Functional Conservation of the Polysaccharide Biosynthetic Protein WbpM and Its Homologues in Pseudomonas aeruginosa and Other Medically Significant Bacteria

Abstract

WbpM is a highly conserved protein involved in synthesis of the O antigens of Pseudomonas aeruginosa. Homologues of this protein have been identified in a large number of bacteria, and they can be divided into two subfamilies: subfamily 1, including WbpM, contains large proteins (∼600 amino acids), while subfamily 2, typified by HP0840 (FlaA1) of Helicobacter pylori, contains smaller proteins (∼350 amino acids) homologous to the C termini of proteins in subfamily 1. Analysis of knockout mutants of wbpM in P. aeruginosa serotypes O3, O10, O15, and O17 showed that although all 20 serotypes of P. aeruginosa possess wbpM, it is not universally required for O-antigen biosynthesis. Homologous genes from Bordetella pertussis (wlbL), Staphylococcus aureus (cap8D), and H. pylori (flaA1) complemented a P. aeruginosa O5 wbpM mutant to various degrees. These conserved proteins may represent interesting targets for the design of inhibitors of bacterial exopolysaccharide biosynthesis.

Exopolysaccharides of pathogenic bacteria, including lipopolysaccharides (LPS), lipooligosaccharides, and capsules, play a major role in virulence (reviewed in references 9, 11, 29, and 32). We are interested in identifying enzymes that are conserved amongst various exopolysaccharide biosynthetic pathways in order to provide targets for the rational design of inhibitor molecules. WbpM was previously identified as being a highly conserved and essential protein for the biosynthesis of the O antigens of serotypes O5 and O6 of Pseudomonas aeruginosa, although these molecules have different sugar compositions (5, 7). A gapped BLASTP search (3) of the GenBank database revealed a large number of WbpM homologues in both gram-negative and gram-positive bacteria, as well as in the Archeae (Table 1). These homologues could be divided into two subfamilies. Subfamily 1, including WbpM, contains large (approximately 600 amino acids) proteins with two distinct domains, with an NAD⁺ or NADP⁺ binding motif in the C terminus, and often a second motif in the N terminus (7). The other subfamily, embodied by the product of the Helicobacter pylori HP0840 gene (FlaA1) (36), consists of smaller (between 300 and 400 amino acids) proteins that are homologous to the C-terminal half of the larger proteins in the other subfamily (7) (Table 1). Interestingly, some species of bacteria contain examples of both subfamilies. In the capsular biosynthestic clusters of Staphylococcus aureus serotypes 5 and 8, contiguous large (capD) and small (capE) wbpM homologues are present in the same operon (29, 30, 31), whereas S. aureus serotype 1 has only capD (21). P. aeruginosa serotype O11 has recently been shown to contain both WbpM and a subfamily 2 homologue, WbjB (10).

TABLE 1.

