host features may contribute to the heterogeneity of these risk factors.6,7 There are several non-modifiable risk factors such as age,8 race,2,9 sex,5 personal history of adenomatous polyps,10 coronary artery disease,11,12 personal history of inflammatory bowel disease,13 and modifiable risk factors such as diet,14,15 physical inactivity and sedentary lifestyle,16,17 cigarette smoking,18,19 alcohol consumption,20,21 sedentary lifestyle,22 overweight and obesity,23-25 chronic inflammatory bowel disease (IBD)26-28 as well as genetic risk factors act an important role in CRC risk, especially when relatives have been diagnosed with the disease early.29 Moreover, 60-65% of all CRC cases are sporadic, with no family history or inherited genomic abnormalities.2,30

The IL-17A gene, which spans 4252 bp and is found on chromosome 6, location 6p12.2, has three exons and two introns.31 This gene produces a pro-inflammatory interleukin that is released by activated T lymphocytes and is a major representative of the IL-17 receptor superfamily, which covers six members (IL-17RA-F). The resulting protein has important effects on host immune defense mechanism, immune regulation, and body tissue reconstruction and plays a substantial function in innate immune defense induction. IL-17A is responsible not only for host defense but also for the etiology of various autoimmune diseases and cancers.32 There are several diseases along with cancers caused by the IL-17A gene, such as multiple sclerosis,33 psoriasis,34 Crohn’s disease and ulcerative colitis,35 systemic lupus erythematosus,36 lung diseases.37 It also plays potential role in the formation of stomach cancer,38,39 colorectal cancer,40,41 cervical cancer,42 lung carcinoma,43 breast carcinoma,44 and bladder cancer.45

There are a few case-control studies till now have been investigated to find out the association of human IL-17A gene polymorphisms (rs10484879 and rs3748067) with the susceptibility of CRC. A Tunisian study has demonstrated that the frequency of the minor allele in rs10484879 was substantially greater in colorectal carcinoma patients than in healthy participants. They also found that heterozygous rs10484879 was linked to an elevated susceptibility to CRC, and the minor allele rs10484879 was linked to a positive family background of this cancer as well as other malignancies. Moreover, they showed that rs3748067 has a positive link with CRC development.40 Another study examined the role of these polymorphisms in which authors applied information from two population-dependent pilot studies to see whether 69 variants of 13 genes in the cytokine mechanism have any association with colon and rectal tumor risk or not. They found several results with several genes and their respective SNPs. Notably, it was found that the rs10484879 of the IL-17A gene is also associated with colon cancer.41

Based on the biological, geographical, and ethnic variations, the rate and extent of disease occurrences also vary. The variations may even be seen between the populations from the same geographical area or ethnicity.46 So, based on previous research around the world, we speculated that rs10484879 and rs3748067 polymorphisms in IL-17A gene might be responsible for CRC development in the Bangladeshi population. To evaluate this hypothesis, the present case-control analysis was performed in our population.

Method and Material

Study Population and Ethical Permission

This retrospective case-control study is comprised of 292 CRC patients and 288 healthy participants. This case-control study was conducted from September 2021 to March 2022. Ethical permission was taken from the Research Ethics Committee, the University of Asia Pacific, Bangladesh [Approval No. UAP/REC/2O21/108(S)] after reviewing the study protocol. Patients with CRC were recruited randomly from the National Institute of Cancer Research and Hospital Dhaka Ahsania Mission Cancer and General Hospital. Controls were chosen following a physical examination by matching age and sex to CRC patients. Data on age, sex, dietary habit, weight, BMI (Body Mass Index), TNM (Tumor Node Metastasis) classification, demographical variables, and lifestyle features were obtained by competent nurses with available expert physicians. Each patient and control subject signed an informed consent document after briefing the purpose of the study. The current pilot investigation was conducted at the Biotechnology Laboratory of the Pharmacy Department, University of Asia Pacific, Bangladesh, according to the Helsinki II declaration. The reporting of this study conforms to STROBE guidelines for case-control studies.47

Genomic DNA Extraction and Quantification

DNA extraction kit, Axygen® (USA) was used for isolating genomic DNA from whole blood (3 mL) from 292 CRC and 288 healthy participants. The procedure manual that came with the kit was meticulously followed when extracting DNA. The purity of the extracted DNA and their concentrations were measured by Nano Spectrophotometer (Genova Nano, Jenway) at 260/280 nm. The purity of the entire DNA was found to be in the range 1.7-2.0, which was then stored at −80°C.

Preparation of Primers and PCR Working Mix

The primers were dissolved according to the company’s instructions by adding an appropriate quantity of nuclease-free water to the primers to form a stock. Then 50 μl of each primer was diluted with 150 μl of nuclease-free water to get the final volume of 200 μl, which was used on a regular basis for DNA amplification, while the original primers were kept in −35°C and the procedure was continued with the stock primers. The primers used for amplification of IL-17A rs10484879 and rs3748067 were designed by Primer1, a primer design web service for tetra-primer ARMS-PCR and sequences are given in Table 1. PCR working mix consisted of PCR master mix, primers, nuclease free water, and extracted DNA. After making the working PCR mix of 126 μL with 63 μL of 2 × master mix, 1.5 μL of each of four primers (10 mmol/l), 1 μL of DNA template, and 56 μL of nuclease-free water for 12 samples, then pipetted 10 μL of working mix in each PCR tube, followed by 1 μL of extracted DNA.

Table 1.

Primer Sequences and Observed PCR Products.

