Abstract
Coronavirus disease 2019 (COVID-19), caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has affected more than 600 million people worldwide. Several organs including lung, intestine, and brain are infected by SARS-CoV-2. It has been reported that SARS-CoV-2 receptor angiotensin-converting enzyme-2 (ACE2) is expressed in human testis. However, whether testis is also affected by SARS-CoV-2 is still unclear. In this study, we generate a human ACE2 (hACE2) transgenic mouse model in which the expression of hACE2 gene is regulated by hACE2 promoter. Sertoli and Leydig cells from hACE2 transgenic mice can be infected by SARS-CoV-2 pseudovirus in vitro, and severe pathological changes are observed after injecting the SARS-CoV-2 pseudovirus into the seminiferous tubules. Further studies reveal that Sertoli and Leydig cells from hACE2 transgenic mice are also infected by authentic SARS-CoV-2 virus in vitro. After testis interstitium injection, authentic SARS-CoV-2 viruses are first disseminated to the interstitial cells, and then detected inside the seminiferous tubules which in turn cause germ cell loss and disruption of seminiferous tubules. Our study demonstrates that testis is most likely a target of SARS-CoV-2 virus. Attention should be paid to the reproductive function in SARS-CoV-2 patients.
Keywords: SARS-CoV-2, ACE2, Sertoli cell, Leydig cell, Testis
Introduction
Coronavirus disease 2019 (COVID-19), caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has been declared as a global pandemic by the World Health Organization (WHO) (Li et al., 2020a, 2020b, 2020c; Zhu et al., 2020). SARS-CoV-2, as well as its close homolog SARS-CoV, which belongs to the Betacoronavirus genus, is a positive-sense single-stranded RNA virus of ∼26–32 kilobases in length (Zhou et al., 2020). SARS-CoV-2 contains four main structural proteins: spike glycoprotein (S), envelope protein, membrane protein, and nucleocapsid protein (N) (Lu et al., 2020). Spike protein, a surface protein forming a characteristic crown on virion, is indispensable for viral binding and fusion. S proteins of SARS-CoV and SARS-CoV-2 share high sequence similarity and interact with the same cellular receptor, angiotensin-converting enzyme 2 (ACE2), to enter the host cells (Hoffmann et al., 2020).
The transmission of SARS-CoV-2 from person to person mostly occurs following respiratory droplet exposure. At present, SARS-CoV-2 has been detected in respiratory fluids, saliva, blood, urine, and feces (Peng et al., 2020; Wang et al., 2020). Besides type II alveolar epithelial cells (AT2) in lungs, ACE2 is also expressed in many other organs, such as heart, kidney, intestine, liver, and testis (Clarke and Turner. 2012; Younis et al., 2020). In human testis, ACE2 is shown to be expressed in spermatogonia, Leydig and Sertoli cells, suggesting that testis is also a potential target organ of SARS-CoV-2 infection (Douglas et al., 2004; Wang and Xu. 2020). However, the studies about the effect of SARS-CoV-2 infection on male fertility are very limited. There are several studies about whether SARS-CoV-2 is present in the semen of COVID-19 patients, but the results are controversial. Most of the studies do not detect the virus in semen samples (Holtmann et al., 2020; Kayaaslan et al., 2020; Pan et al., 2020; Paoli et al., 2020; Rawlings et al., 2020; Song et al., 2020; Guo et al., 2021; Ma et al., 2021). Only one study reports that SARS-CoV-2 virus are detected in six semen samples of totally thirty-eight COVID-19 patients, two samples from recovery stage, and four from acute infected stage (Li et al., 2020a, 2020b, 2020c). Among these patients, scrotal discomfort, altered semen parameters and hormone production, and spermatozoa with increased DNA fragmentation are noted. Testis injury, including reduced Leydig cells, swelling and vacuolated Sertoli cells, and inflammatory infiltration are observed in COVID-19 patients by postmortem examination (Yang et al., 2020), suggesting that SARS-CoV-2 infection has obvious adverse effects on spermatogenesis and male fertility, independent of the presence of virus in semen (Gonzalez et al., 2020; Omolaoye et al., 2021). How these adverse effects are exerted is largely unknown.