WbpM and its homologues from other bacteria

Subfamily and protein	Organism	Length (aa)c	% Similarity to WbpMO5d	Putative function	Accession no. (reference or source)
1a
WbpM	Pseudomonas aeruginosa serotype O5	665	100	Fuc2NAc biosynthesis	U50396 (7)
WbpMO6	Pseudomonas aeruginosa serotype O6	665	98	Fuc2NAc biosynthesis	AF035937 (5)
WbpMO11	Pseudomonas aeruginosa serotype O11	665	97	Fuc2NAc biosynthesis	U44089, AF147795 (10)
WbcP (TrsG)	Yersinia enterocolitica serotype O:3	638	65	Galactose modification	S51266 (34)
WlbL	Bordetella bronchiseptica	624	61	Nucleotide sugar dehydratase or epimerase	AJ007747 (direct submission)
WlbL (BplL)	Bordetella pertussis	624	61	FucNAcMe biosynthesis	S70683 (1)
WlaL, PglF	Campylobacter jejuni	590	52	Unknown; protein glycosylation	Y11648 (15), AF108897 (direct submission)
RfbV	Vibrio cholerae serotype O1	621	64	Unknown	Y07788 (13)
ORF22-30	Vibrio cholerae serotype O22	646	65	Unknown	AB012957 (direct submission)
ORF10	Vibrio cholerae serotype O139	646	66	Epimerase or dehydratase	U47057 (8)
CapD	Staphylococcus aureus serotype 1	599	59	Type 1 capsule synthesis	U10927 (22)
Cap5D	Staphylococcus aureus serotype 5	607	56	Unknown	U81973 (31)
Cap8D	Staphylococcus aureus serotype 8	607	56	Unknown	U73374 (29)
LpsB	Rhizobium etli	683	65	dTDP-glucose-4,6-dehydratase	U56723 (direct submission)
PglD	Neisseria meningitidis	636	61	Pilin glycosylation	AF014804 (direct submission)
WbiI	Burkholderia pseudomallei	637	54	Epimerase/dehydratase	AF0064070 (12)
TP0077	Treponema pallidum	538	55	Capsular polysaccharide biosynthesis protein	AE001192 (14)
TM1548	Thermotoga maritima	605	53	Unknown	AE001801 (26)
YveM	Bacillus subtilis	598	56	Unknown	Z99121 (20)
2b
WbjB	Pseudomonas aeruginosa	344	50	O-antigen biosynthesis	AF147795 (10)
HP0840 (FlaA1)	Helicobacter pylori strain 26695	333	52	Unknown	AE000595 (36)
JHP0778	Helicobacter pylori strain J99	333	51	Sugar nucleotide biosynthesis	AE001508 (2)
FlaA1	Caulobacter crescentus	331	51	Unknown	U27301 (direct submission)
Cap5E	Staphylococcus aureus serotype 5	342	50	Unknown	U81973 (31)
Cap8E	Staphylococcus aureus serotype 8	342	50	Unknown	U73374 (31)
Protein D	Methanococcus jannaschii	333	62	Capsular biosynthetic protein	U67549 (6)
CapD	Rickettsia prowazekii	341	51	Unknown	AJ235271 (4)
KasD	Streptomyces kasugaensis	329	42	NDP-hexose 4,6-dehydratase	AB005901 (18)
Gdh	Saccharopolyspora erythraea	329	42	dTDP-d-glucose-4,6-dehydratase	L37354 (23)
OrfJ06	Leptospira interrogans	336	51	Unknown	AF144879 (11)
OrfH10	Leptospira borgpetersenii	336	52	Unknown	AF078135 (11)

^aSubfamily 1 contains proteins of approximately 600 amino acids in length. 

^bSubfamily 2 contains proteins under 360 amino acids in length. 

^caa, amino acids. 

^dSimilarity was the sum of identical and conserved amino acids, as determined by nonfiltered Gapped BLASTP searches (3). The similarities of subfamily 1 are to WbpM_O5 in its entirety, while the similarities of subfamily 2 are to the 3′ half of WbpM_O5, from approximately amino acid 290 to the end. 

Although the specific function of these proteins has not yet been demonstrated at the biochemical level, they can be shown by complementation to be functionally homologous. The wbpM homologues from Bordetella pertussis strain BP536 (1), S. aureus serotype 8 (29), and H. pylori strain 26695 (36) were individually cloned into the broad-host-range vector, pUCP26 (37) (Table 2) and used to transform a P. aeruginosa O5 wbpM::Gm^r mutant, which cannot synthesize B-band LPS (7). Silver-stained sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western immunoblot analyses showed that the P. aeruginosa wbpM::Gm^r mutant was complemented for O-antigen production by wlbL from B. pertussis (1), cap8D of S. aureus (29), and, partially, by HP0840 of H. pylori (36) (Fig. 1). The ability of HP0840 to partly complement a wbpM mutation demonstrates that the subfamily 2 homologues have activities related to those of subfamily 1. These data support the hypothesis previously stated by members of our group (7) that the larger proteins may have arisen through a fusion between two contiguous open reading frames, with the carboxy-terminal region, corresponding to subfamily 2, containing the putative active site. Further characterization of the larger proteins will permit the identification of the minimum structure required for function in P. aeruginosa.