Gene SNP Primers (5’-3’) PCR conditions No. of cycles Size of PCR products (bp)
IL-17A rs10484879 Forward inner: GAAACTCATCGTGAAGTCAAACATTTAA 95°C for 5 minutes 35 CC: 110, 203
Reverse inner: AGATTTTCTATAGCTCTTTCTTCCAGTG 95°C for 1 minute AC: 110, 149, 203
Forward outer: GATTTTCTAGGTAGAAATATCCTCCTGC 63°C for 30 seconds AA: 149, 203
Reverse outer: TATACCTAAGAAAACATGAAGGAGATCG 72°C for 30 seconds
72°C for 10 minutes
rs3748067 Forward inner: CTTGGGCTGAACTTTTCTCATACTTACAG
95°C for 5 minutes 35 GG: 192, 305
Reverse inner: AAAGGAGCTGATGGGGCAGAACGCAT 95°C for 1 minute AG: 168, 192, 305
Forward outer: TCTAGAGGCCTTCAGAAGTAGGGCAAGA 63.5°C for 30 seconds AA: 168, 305
Reverse outer: GTCCAGTTTCTCCCCTAGACTCAGGCTT 72°C for 30 seconds
72°C for 10 minutes

SNP: Single nucleotide polymorphism; PCR: Polymerase chain reaction; BP: Base-pair.

Validation Process of ARMS–PCR and Subsequent Genotyping

Before starting genotyping, the process of method validation was carried out to choose an appropriate annealing temperature for both genetic variants to obtain the desired fragments of DNA.48 Primarily, a gradient PCR was run, setting the temperature from 55°C to 65°C by altering the concentration of primers. Based on the outcomes, two annealing temperatures, 63°C and 63.5°C were selected as for amplifying rs10484879 and rs3748067, individually. In terms of the rs10484879 variant, at 63°C temperature, we got 203 bp, 149 bp, and 110 bp DNA fragments (Figure 1), whereas for the rs3748067 variant, at 63.5°C temperature, we got 305 bp, 192 bp, and 168 bp DNA fragments (Figure 2). Next, the products of PCR were examined using gel electrophoresis (1.5% agarose), adding EtBr (ethidium bromide) to confirm the presence of the target genotypes. PCR amplification conditions and the respective amplified fragments for both SNPs (rs10484879 and rs3748067) are described in Table 1. About 20% of the samples were replicated to confirm the genotypes.

Figure 1.

Figure 1.

Observed PCR products for IL-17A gene rs10484879 after 1.5% of agarose gel electrophoresis.

Figure 2.

Figure
2.

Observed PCR products for IL-17A gene rs3748067 after 1.5% of agarose gel electrophoresis.

Statistical Analysis

All statistical analyses were carried out applying the statistical software package SPSS (v. 25.0) and MedCalc (v. 20.0). The differences between demographic and clinicopathologic information of cases and volunteers were contrasted by applying χ2-tests and two-sided unpaired t-tests. The association of rs10484879 and rs3748067 with CRC susceptibility was examined using odds ratios (ORs) along with the corresponding 95% confidence intervals (CI). The deviation of genotype frequencies was measured under the Hardy-Weinberg equilibrium (HWE) by applying the χ2-test. Online Sample Size Estimator (OSSE) was used to calculate the statistical power of sample size for this case-control association study. Analysis of the false-positive report probability (FPRP) was utilized to assess the noteworthy relationships of the significant findings.49,50 The FPRP threshold was set at .2, and a prior probability of .1 was provided for a relationship with the investigated genotypes. The P < .05 was regarded statistically significant in this study.

Results

Distribution of Demographics in Participants

The demographic and clinicopathological characteristics of included CRC patients and healthy participants are described in Table 2. The data suggest that the minimum age of patients was 19 years and controls was 15 years, and the maximum age of patients was 78 years and controls was 75 years. Again, the number of patients below 45 years and from 45 to 60 years were 23.97% and 56.16%, consecutively, whereas, for healthy participants, the values were 17.36% and 69.44%, respectively. The frequencies of both cases and controls aged more than 60 years were 19.86% and 13.19%, respectively. The average BMI in cases and controls was 23.12 ± 4.38 and 23.68 ± 2.88. In CRC cases, the percentage of male, female, married, and unmarried was about 58.90%, 41.10%, 91.78%, and 8.22%, whereas, in controls, these numbers were 51.39%, 48.61%, 85.42%, and 14.58%, respectively. In terms of smoking and alcohol consumption, 41.78% and 4.79% cases were found; similarly, in controls, the percentages were 39.58% and 1.39%. Familial history of CRC was excluded in control subjects, but it was included in CRC cases. Among the CRC participants, the maximum belonged to colon cancer (65.75%). In cases samples, most of the patients were in TNM stage 3 (33.56%). Among the patients, 54.11% carried the tumor size more than 5 cm, rest of the number were carried less than 5 cm of tumor size. Lymph node metastasis status was observed in 67.12% of cases. Several approaches of treatment were taken by the CRC patients, where 73.28% belonged to chemotherapy.

Table 2.

Demographic and Clinicopathological Characteristics of Colorectal Cancer Patients and Controls.

Variables Cases, N = 292 Controls, N = 288 P-value
Age (years) <45 70 (23.97%) 50 (17.36%) .306
45-60 164 (56.16%) 200 (69.44%)
>60 58 (19.86%) 38 (13.19%)
Age (years) Minimum age 19 15
Maximum age 78 75
Average 48.43 52.11
Average BMI (kg/m2) ±SD 23.12±4.38 23.68±2.88 .197
Sex Male 172 (58.90%) 148 (51.39%) .199
Female 120 (41.10%) 140 (48.61%)
Marital status Married 268 (91.78%) 246 (85.42%) .092
Unmarried 24 (8.22%) 42 (14.58%)
Smoking Yes 122 (41.78%) 114 (39.58%) .703
No 170 (58.22%) 174 (60.42%)
Alcohol intake Yes 14 (4.79%) 4 (1.39%) .116
No 278 (95.21%) 284 (98.61%)
Family history of CRC Yes 34 (11.64%) N/A
No 258 (88.36%) N/A
Tumor localization Colon 192 (65.75%) N/A
Rectum 100 (34.25%) N/A
TNM stage 1 46 (15.75%) N/A
2 86 (29.45%) N/A
3 98 (33.56%) N/A
4 62 (21.23%) N/A
Tumor size >5 cm 158 (54.11%) N/A
≤5 cm 134 (45.89%) N/A
Lymph node metastasis Yes 196 (67.12%) N/A
No 96 (32.88%) N/A
Treatment history Chemotherapy 214 (73.28%) N/A
Radiotherapy 6 (2.05%) N/A
Chemotherapy + radiotherapy 34 (11.64%) N/A
Surgery 14 (4.79%) N/A
Mixed 24 (8.22%) N/A

BMI: Body mass index; TNM: Tumor node metastasis; CRC: Colorectal cancer; SD: Standard deviation.