Animal models are invaluable for studying the transmission and pathogenesis of SARS-CoV-2 and for the evaluation of vaccines and antivirals. Because of the relative low conservation of ACE2 protein between human and mouse, mouse ACE2 can not effectively support the infection of SARS-CoV-2. To study the pathogenesis of SARS-CoV-2 infection, several hACE2 knock-in and transgenic mouse models were generated previously (Bao et al., 2020; Jiang et al., 2020; Sun et al., 2020). In these mouse models, the expression of hAce2 gene is under the control of mouse Ace2 promoter, tissue-specific promoter, or other ubiquitous expression promoters (Bao et al., 2020; Jiang et al., 2020; Sun et al., 2020). The expression of hACE2 protein is detected in lung and interstitial pneumonia is observed after intranasally infected with live SARS-CoV-2. However, the expression pattern of ACE2 and the SARS-CoV-2 susceptibility, as well as the SARS-CoV-2-induced pathology in testis are largely unknown. In this study, we generated a transgenic mouse model in which the expression of hACE2 is under the control of hACE2 promoter. We found that hACE2 was expressed in testis and other organs including lung, intestine, and heart, etc. Seminiferous tubule injection of VSV-based SARS-CoV-2 pseudovirus (rVSV-SARS-CoV-2) resulted in severe pathological changes and disruption of seminiferous tubules in testis. In vitro studies showed that Leydig cells and Sertoli cells could be infected by both SARS-CoV-2 pseudovirus and authentic SARS-CoV-2 virus. We also found that authentic SARS-CoV-2 virus first damaged the Leydig cells after being injected into testis interstitium, and then the expression of viral protein was detected in the seminiferous tubules which in turn caused germ cell loss and disruption of seminiferous tubules.
Results
Generation of hACE2 transgenic mice
As shown in the schematic diagram of hACE2 transgenic construct in Fig. 1 A, the expression of hACE2 gene was under the control of hACE2 promoter. hACE2 transgenic mice were generated by pronuclear microinjection. PCR genotyping of hACE2 transgenic mouse was shown in Fig. 1B. The expression of hACE2 protein was detected in multiple organs, including heart, intestine, liver, lung, spleen, and brain (Fig. 1C–O). High level of hACE2 protein was also detected in testes (Fig. 1C). Immunohistochemistry analysis showed hACE2 was mainly expressed in alveolar epithelial cells of lung (Fig. 1E). In testis, hACE2 was expressed in Leydig cells, spermatogenic cells, and Sertoli cells (Fig. 1G).
Fig. 1.
Generation of hACE2 transgenic mouse model. A: Schematic diagram of hACE2 transgenic construct. B: PCR genotyping of hACE2 transgenic mouse. C: Western blot analysis of hACE2 protein expression in different tissues. D–O: Immunohistochemistry analysis of hACE2 protein expression in lung (D and E), testis (F and G), heart (H and I), liver (J and K), brain (L and M) and spleen (N and O) of wildtype and hACE2 transgenic mice.