TABLE 2.

Bacterial strains and plasmids used in this study

Strain or plasmid	Genotype, phenotype, or propertiesa	Source and/or reference
Strains
P. aeruginosa
O3	Wild type, serotype reference strain, B-band positive	ATCC 33350 (24)
O3 wbpM::Gmr	wbpM knockout mutant, B-band negative	This study
O10	Wild type, serotype reference strain, B-band positive	ATCC 33357 (24)
O10 wbpM::Gmr	wbpM knockout mutant, B-band negative	This study
O15	Wild type, serotype reference strain, B-band positive	ATCC 33362 (24)
O15 wbpM::Gmr	wbpM knockout mutant, B-band positive	This study
O17	Wild type, serotype reference strain, B-band positive	ATCC 33364 (24)
O17 wbpM::Gmr	wbpM knockout mutant, B-band positive	This study
E. coli
JM109	recA1 supE44 endA1 hsdR17 gyrA96 relA1 thi Δlac-proAB F′[tra D36 proAB+ lacIqlacZΔM15]; used as host strain for recombinant plasmids	38
SM10	thi-1 thr leu tonA lacY supE recA RP4-2-Tcr::Mu, Kmr; mobilizes plasmids into P. aeruginosa strains via conjugation	34
Plasmids
pUCP26	4.9-kb pUC18-based broad-host-range vector; Tcr	37
pCRII-TOPO	T/A topoisomerase PCR cloning vector	Invitrogen
pFV163-26	pUCP26 containing wbpMO5 on a 3.6-kb XbaI-SalI fragment from pFV115 (Burrows et al. [7])	This study
pCAPCD-26	pUCP26 containing the S. aureus cap8CD genes on a 4.0-kb SalI-PstI fragment from pCL7815 (Sau and Lee [29])	This study
pWLBL-26	B. pertussis wlbL gene amplified by PCR from a pLAFR1 clone containing the entire B. pertussis band A coding region (Allen and Maskell [1]) using primers with the following sequences: upstream, 5′ GCC CCG TCC CGT CCA GCC GC 3′; and downstream, 5′ CAT CGA CCC CAC CAA GGC ATC 3′, and then cloned into pCRII-TOPO and subcloned as a 2.1-kb BamHI-XbaI fragment into pUCP26	This study
pHP0840-26	pUCP26 containing the H. pylori 26695 ORF HP0840 gene (encodes putative protein FlaA1) subcloned as a 1.3-kb BamHI-SstI fragment from pUC18; the DNA fragment containing HP0840 was purchased from the ATCC/TIGR collection	This study
pEX18Ap	pEX100T-based suicide construct containing bla and sacB	17
pUCGM	Source of gentamicin resistance cassette; Apr, Gmr	33
pFV169-18Ap	pEX18Ap containing wbpMO5 on a 2.3-kb XbaI-HindIII fragment, with an ∼1-kb nonpolar gentamicin cassette (excised from pUCGM with SalI) inserted at a unique XhoI site with wbpM	This study

^aATCC, American Type Culture Collection; TIGR, The Institute for Genomic Research. 

FIG. 1.

Complementation of a serotype O5 B-band-deficient mutant. Plasmids (see Table 2) containing wbpM or its homologues from S. aureus serotype 8 (capD), H. pylori 26695 (HP0840) and B. pertussis (wlbL) were used to complement a wbpM::Gm^r mutant of P. aeruginosa PAO1 (7). B-band LPS prepared by the proteinase K digestion method of Hitchcock and Brown (15) was separated on SDS-PAGE, transferred to nitrocellulose, and detected using monoclonal antibody 18-19, which recognizes the O5 O unit (18). The fastest-migrating band represents the core plus one O unit, the most abundant species.