Genotype Frequencies of Participants

The frequencies of genotypes for both rs10484879 and rs3748067 in the IL-17A gene according to the Hardy-Weinberg Equilibrium (HWE) are presented in Table 3. For rs10484879 SNP, 49.31% of cases and 71.53% of controls carrying the CC genotype, whereas these values are 39.73% and 23.61% in terms of AC genotype and 10.96% and 4.86% in terms of AA genotype. The above calculation indicates that the distribution of genotype data in both cases (P = .408) and controls (P = .072) obeys the HWE. On the other hand, in the case of rs3748067, 58.90% of cases and 77.08% of controls had the GG genotype, whilst these frequencies were 28.08% and 15.97% in terms of AG genotype and 13.01% and 6.94% in terms of AA genotype. The genotype frequency distribution of both cases and controls is not consistent with HWE (P-values <.05). OSSE data showed that the statistical power of sample size included for rs10484879 and rs3748067 was 97.8% and 94.6%, respectively.

Table 3.

Distribution of Genotype Data for rs10484879 and rs3748067.

Genotypes Cases, N=292 (%) HWE Controls, N=288 (%) HWE
χ2 P-value χ2 P-value
rs10484879
 CC 144 (49.31) .68 .408 206 (71.53) 3.24 .072
 AC 116 (39.73) 68 (23.61)
 AA 32 (10.96) 14 (4.86)
 C 404 (69.18) 480 (83.33)
 A 180 (30.82) 96 (16.67)
rs3748067
 GG 172 (58.90) 12.15 <.001 222 (77.08) 19.84 <.001
 AG 82 (28.08) 46 (15.97)
 AA 38 (13.01) 20 (6.94)
 G 426 (72.94) 490 (85.06)
 A 158 (27.06) 86 (14.94)

HWE: Hardy–Weinberg equilibrium; P-value >.05 indicates consistent with HWE.

Association of rs10484879 and rs3748067 With CRC

Table 4 shows the association of rs10484879 and rs3748067 genetic variants with CRC susceptibility. From the analysis of IL-17A gene rs10484879, we found that AC genotype carrier showed 2.44-times increased risk in compared to CC genotype carrier for the development of CRC (AC vs. CC: OR = 2.44, P = .0008), and the association was significant. Again, AA genotype carrier depicted 3.27-folds enhanced risk and the association was significant (AA vs. CC: OR = 3.27, P = .0133). In the dominant model, AC + AA combined genotype depicted 2.58-fold increased susceptibility for CRC development, and the association was also statistically significant (AC + AA vs. CC: OR = 2.58, P = .0001). In terms of the recessive genetic model, AA genotype depicted 2.41-fold increased but non-significant risk for CRC development (AA vs. CC + AC: OR = 2.41, P = .0611). The over-dominant model also revealed 2.13-times greater risk for CRC development (AC vs. CC + AA: OR = 2.13, P = .0035). In the allelic model, A allele showed 2.22-times significantly enhanced risk with respect to C allele (A vs. C: OR = 2.22, P = .0001).

Table 4.

Association of rs10484879 and rs3748067 Polymorphisms with Colorectal Cancer.

Genetic models Genotype/Allele Cases, N=292 (%) Controls, N=288 (%) Crude analysis
OR (95% Cl) P-value
rs10484879
 Additive model 1 (AC vs CC) CC 144 (49.31) 206 (71.53) 1
AC 116 (39.73) 68 (23.61) 2.44 (1.45 – 4.10) .0008
 Additive model 2 (AA vs CC) CC 144 (49.31) 206 (71.53) 1
AA 32 (10.96) 14 (4.86) 3.27 (1.28 – 8.35) .0133
 Dominant model (AC + AA vs CC) CC 144 (49.31) 206 (71.53) 1
AC + AA 148 (50.68) 82 (28.47) 2.58 (1.59 – 4.20) .0001
 Recessive model (AA vs CC + AC) CC + AC 260 (89.04) 274 (95.14) 1
AA 32 (10.96) 14 (4.86) 2.41 (.96 – 6.04) .0611
 Over-dominant model (AC vs CC + AA) CC + AA 176 (60.27) 220 (76.39) 1
AC 116 (39.73) 68 (23.61) 2.13 (1.28 – 3.54) .0035
 Allele (A vs C) C 404 (69.18) 480 (83.33) 1
A 180 (30.82) 96 (16.67) 2.22 (1.50 – 3.31) .0001
rs3748067
 Additive model 1 (AG vs GG) GG 172 (58.90) 222 (77.08) 1
AG 82 (28.08) 46 (15.97) 2.30 (1.28 – 4.12) .005
 Additive model 2 (AA vs GG) GG 172 (58.90) 222 (77.08) 1
AA 38 (13.01) 20 (6.94) 2.45 (1.08 – 5.54) .031
 Dominant model (AG + AA vs GG) GG 172 (58.90) 222 (77.08) 1
AG + AA 120 (41.09) 66 (22.91) 2.35 (1.41 – 3.91) .001
 Recessive model (AA vs GG + AG) GG + AG 254 (86.98) 268 (93.05) 1
AA 38 (13.01) 20 (6.94) 2.00 (.90 – 4.48) .090
 Over-dominant model (AG vs GG + AA) GG + AA 210 (71.91) 242 (84.02) 1
AG 82 (28.08) 46 (15.97) 2.05 (1.16 – 3.64) .014
 Allele (A vs G) G 426 (72.94) 490 (85.06) 1
A 158 (27.06) 86 (14.94) 2.11 (1.40 – 3.20) .0004

OR: Odds ratio; CI: Confidence interval; P-value <.05 indicates statistically significant (bold).