The testes of hACE2 transgenic mice were infected by rVSV-SARS-CoV-2 pseudovirus
To determine whether the testis of our hACE2 mouse model is susceptible to SARS-CoV-2 infection, we used a replication-competent SARS-CoV-2 pseudotype-rVSV-SARS-CoV-2 with a luciferase reporter (rVSV-luciferase-SARS-CoV-2) or an eGFP reporter (rVSV-eGFP-SARS-CoV-2). rVSV-SARS-CoV-2 encoded the SARS-CoV-2 spike in place of the original glycoprotein in VSV backbone which served as a powerful tool to study cell tropism (Li et al., 2020a, 2020b, 2020c). The rVSV-luciferase-SARS-CoV-2 was microinjected into the seminiferous tubules of the testes in wildtype and hACE2 transgenic mice. The mice were analyzed for luminescence 24 h later using IVIS Spectrum. Strong luminescence signal was detected in the testes of hACE2 mice with pseudovirus injection, but no signal was detected in wildtype testes (Fig. 2 A). We further analyzed the histology of the testes at 3 and 18 days postinfection (Figs. 2B–2Q, S1A–S1H). In wildtype mice, no obvious histological change was noted in the testes (Figs. 2C, 2G, 2K, 2O, S1B, S1F). In hACE2 transgenic mice, numerous large vacuoles were observed in the seminiferous tubules at 3 days postinfection (Figs. 2E and S1D, arrowheads). On day 18, massive germ cell loss was noted in the testes of hACE2 transgenic mice (Figs. 2M and S1H, asterisks). A large number of CD3-positive inflammatory cells were also observed in the interstitium and seminiferous tubules of pseudovirus injected hACE2 transgenic mice (Fig. 2Q, arrows). These results indicated that the testis of hACE2 mice was susceptible to SARS-CoV-2 through the receptor hACE2.
Fig. 2.
The testis of hACE2 transgenic mice was susceptible to rVSV-SARS-CoV-2 infection. A: Accumulation of the virus in testis was observed in hACE2 transgenic mice (arrows), but not in wildtype mice at 24 h after seminiferous tubules injection of rVSV-luciferase-SARS-CoV-2 as measured by luminescence. B–Q: The expression of MVH and CD3 in the testes of wildtype and hACE2 transgenic mice was examined by immunohistochemistry. MVH was specifically expressed in germ cells (B–E, J–M, arrows), large vacuoles were observed in the seminiferous tubules at D3 (E, arrowheads) and massive germ cells loss was observed at D18 after injection in hACE2 transgenic mice (Q, asterisks). There were no CD3-positive T lymphocytes in wildtype mice with (G and O) or without infection (F and N). A large number of CD3-positive T lymphocytes were detected in testes of hACE2 mice at D18 after injection (Q, arrows). Scale bar, 100 μm.
To test the cellular tropism of SARS-CoV-2 in the testis, Leydig cells and Sertoli cells were isolated from wildtype and hACE2 mice, cultured in vitro and subjected to rVSV- eGFP-SARS-CoV-2 (Li et al., 2020a, Li et al., 2020b, Li et al., 2020c). Infectivity was quantified by counting GFP positive cells. Both Sertoli and Leydig cells from hACE2 transgenic mice showed susceptibility to rVSV-eGFP-SARS-CoV-2 (Figs. S2–S4). In contrast, no GFP signal was noted in Sertoli and Leydig cells from wildtype mice (Figs. S2–S4). These results indictaed that Sertoli and Leydig cells from hACE2 transgenic mice were the SARS-CoV-2 susceptible cells in the testis.
hACE2 transgenic mice were susceptible to authentic SARS-CoV-2 virus infection
The susceptibility of SARS-CoV-2 in the hACE2 transgenic mice was further valuated by authentic SARS-CoV-2. hACE2 transgenic mice were intranasally infected with authentic SARS-CoV-2. The viral RNA in lung and testis was analyzed by quantitative reverse transcription PCR (qRT-PCR) at 3, 6, and 9 days postinfection. As shown in Fig. 3 A, SARS-CoV-2 RNA could be detected in lungs and testes of hACE2 mice at 3, 6 and 9 days postinfection. No viral RNA was found in control group. The histology of lungs and testes of hACE2 mice was further analyzed with Hematoxylin and eosin (H&E) staining (Fig. 3B–3E). At 6 days postinfection, infiltration of immune cells and thickened alveolar walls were found in lungs of hACE2 mice (Fig. 3C, arrows). However, no obvious change could be observed in testes after SARS-CoV-2 infection (Fig. 3E). The structure of seminiferous tubules was intact and there was no infiltration of inflammatory cells. These results indicated that the lung of hACE2 mice model was susceptible for SARS-CoV-2 infection, but the infection via intranasal route did not cause evident pathological changes in testes. Nucleoprotein (N) expression of SARS-CoV-2 in lung and testis was also analyzed (Fig. 3F–3I). The results showed that nucleoprotein could be detected in lung (Fig. 3G, arrows), but not in testes (Fig. 3I) of hACE2 mice after infection.