All 20 serotypes of P. aeruginosa contain wbpM, despite the fact that they produce structurally distinct O antigens (7, 25). Therefore, it was of interest to understand the role of WbpM in O-antigen synthesis in P. aeruginosa and to determine whether it is essential in serotypes other than O5 and O6 (5, 7). Members of our group proposed previously (7) that WbpM could be a C4 epimerase required for the conversion of UDP-N-acetyl-d-glucosamine (UDP-d-GlcNAc) to UDP-N-acetyl-d-galactosamine (UDP-d-GalNAc). However, results from studies on the biosynthesis of the UDP-d-GalNAc residues required for serotype O6 O-antigen synthesis showed that among the proteins encoded by the O-antigen biosynthesis genes, WbpP, and not WbpM, is the C4 epimerase involved in conversion of UDP-d-GlcNAc to UDP-d-GalNAc (5). Instead, WbpM is likely involved in the formation of the 6-deoxyaminohexose UDP-N-acetyl-d-quinovosamine (UDP–d-QuiNAc) (or UDP-6-deoxy-d-GlcNAc) residues of the serotype O6 O antigen. In serotype O5, the UDP-d-QuiNAc product of WbpM activity could be epimerized at C4 to form UDP-N-acetyl-d-fucosamine (UDP-d-Fuc2NAc) (or UDP-6-deoxy-d-GalNAc) by the UDP-galactose-4-epimerase (GalE) homologue, WbpK. This hypothesis is supported by the observation that WbpK is able to partly complement a Salmonella enterica serovar Typhimurium galE mutant (M. Matewish, H. L. Rocchetta, L. L. Burrows, R. Rahim, K. Pigeon, and J. S. Lam, Abstr. 60th N. Am. Cyst. Fibros. Meet., abstr. 374, 1998), suggesting it possesses C4 epimerase activity.

To further investigate the role of WbpM in synthesis of P. aeruginosa O antigens containing d-QuiNAc and its derivatives, we generated nonpolar chromosomal wbpM::Gm^r mutations, using previously described methodology (7), in serotypes O3, O10, O15, and O17. These serotypes have primary O-antigen structures that are distinct from those of serotypes O5 and O6 (Table 3). The O antigen of serotype O10 contains d-QuiNAc, while serotype O3 contains a d-QuiNAc derivative, bacillosamine (4-amino-d-QuiNAc; shown in bold in Table 3). In contrast, the O antigens of O15 and O17 contain neither d-QuiNAc nor d-FucNAc. Briefly, a gentamicin-resistance cassette containing its own promoter sequence was inserted within a unique XhoI site approximately in the middle of the 1.9-kb wbpM gene of serotype O5, and the mutated gene was introduced first into the chromosome of serotype O5 to demonstrate that the mutation abrogated O-antigen synthesis (data not shown). The wbpM::Gm^r construct was then introduced in the chromosomes of serotypes O3, O10, O15, and O17 by homologous recombination. To demonstrate the correct replacement of wild-type wbpM with the knockout construct, PCR using wbpM-specific primers flanking the XhoI site was performed. Upon agarose gel analysis, amplicons from the mutants were approximately 1 kb larger than those of the parental serotype strains, corresponding to the size of the Gm^r cassette (Fig. 2A). Silver-stained SDS-PAGE analysis of LPS from the O3, O10, O15, and O17 parent strains and their isogenic wbpM mutants showed that synthesis of the serotype O3 and O10 O antigens containing 4-amino-d-QuiNAc {4-amino-2,4,6-trideoxy-N-acetylglucosamine [Bac(2NAc4N)]} and d-QuiNAc, respectively (Table 3), was abrogated by the loss of WbpM (Fig. 2B). The deficiency in B-band O-antigen production was restored in the serotype O3 and O10 wbpM::Gm^r mutants by complementation with the wbpM_O5 gene in trans (Fig. 2B). In contrast, synthesis of the serotype O15 and O17 O antigens that contain neither d-QuiNAc nor d-Fuc2NAc was not affected by the wbpM mutation (Fig. 2B). These data are consistent with our previous results (5, 7) showing wbpM is essential for the synthesis of the serotype O6 and O5 O antigens, containing d-QuiNAc and its C4 epimer d-FucNAc, respectively.