In the case of rs3748067, it was found that AG genotype carrier showed 2.30-times significantly elevated association with CRC (AG vs. GG: OR = 2.44, P = .005). Again, AA genotype depicted 2.45-times enhanced risk, and the association was significant (AA vs. GG: OR = 2.45, P = .031). The dominant model showed 2.35-folds more risk for CRC development in terms of GG genotype, and the association was also statistically significant (AG + AA vs. GG: OR = 2.35, P = .001). In the recessive model, AA genotype showed 2.00-folds enhanced risk for CRC development, and the association was non-significant with respect to the GG + AG genotype (AA vs. GG + AG: OR = 2.00, P = .090). The over-dominant model revealed 2.05-times elevated risk for CRC development, and the association was statistically significant (AG vs. GG + AA: OR = 2.05, P = .014). In the allelic model, A allele showed 2.22-times enhanced risk for CRC development, and the risk was significantly associated with CRC (A vs. G: OR = 2.11, P = .0004).

An FPRP analysis was performed to determine whether the noteworthy results warranted attention (Table 5). The substantial correlation for rs10484879 (heterozygote, dominant, overdominant and allele models, FPRP = .170, .078, .265, .029) and for rs3748067 (heterozygote, dominant, overdominant and allele models, FPRP = .379, .177, .473, .068) was still notable at the prior probability threshold of .1.

Table 5.

False-Positive Report Probability Values for the Association Between rs10484879 and rs3748067 with Colorectal Cancer Risk.

Genotype Crude OR (95% CI) p Statistical Powera Prior probability
0.25 0.1 0.01 0.001 0.0001
rs10484879
 AC vs. CC 2.44 (1.45 – 4.10) 0.0008 0.033 0.064 0.170 0.693 0.958 0.996
 AA vs. CC 3.27 (1.28 – 8.35) 0.0133 0.052 0.435 0.698 0.962 0.996 1.000
 AC+AA vs. CC 2.58 (1.59 – 4.20) 0.0001 0.015 0.028 0.078 0.483 0.904 0.990
 AA vs. CC+AC 2.41 (0.96 – 6.04) 0.0611 0.156 0.538 0.778 0.975 0.997 1.000
 AC vs. CC+AA 2.13 (1.28 – 3.54) 0.0035 0.088 0.107 0.265 0.799 0.976 0.998
 A vs. G 2.22 (1.50 – 3.31) 0.0001 0.027 0.010 0.029 0.249 0.770 0.971
rs3748067
 AG vs. GG 2.30 (1.28 – 4.12) 0.005 0.075 0.169 0.379 0.870 0.985 0.999
 AA vs. GG 2.45 (1.08 – 5.54) 0.031 0.119 0.441 0.703 0.963 0.996 1.000
 AG+AA vs. GG 2.35 (1.41 – 3.91) 0.001 0.042 0.067 0.177 0.703 0.960 0.996
 AA vs. GG+AG 2.00 (0.90 – 4.48) 0.090 0.242 0.533 0.774 0.974 0.997 1.000
 AG vs. GG+AA 2.05 (1.16 – 3.64) 0.014 0.143 0.230 0.473 0.908 0.990 0.999
 (A vs. G) 2.11 (1.40 – 3.20) 0.0004 0.054 0.024 0.068 0.446 0.891 0.988

aStatistical power was calculated using the number of observations in the subgroup and the OR and P values in this table.

The results in false-positive report probability analysis were in bold if the prior probability <.2.

Discussion

Previous investigations have analyzed various polymorphisms in multiple genes that may be associated with CRC susceptibility. The IL-17A genetic polymorphisms have also been evaluated in different studies to correlate with CRC development. Keeping the possibility of different outcomes due to population or regional variation, we conducted this case-control study in the Bangladeshi population to examine the susceptibility of CRC by two common IL-17A genetic polymorphisms, including rs10484879 and rs3748067.

SNP rs10484879 in the IL-17A gene is located on the 3’-untranslated region (UTR) in chromosome 6 position 52187159. IL-17A gene rs10484879 has been extensively studied due to its potential association with different diseases in different ethnic populations. Previous studies with rs10484879 have been performed in various diseases, such as vulvovaginal candidiasis,51 hepatitis B virus infection,52 psoriasis,53 periodontal disease and peri-implantitis.54 The connection between IL-17A rs10484879 polymorphism and CRC susceptibility was studied for the first time in 2013.41 Bondurant and colleagues conducted a case-control study in Northern California and Utah to look at the effects of IL-17A gene rs10484879 polymorphism on the risk of colon tumor (total subjects = 3,511) and rectal cancer (total subjects = 1,713) utilizing the information from two population-dependent pilot studies. In that study, particularly for rs10484879, GT + TT combined genotype carrier was at .76-times more susceptibility for the progression of colon tumor than GG genotype carrier and it was statistically significant (ORs = .76; P-value .011). Then in 2018, Bedoui and colleagues40 further carried a case-control study on the Tunisian population to correlate the IL-17A gene rs10484879 polymorphism with CRC. The study included 293 CRC patients and 268 healthy controls who were recruited, matching age, sex, and BMI. The researchers demonstrated that the minor allele frequency in rs10484879 in CRC patients was considerably greater than in control subjects. Moreover, the minor allele of rs10484879 was associated with a previous family background of CRC and related malignancies (P = .002), CRC classification (P = .044), chemo reaction (P = .001), and therapy (P = .038). The study reported that, CT genotype and TT genotype carrier had 2.63- and 1.27-times more risk for CRC (CT vs. CC: OR = 2.63; P < .001 and TT vs. CC: OR = 1.27; P < .001). Again, dominant association model (OR = 2.43; P < .001) showed significantly elevated risk for CRC. In the present case-control study, our analysis also revealed that in case of rs10484879, additive model 1 (P = .0008), additive model 2 (P = .0133), dominant model (P = .0001), over-dominant model (P = .0035), and allelic model (P = .0001) showed the enhanced association for the development of CRC and all of the genetic models are statistically significant.