Fig. 3.
Effect of SARS-CoV-2 virus infection intranasally on lung and testis of hACE2 mice. A: Real-time RT-PCR analysis of viral RNA in lungs and testes. hACE2 mice were intranasally inoculated with live SARS-CoV-2 or PBS. At 3, 6, and 9 days after inoculation, the viral RNA in lungs and testes was extracted and analyzed using RT-qPCR. Viral burden was expressed on a log10 scale as viral RNA copies per g after comparison with a standard curve. B–E: Hematoxylin and eosin (H&E) staining of lungs and testes in hACE2 mice at 6 days after inoculation. F–I: Immunohistochemistry analysis of nucleoprotein of SARS-CoV-2 in lungs and testes in hACE2 mice at 6 days after inoculation. Nucleoprotein expression was evident in lungs (G, arrows), but it could not be detected in testes of hACE2 mice (I). Scale bars, 100 μm (B–E, H, I); 50 μm (F, G).
Thus, we try to infect the testis by direct injection of the authentic SARS-CoV-2 virus into the testis interstitium. The histology of the testes at 3 days and 6 days postinjection was analyzed and shown in Figs. 4 and S5. At D3 after virus injection, the nucleoprotein of SARS-CoV-2 was detected in most testicular interstitial cells of hACE2 mice (Fig. 4 D, arrows), but not in wildtype mice (Fig. 4B). However, no infection was observed in the seminiferous tubules and the structure of seminiferous tubules was not affected in hACE2 mice at D3 postinjection (Figs. 4H and S5D). At D6, most virus in the interstitium was eliminated. On the contrary, the N protein was detected in the seminiferous tubules of hACE2 mice (Fig. 4L, asterisk). The dissemination of virus from interstitium to the surrounding seminiferous tubules was observed in some areas of testes in hACE2 mice (Fig. 4L, arrows). The infection resulted in infiltration of inflammatory cells in the seminiferous tubules and the interstitium (Fig. S5L, arrows, CD3+). We also found that a large number of seminiferous tubules were disrupted with massive germ cell loss in hACE2 mice at D6 after virus injection (Figs. 4P, S5H, S5L, asterisks). These results indicated that the interstitium of the testis could be infected by SARS-CoV-2 virus and the virus further disseminated from interstitium to the seminiferous tubules which in turn led to the disruption of seminiferous tubules.
Fig. 4.
The testis of hACE2 transgenic mice was susceptible to live SARS-CoV-2 infection. A–P: Immunohistochemistry analysis of MVH and Nucleoprotein of SARS-CoV-2 at D3 (A–H) and D6 (I–P) in testes after SARS-CoV-2 was injected into the testes interstitium of wildtype and hACE2 mice. Nucleoprotein of the virus was detected in the interstitial cells of testes in hACE2 mice (D, arrows), not in wildtype mice (B) at D3 after injection. At D6, most Nucleoprotein signal in the interstitium disappeared, instead, Nucleoprotein was observed in some seminiferous tubules (L, asterisk) in hACE2 mice. The invasion of the SARS-CoV-2 from interstitium to the surrounding seminiferous tubules was also observed (L, arrows). The infection caused germ cell loss from the seminiferous tubules (P, asterisks). Scale bar, 100 μm.
Fig. 5.
Leydig cells and Sertoli cells of hACE2 transgenic mice were susceptible to live SARS-CoV-2 infection. Primary Leydig and Sertoli cells were isolated from the testes of wildtype and hACE2 transgenic mice and infected with live SARS-CoV-2. Nucleoprotein and 3β-HSD (A–C), Nucleoprotein and SOX9 (D–F) double staining experiments were performed. In wildtype cells, 3β-HSD was expressed in cytoplasm of Leydig cells (A, red) and SOX9 was expressed in nuleus of Sertoli cells (D, red). No Nucleoprotein of SARS-CoV-2 was detected in wildtype cells after infection (A and D) and cells from hACE2 transgenic mice without infection (B and E). Nucleoprotein/3β-HSD, Nucleoprotein/SOX9 double-positive cells were evident in Leydig cells (C, arrows) and Sertoli cells (F, arrows) from hACE2 mice after incubation with SARS-CoV-2. Nuclei were stained blue with DAPI. Scale bar, 50 μm.