TABLE 3.

P. aeruginosa O-antigen structures

P. aeruginosa IATS serotypea	O antigen structureb
O3c	[-6)-α-d-GlcNAc-(1-4)-α-l-GalNAcA-(1-3)-β-d-Bac(2NAc4N)-(1-2)-α-l-Rha-(1-]
	4 |
	(S)-CH3CH(OH)CH2CO
O5	[-4)-β-d-Man(2NAc3N)A-(1-4)-β-d-Man(2NAc3NAc)A-(1-3)-α-d-FucNAc-(1-]
	3|
	CH3C⩵NH
O6	[3)-α-l-Rha-(1-4)-α-d-GalNAcA-(1-4)-α-d-GalNFmA-(1-3)-α-d-QuiNAc-(1-]
	3 |   6|
	OAc  NH2
O10	[-3)-α-l-Rha-(1-4)-α-l-GalNAcA-(1-3)-α-d-QuiNAc-(1-]
O15	[-4)-α-d-GalNAc-(1-2)-β-d-Ribf-(1-]
O17	[-3)-β-d-ManNAc-(1-4)-α-l-Rha-(1-]

^aIATS, International Antigenic Typing Scheme (23). 

^bBased on reference 19. Abbreviations: Bac(2NAc4N), 4-amino-2,4,6-trideoxy-N-acetylglucosamine; FucNAc, 6-deoxy-N-acetylgalactosamine; GalNAcA, N-acetylgalactosaminuronic acid; GalNFmA, N-formylgalactosaminuronic acid; GlcNAc, N-acetylglucosamine; Man(2NAc3NAc)A, 2,3-dideoxy-2,3-di-N-acetylmannosaminuronic acid; QuiNAc, 6-deoxy-N-acetylglucosamine; Rha, rhamnose; Ribf, ribofuranose. 

^cThe Bac(2NAc4N) residue in the serotype O3 O antigen is substituted with an (S)-3-hydroxybutyryl group. 

FIG. 2.

Analysis of wbpM::Gm^r mutants of selected P. aeruginosa serotype strains. (A) Correct insertion of the gentamicin resistance cassette within wbpM was ascertained by PCR using the wbpM-specific primers flanking the unique XhoI site (upstream primer, 5′ AGGGTGGCTATCTATGGCGCGGGG 3′; downstream primer, 5′ AACGGGTGATGCTCGGGTGGGTGA 3′). The mutants showed a shift in the size of the amplicon of approximately 1 kb, corresponding to the size of the Gm^r cassette. (B) LPS prepared from selected serotype strains, their wbpM::Gm^r mutants, and their complemented mutants was analyzed by silver-stained SDS-PAGE. Mutants lacking B-band O antigen were complemented with the serotype O5 wbpM gene on pFV163-26. It is not clear why the O17 wbpM mutant produces somewhat less B-band LPS than the wild-type strain, but the banding pattern is very similar and its O antigen is genuine O17 as determined by slide agglutination with O17-specific antiserum (data not shown).

In summary, we have shown that WbpM is a member of a large and growing family of functionally homologous proteins that are involved in synthesis of exopolysaccharides in both gram-positive and gram-negative bacteria. WbpM is thought to play a role in the synthesis of the deoxyhexose, UDP-d-QuiNAc, and its derivatives, including UDP-d-Bac(2NAc4N) and UDP-d-FucNAc. Work is underway in our laboratory to provide biochemical evidence for the role of WbpM in the biosynthesis of these unusual sugars. Since homologues of WbpM occur in a number of medically significant bacteria, these proteins may be of interest as therapeutic targets.