IL-17A gene rs3748067 polymorphism is located on the 3’-untranslated region (UTR) in chromosome 6 position 52190541. This SNP has been extensively studied due to its potential association with different diseases in different ethnic populations. Previous studies with r3748067 in various diseases are asthma,55 breast cancer,44 cervical cancer,56,57 CRC,40,58 congestive heart failure,59 coronary artery disease,60,61 gastric cancer,30,62 gastrointestinal diseases,63 rheumatoid arthritis,64 laryngeal cancer,65 lung cancer,66 otitis,67 pneumoconiosis,68 psoriasis,69 tuberculosis,70-72 ulcerative colitis,73 and viral myocarditis.74

The connection between IL-17A rs3748067 genetic variant and susceptibility of CRC has been studied for the first time in 2018.40 The study by Bedoui and colleagues evaluated the influences of IL-17A gene variants on the susceptibility of CRC by a pilot study on the Tunisian population. The study included 293 CRC patients and 268 healthy controls and examined the link of CRC susceptibility with six IL-17A polymorphisms (rs10484879, rs3819024, rs3748067, rs3819025, rs7747909, and rs2275913) in Tunisians. They showed that AG and AA genotype carrier was at .56-times and 2.42-times significant risk for the development of CRC (AG vs. GG: OR = .56; P = .003 and AA vs. GG: OR =2.42; P = .003). In terms of the dominant model and recessive model, the AG + AA genotype showed a significantly .67-times decreased risk for CRC susceptibility (AG + AA vs. GG: OR = .67; P = .04). In the recessive model, AA genotype carrier depicted 2.83-folds significantly elevated risk for CRC (AA vs. GG + AG: OR = 2.83; P = .04). However, no further studies evaluated the role of this polymorphism in other populations. To evaluate the effect of rs3748067 on CRC, we performed this study in our population. Our case-control study revealed that rs3748067 is associated with significantly increased CRC susceptibility under the additive model 1 (P = .0008), additive model 2 (P = .031), dominant model (P = .001), over-dominant model (P = .014), and allelic model (P = .0004) in the studied population.

It would be noteworthy to mention that we have performed this association study in Bangladesh for the first time. Before this, IL-17A rs10484879 had been studied in two countries, and rs3748067 had been studied in only one country. Notably, our results are compatible with the previously performed investigations, but further genotyping research in different ethnic populations is needed to confirm the link between this SNP and CRC susceptibility.

At the same time, there were some limitations in our study, which should be resolved in the upcoming studies. The number of participants involved in the study was comparatively low, which we thought was not large enough to represent the actual scenario of the country. Again, we could not find all the associated data of the patients, which may affect the risk. Moreover, we have selected only a known SNP from the public database. Furthermore, the interaction of this polymorphism with other modifiable risk factors has not been addressed. As a result, further studies need to be done to confirm these findings.

Conclusion

To summarize, our study highlights that IL-17A rs10484879 and rs3748067 polymorphisms may be associated with colorectal cancer development. However, further functional research with larger samples may reveal more statistically significant outcomes.

Acknowledgments

The authors would like to acknowledge the Department of Pharmacy, University of Asia Pacific for their full support during this study.

Footnotes

Author Contributions: Md. Robiul Islam: Sample collection, Investigation, Method validation, Writing- Original draft preparation;

Md. Abdul Aziz: Writing- Original draft preparation, Methodology, Data analysis, Software, Writing- Reviewing and Editing;

Mohammad Shahriar: Study design, data analysis and writing;

Mohammad Safiqul Islam: Conceptualization, Supervision, Writing- Reviewing and Editing.

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding: The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This research received a partial grant from the Department of Pharmacy, University of Asia Pacific.

Ethical Approval: Ethical permission was taken from the National Institute of Cancer Research and Hospital (NICRH), and Dhaka Ahsania Mission Cancer and General Hospital.

Data Availability: All data related to the manuscript are provided in the manuscript main file, figure, and tables. The corresponding author will provide additional information on a valid request if required.