Sertoli cells and Leydig cells were further isolated from wildtype and hACE2 mice and incubated with SARS-CoV-2 virus. After incubation for 24 h, Leydig cells and Sertoli cells were fixed and processed for immunofluorescence analysis. SARS-CoV-2 Nucleoprotein/3β-HSD double staining for Leydig cells and SARS-CoV-2 Nucleoprotein/SOX9 for Sertoli cells was shown in Fig. 5 A–5F. Nucleoprotein/3β-HSD and Nucleoprotein/SOX9 double-positive cells were observed in Leydig cells (Fig. 5C, arrows) and Sertoli cells (Fig. 5F, arrows) from hACE2 mice respectively. In contrast, no Nucleoprotein signal (green) was detected in 3β-HSD-positive Leydig cells (Fig. 5A) and SOX9-positive Sertoli cells (Fig. 5D) from wildtype mice.
Discussion
Several mouse models expressing hACE2 have been generated to study the pathogenesis and therapeutics of SARS-CoV-2, including transgenic, knock-in, and adenovirus-transduced mouse models (Munoz-Fontela et al., 2020; Rathnasinghe et al., 2020). There are several types of transgenic mouse models, in which the expression of hACE2 is under the control of different promoters, such as cytokeratin epithelial cell promoter (K18), synthetic CAG composite promoter, lung ciliated epithelial cell promoter (HFH4), and human ACE2 promoter (Munoz-Fontela et al., 2020; Rathnasinghe et al., 2020). Whether hACE2 is expressed in the testis of these mice models is not clear. In human, ACE2 is reported to be expressed in spermatogonia, Leydig and Sertoli cells of testis, suggesting the testis is a potential target of SARS-CoV-2 infection (Wang and Xu, 2020). To mimic the expression pattern of ACE2 in human, we generated a mouse model in which the expression of human ACE2 cDNA was under the control of the promoter of human ACE2 gene. In this model, ACE2 protein was expressed in lung, intestine, and brain which was consistent with other mouse models. Most importantly, ACE2 protein was also detected in testes.
In this study, we found that in vitro cultured Sertoli cells and Leydig cells could be infected by both pseudotyped and authentic SARS-CoV-2 virus, suggesting that these cells could be the targets of SARS-CoV-2 infection in vivo. The expression of N proteins was first detected in Leydig cells after interstitial injection of authentic SARS-CoV-2 virus, and the viruses further spread into seminiferous tubules, suggesting that SARS-CoV-2 virus can break through the blood-testis barrier (BTB) and enter the seminiferous tubules. BTB is one of the tightest blood-tissue barriers formed by cell junctions between adjacent Sertoli cells. BTB provides a physical and immunoprivileged microenvironment for germ cell development which sequesters germ cells in the adluminal compartment from harmful toxicants and against the body's immune system. It has been reported that several viruses can penetrate the barriers and induce testicular dysfunctions, such as Mumps, HIV, Zika, and Ebola (Seymen. 2021).
A recent study using hamster found intranasal SARS-CoV-2 challenge caused testicular damage and N protein of SARS-CoV-2 could be detected in testes, although viral loads and N protein expression were markedly lower in testis than lung (Li et al., 2022). Another study detected SARS-CoV-2 RNA in testes but histopathological changes was not found after infecting hamsters intranasally (Campos et al., 2021). In our study, although virus RNA was detected in testes of hACE2 mice after intranasal exposure of SARS-CoV-2 virus, no pathological change was observed and N protein of SARS-CoV-2 virus was not detected in testes, suggesting the amount of virus in testes after intranasal exposure is very few which could not cause pathological changes in testis. We noticed that although infiltration of immune cells was observed in lung of hACE2 mice after intranasal infection, the pathological change in this mouse model was not as severe as previously reported (Bao et al., 2020; Jiang et al., 2020). We speculated that the infection of testes was secondary to the infection of lung. The infection of testes probably needs high viral load in blood. Higher viral load is reported to be associated with more severe disease symptoms (Moshrefi et al., 2021). The expression level of hACE2 is probably another factor that determines whether the testes could be infected and the degree of damage with intranasal exposure of SARS-CoV-2.