ORCID iDs

Md. Abdul Aziz https://orcid.org/0000-0003-2079-4509

Mohammad Safiqul Islam https://orcid.org/0000-0003-4924-5319

References

  • 1.Xie YH, Chen YX, Fang JY. Comprehensive review of targeted therapy for colorectal cancer. Signal Transduct Targeted Ther. 2020;5:22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Keum N, Giovannucci E. Global burden of colorectal cancer: Emerging trends, risk factors and prevention strategies. Nat Rev Gastroenterol Hepatol. 2019;16:713-732. [DOI] [PubMed] [Google Scholar]
  • 3.Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A Cancer Journal for Clinicians 2021;71:209-249. [DOI] [PubMed] [Google Scholar]
  • 4.Botteri E, Borroni E, Sloan EK, Bagnardi V, Bosetti C, Peveri G. Smoking and colorectal cancer risk, overall and by molecular subtypes: A meta-analysis. Official Journal of the American College of Gastroenterology| ACG. 2020;115:1940-1949. [DOI] [PubMed] [Google Scholar]
  • 5.Murphy N, Moreno V, Hughes DJ, Vodicka L, Vodicka P, Aglago EK, et al. Lifestyle and dietary environmental factors in colorectal cancer susceptibility. Mol Aspect Med 2019;69:2-9. [DOI] [PubMed] [Google Scholar]
  • 6.Nakanishi Y, Diaz-Meco MT, Moscat J. Serrated colorectal cancer: The road less travelled. Trends in Cancer. 2019;5:742-754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Crockett SD, Nagtegaal ID. Terminology, molecular features, epidemiology, and management of serrated colorectal neoplasia. Gastroenterology. 2019;157:949-966. [DOI] [PubMed] [Google Scholar]
  • 8.Fairley TL, Cardinez CZ, Martin J. Colorectal cancer in US adults younger than 50 years of age. Cancer. 2006;107:1153-1161. [DOI] [PubMed] [Google Scholar]
  • 9.Ashktorab H, Ahuja S, Kannan L, Llor X, Ellis NA, Xicola RM. A meta-analysis of MSI frequency and race in colorectal cancer. Oncotarget. 2016;7:34546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.De Jong AE, Morreau H, Nagengast FM, Maths-Vliegen EM, Kleibeuker JH, Griffioen G, et al. Prevalence of adenomas among young individuals at average risk for colorectal cancer. Official journal of the American College of Gastroenterology| ACG 2005;100:139-143. [DOI] [PubMed] [Google Scholar]
  • 11.Chan AO, Lam KF, Tong T, Siu DC, Jim MH, Hui WM, et al. Coexistence between colorectal cancer/adenoma and coronary artery disease: Results from 1382 patients. Alimentary Pharmacology and Therapeutics 2006;24(3):535-539. [DOI] [PubMed] [Google Scholar]
  • 12.Gausman V, Dornblaser D, Anand S, Hayes RB, O’Connell K, Du M, et al. Risk factors associated with early-onset colorectal cancer. Clin Gastroenterol Hepatol 2020;18(12):2752-2759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Haggar FA, Boushey RP. Colorectal cancer epidemiology: Incidence, mortality, survival, and risk factors. Clin Colon Rectal Surg. 2009;22:191-197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Bouvard V, Loomis D, Guyton KZ, Grosse Y, El Ghissassi F, Benbrahim-Tallaa L. Carcinogenicity of consumption of red and processed meat. Lancet Oncol. 2015;16:1599-1600. [DOI] [PubMed] [Google Scholar]
  • 15.Tabung FK, Liu L, Wang W, Fung TT, Wu K, Smith-Warner SA. Association of dietary inflammatory potential with colorectal cancer risk in men and women. JAMA Oncol. 2018;4:366-373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Schmid D, Leitzmann MF. Television viewing and time spent sedentary in relation to cancer risk: A meta-analysis. JNCI: Journal of the National Cancer Institute. 2014;106:98. [DOI] [PubMed] [Google Scholar]
  • 17.Ruiz-Casado A, Martín-Ruiz A, Pérez LM, Provencio M, Fiuza-Luces C, Lucia A. Exercise and the hallmarks of cancer. Trends in Cancer. 2017;3:423-441. [DOI] [PubMed] [Google Scholar]
  • 18.Hamada T, Nowak JA, Masugi Y, Drew DA, Song M, Cao Y. Smoking and risk of colorectal cancer sub-classified by tumor-infiltrating T cells. JNCI. Journal of the National Cancer Institute. 2019;111:42-51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zisman AL, Nicolov A, Brand RE, Gorchow A, Roy HK. Associations between the age at diagnosis and location of colorectal cancer and the use of alcohol and tobacco: Implications for screening. Arch Intern Med. 2006;166:629-634. [DOI] [PubMed] [Google Scholar]
  • 20.Choi YJ, Myung SK, Lee JH. Light alcohol drinking and risk of cancer: A meta-analysis of cohort studies. Cancer Research and Treatment. Official Journal of Korean Cancer Association. 2018;50:474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Rossi M, Jahanzaib, Anwar M, Usman A, Keshavarzian A, Bishehsari F. Colorectal cancer and alcohol consumption—populations to molecules. Cancers. 2018;10:38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mármol I, Sánchez-de-Diego C, Pradilla Dieste A, Cerrada E, Rodriguez Yoldi MJ. Colorectal carcinoma: A general overview and future perspectives in colorectal cancer. Int J Mol Sci. 2017;18:197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Dong Y, Zhou J, Zhu Y, Luo L, He T, Hu H. Abdominal obesity and colorectal cancer risk: systematic review and meta-analysis of prospective studies. Biosci Rep. 2017;37:BSR20170945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ye P, Xi Y, Huang Z, Xu P. Linking obesity with colorectal cancer: Epidemiology and mechanistic insights. Cancers. 2020;12:1408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Liu PH, Wu K, Ng K, Zauber AG, Nguyen LH, Song M. Association of obesity with risk of early-onset colorectal cancer among women. JAMA Oncol. 2019;5:37-44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Jess T, Rungoe C, Peyrin–Biroulet L. Risk of colorectal cancer in patients with ulcerative colitis: A meta-analysis of population-based cohort studies. Clin Gastroenterol Hepatol. 2012;10:639-645. [DOI] [PubMed] [Google Scholar]
  • 27.Lutgens MW, van Oijen MG, van der Heijden GJ, Vleggaar FP, Siersema PD, Oldenburg B. Declining risk of colorectal cancer in inflammatory bowel disease: An updated meta-analysis of population-based cohort studies. Inflammatory Bowel Disease. 2013;19:789-799. [DOI] [PubMed] [Google Scholar]
  • 28.Nadeem MS, Kumar V, Al-Abbasi FA, Kamal MA, Anwar F. Risk of colorectal cancer in inflammatory bowel diseases. Semin Cancer Biol. 2020;64:51-60. [DOI] [PubMed] [Google Scholar]
  • 29.Karmokar PF, Shabnaz S, Aziz MA, Asaduzzaman M, Shahriar M, Bhuiyan MA, et al. Variants of SMAD1 gene increase the risk of colorectal cancer in the Bangladeshi population. Tumor Biol 2020;42:1010428320958955. [DOI] [PubMed] [Google Scholar]
  • 30.Tian J, Liu G, Zuo C, Liu C, He W, Chen H. Genetic polymorphisms and gastric cancer risk: A comprehensive review synopsis from meta-analysis and genome-wide association studies. Cancer Biology and Medicine. 2019;16:361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Omrane I, Marrakchi R, Baroudi O, Mezlini A, Ayari H, Medimegh I, et al. Significant association between interleukin-17A polymorphism and colorectal cancer. Tumor Biol 2014;35:6627-6632. [DOI] [PubMed] [Google Scholar]
  • 32.Afzali B, Lombardi G, Lechler RI, Lord GM. The role of T helper 17 (Th17) and regulatory T cells (Treg) in human organ transplantation and autoimmune disease. Clin Exp Immunol. 2007;148:32-46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL, Murphy KM, et al. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol 2005;6:1123-1132. [DOI] [PubMed] [Google Scholar]
  • 34.Harper EG, Guo C, Rizzo H, Lillis JV, Kurtz SE, Skorcheva I, et al. Th17 cytokines stimulate CCL20 expression in keratinocytes in vitro and in vivo: Implications for psoriasis pathogenesis. J Invest Dermatol 2009;129:2175-2183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Monteleone I, Sarra M, Pallone F, Monteleone G. Th17-related cytokines in inflammatory bowel diseases: Friends or foes? Curr Mol Med. 2012;12:592-597. [DOI] [PubMed] [Google Scholar]
  • 36.Garrett-Sinha LA, John S, Gaffen SL. IL-17 and the Th17 lineage in systemic lupus erythematous. Curr Opin Rheumatol. 2008;20:519-525. [DOI] [PubMed] [Google Scholar]
  • 37.Chesné J, Braza F, Mahay G, Brouard S, Aronica M, Magnan A. IL-17 in severe asthma. Where do we stand? Am J Respir Crit Care Med. 2014;190:1094-1101. [DOI] [PubMed] [Google Scholar]
  • 38.Shibata T, Tahara T, Hirata I, Arisawa T. Genetic polymorphism of interleukin-17A and-17F genes in gastric carcinogenesis. Hum Immunol. 2009;70:547-551. [DOI] [PubMed] [Google Scholar]
  • 39.Wu X, Zeng Z, Xu L, Yu J, Cao Q, Chen M, et al. Increased expression of IL17A in human gastric cancer and its potential roles in gastric carcinogenesis. Tumor Biol 2014;35:5347-5356. [DOI] [PubMed] [Google Scholar]
  • 40.Bedoui SA, Barbirou M, Stayoussef M, Dallel M, Mokrani A, Makni L, et al. Association of interleukin-17A polymorphisms with the risk of colorectal cancer: A case-control study. Cytokine 2018;110:18-23. [DOI] [PubMed] [Google Scholar]
  • 41.Bondurant KL, Lundgreen A, Herrick JS, Kadlubar S, Wolff RK, Slattery ML. Interleukin genes and associations with colon and rectal cancer risk and overall survival. Int J Cancer. 2013;132:905-915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Lv Q, Zhu D, Zhang J, Yi Y, Yang S, Zhang W. Association between six genetic variants of IL-17A and IL-17F and cervical cancer risk: A case-control study. Tumor Biol. 2015;365:3979-3984. [DOI] [PubMed] [Google Scholar]
  • 43.He X, Wang L, Riedel H, Wang K, Yang Y, Dinu CZ, et al. Mesothelin promotes epithelial-to-mesenchymal transition and tumorigenicity of human lung cancer and mesothelioma cells. Mol Cancer 2017;16:1-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Wang L, Jiang Y, Zhang Y, Wang Y, Huang S, Wang Z, et al. Association analysis of IL-17A and IL-17F polymorphisms in Chinese Han women with breast cancer. PLoS One 2012;7:e34400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Zhou B, Zhang P, Wang Y, Shi S, Zhang K, Liao H, et al. Interleukin-17 gene polymorphisms are associated with bladder cancer in a Chinese Han population. Mol Carcinog 2013;52:871-878. [DOI] [PubMed] [Google Scholar]
  • 46.Datta A, Zahora FT, Aziz MA, Uddin MS, Ferdous M, Millat MS, et al. Association study of IL10 gene polymorphisms (rs1800872 and rs1800896) with cervical cancer in the Bangladeshi women. Int Immunopharm 2020;89:107091. [DOI] [PubMed] [Google Scholar]
  • 47.von Elm E, Altman DG, Egger M, Pocock SJ, Gøtzsche PC, Vandenbroucke JP, et al. The strengthening the reporting of observational studies in epidemiology (STROBE) statement: Guidelines for reporting observational studies. Ann Intern Med 2007;147:573-577. [DOI] [PubMed] [Google Scholar]
  • 48.Aziz MA, Akter T, Hussain MS, Millat MS, Uddin MS, Sajal M, et al. Association of rs363598 and rs360932 polymorphisms with autism spectrum disorder in the Bangladeshi children. Meta Gene 2020;25:100733. [Google Scholar]
  • 49.Wacholder S, Chanock S, Garcia-Closas M, El Ghormli L, Rothman N. Assessing the probability that a positive report is false: An approach for molecular epidemiology studies. Journal of the National Cancer Institute. 2004;96(6):434-442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Zhuo Z, Lu H, Zhu J, Hua RX, Li Y, Yang Z, et al. METTL14 gene polymorphisms confer neuroblastoma susceptibility: An eight-center case-control study. Mol Ther Nucleic Acids 2020;14(22):17-26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Li W, Shi W, Yin Y, Chen J, Luo L. Association of IL-17 and IL-23 gene variants with plasma levels and risk of vulvovaginal candidiasis in a Chinese han population. Pharmacogenomics Personalized Med. 2020;13:725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Tayefinasrabadi H, Mohebbi SR, Hosseini SM, Azimzadeh P, Pourhoseingholi MA, Ghaemi A, et al. Association of Interleukin-17 gene polymorphisms with susceptibility to chronic hepatitis B virus infection and clearance in Iranian population. Microb Pathog 2020;144:104195. [DOI] [PubMed] [Google Scholar]
  • 53.Kaur R, Rawat AK, Kumar S, Aadil W, Akhtar T, Narang T, et al. Association of genetic polymorphism of interleukin-17A and interleukin-17F with susceptibility of psoriasis. Indian J Med Res. 2018;148:422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Kadkhodazadeh M, Baghani Z, Ebadian AR, Youssefi N, Mehdizadeh AR, Azimi N. IL-17 gene polymorphism is associated with chronic periodontitis and peri-implantitis in Iranian patients: A cross-sectional study. Immunol Invest. 2013;42:156-163. [DOI] [PubMed] [Google Scholar]
  • 55.Liang T, Xu YT, Zhang Y, Cai PC, Hu LH. Interleukin-17A and-17F single nucleotide polymorphisms associate with susceptibility of asthma in Chinese Han population. Hum Immunol. 2018;79:736-742. [DOI] [PubMed] [Google Scholar]
  • 56.de Moura EL, Dos Santos AC, da Silva DM, Dos Santos BB, Figueredo DD, Moura AW, et al. Association of polymorphisms in cytokine genes with susceptibility to precancerous lesions and cervical cancer: A systematic review with meta-analysis. Immunol Invest 2021;50:492-526. [DOI] [PubMed] [Google Scholar]
  • 57.Yang S, Li C, Li X, Huang X, Zhao Q, Liu D, et al. Relationship of IL-17A and IL-17F genetic variations to cervical cancer risk: A meta-analysis. Biomarkers Med 2017;11:459-471. [DOI] [PubMed] [Google Scholar]
  • 58.Bedoui S, Dallel M, Barbirou M, Stayoussef M, Mokrani A, Mezlini A, et al. Interleukin-17A polymorphisms predict the response and development of tolerance to FOLFOX chemotherapy in colorectal cancer treatment. Cancer Gene Ther 2020;27:311-318. [DOI] [PubMed] [Google Scholar]
  • 59.Sandip C, Tan L, Huang J, Li Q, Ni L, Cianflone K, et al. Common variants in IL-17A/IL-17RA axis contribute to predisposition to and progression of congestive heart failure. Medicine 2016;95:e4105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Su GB, Guo XL, Liu XC, Cui QT, Zhou CY. Association between interleukin-17A polymorphism and coronary artery disease susceptibility in the Chinese Han population. Genet Mol Res. 2016;15:15038235. [DOI] [PubMed] [Google Scholar]
  • 61.Bao MH, Luo HQ, Xiang J, Tang L, Dong LP, Li GY, et al. Meta-analysis for the association between polymorphisms in interleukin-17A and risk of coronary artery disease. Int J Environ Res Publ Health 2016;13:660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Elshazli RM, Salman DO, Kamel MM, Toraih EA, Fawzy MS. Genetic polymorphisms of IL-17A rs2275913, rs3748067 and IL-17F rs763780 in gastric cancer risk: evidence from 8124 cases and 9873 controls. Mol Biol Rep. 2018;45:1421-1444. [DOI] [PubMed] [Google Scholar]
  • 63.Jiang YX, Li GM, Yi D, Yu PW. A meta-analysis: The association between interleukin-17 pathway gene polymorphism and gastrointestinal diseases. Gene. 2015;572:243-251. [DOI] [PubMed] [Google Scholar]
  • 64.Bogunia-Kubik K, Świerkot J, Malak A, Wysoczańska B, Nowak B, Białowąs K. et al. IL-17A, IL-17F and IL-23R gene polymorphisms in polish patients with rheumatoid arthritis. Arch Immunol Ther Exp 2015;63:215-221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Si FZ, Feng YQ, Han M. Association between interleukin-17 gene polymorphisms and the risk of laryngeal cancer in a Chinese population. Genet Mol Res. 2017;16:16019076. doi: 10.4238/gmr16019076. [DOI] [PubMed] [Google Scholar]
  • 66.He Y, Du Y, Wei S, Shi J, Mei Z, Qian L, et al. IL‐17A and IL‐17F single nucleotide polymorphisms associated with lung cancer in Chinese population. The Clinical Respiratory Journal 2017;11:230-242. [DOI] [PubMed] [Google Scholar]
  • 67.Korppi M, Teräsjärvi J, Liehu-Martiskainen M, Lauhkonen E, Vuononvirta J, Nuolivirta K, et al. Haplotype of the Interleukin 17A gene is associated with osteitis after Bacillus Calmette-Guerin vaccination. Sci Rep 2017;7:1-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Han R, Ji X, Wu B, Wang T, Han L, Yang J, et al. Polymorphisms in interleukin 17A gene and coal workers’ pneumoconiosis risk in a Chinese population. BMC Pulm Med 2015;15:1-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.van Vugt LJ, van den Reek JM, Meulewaeter E, Hakobjan M, Heddes N, Traks T, et al. Response to IL-17A inhibitors secukinumab and ixekizumab cannot be explained by genetic variation in the protein-coding and untranslated regions of the IL-17A gene: results from a multicenter study of four European psoriasis cohorts. J Eur Acad Dermatol Venereol 2020;34:112-118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Yu ZG, Wang BZ, Li J, Ding ZL, Wang K. Association between interleukin-17 genetic polymorphisms and tuberculosis susceptibility: an updated meta-analysis. Int J Tubercul Lung Dis. 2017;21:1307-1313. [DOI] [PubMed] [Google Scholar]
  • 71.Wang M, Xu G, Lü L, Xu K, Chen Y, Pan H, et al. Genetic polymorphisms of IL-17A, IL-17F, TLR4 and mir-146a in association with the risk of pulmonary tuberculosis. Sci Rep 2016;6:1-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Zhao J, Wen C, Li M. Association analysis of interleukin-17 gene polymorphisms with the risk susceptibility to tuberculosis. Lung. 2016;194:459-467. [DOI] [PubMed] [Google Scholar]
  • 73.Li J, Tian H, Jiang HJ, Han B. Interleukin-17 snps and serum levels increase ulcerative colitis risk: A meta-analysis. World J Gastroenterol. 2014;20:15899-15909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Tang H, Pei H, Xia Q, Tang Y, Huang J, Huang J, et al. Role of gene polymorphisms/haplotypes and serum levels of interleukin-17A in susceptibility to viral myocarditis. Exp Mol Pathol 2018;104:140-145. [DOI] [PubMed] [Google Scholar]

Articles from Cancer Control : Journal of the Moffitt Cancer Center are provided here courtesy of SAGE Publications

RESOURCES