Although most studies report the absence of SARS-CoV-2 in semen of COVID-19 patients, it is evident that there is testis injury such as scrotal discomfort, altered semen parameters, and hormone production in many patients (Gonzalez et al., 2020; Yang et al., 2020; Omolaoye et al., 2021). Pathological findings such as injury in seminiferous tubules and Leydig cells, and lymphocyte inflammation are also observed in autopsy samples (Yang et al., 2020). How SARS-CoV-2 affects testes? The indirect effect after infection such as fever and drugs (corticosteroids) may cause testicular damage (Sheikhzadeh Hesari et al., 2021). The direct effect mediated through the binding of the spike protein of SARS-CoV-2 with hACE2 receptor should not be neglected. At present, the number of semen samples collected in clinical studies is still limited and most samples were collected at the recovery stage. More studies need to be performed at the acute stage of COVID-19 to confirm the presence of SARS-CoV-2 virus in semen. Our study demonstrated that SARS-CoV-2 virus could infect Sertoli and Leydig cells through its receptor hACE2. The replication of virus in these cells caused testis damage. However, no pathological changes were detected in testis after intranasal exposure of SARS-CoV-2. Based on these results, we could not exclude the possibility of testis damage after COVID-19 infection in human. It is possible that high viral load in blood and high expression level of hACE2 may cause testis infection and damage and this needs further investigation.
In summary, we constructed a humanized ACE2 transgenic mice model in which ACE2 expression pattern resembled to that in human. Injection of SARS-CoV-2 virus into the testis interstitium could infect the testicular cells and cause disruption of seminiferous tubules. Our study demonstrates that testis is most likely also a target of SARS-CoV-2 virus. Attention should be paid to the testis function in SARS-CoV-2 patients. Our mouse model is helpful for understanding the pathogenesis of SARS-CoV-2 infection, studying the influence of SARS-CoV-2 virus on reproductive system, and evaluating vaccines and therapeutics. More studies are needed to investigate whether the virus can be transmitted to the testis in mice which developed severe interstitial pneumonia.
Material and methods
Ethics statement
Recombinant vesicular stomatitis virus (rVSV) pseudovirus used in this study was conducted in a biosafety level 2 (BSL2) facility. All experiments with authentic viruses and animals were performed in a biosafety level 3 (BSL3) laboratory. The study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the Institute of Microbiology, Chinese Academy of Sciences (IMCAS) Ethics Committee, and all experiments conformed to the relevant regulatory standards. The experiments and protocols were approved by the Committee on the Ethics of Animal Experiments of IMCAS (Permit Number: APIMCAS2022073). All animal experiments were conducted under isoflurane anesthesia to minimize animal suffering.
Mice
Animal experiments were carried out in accordance with the protocols approved by the Institutional Animal Care and Use Committee (IACUC) of the Institute of Zoology, Chinese Academy of Sciences (CAS) (SYXK, 2018-0021). To construct hACE2 transgenic mice, human ACE2 promoter and coding sequence were amplified by PCR and inserted into pUC19L vector. The primers were: ACE2 promoter F: CTCGGTACTGCTGTCCCAGGCTC; ACE2 promoter R: ATGGTGGCCGTCCCCTGTGAGCC; ACE2 CDs F: AGGGGACGGCCACCATGTCAAGC; and ACE2 CDs R: CCGCTGCCCTTGTCATCGTCATCCT. The plasmid was microinjected into fertilized ova from C57BL/6 mice, which were then transplanted into pseudo-pregnant mice. The offspring were genotyped using the following primers: F: AGTCACGACGTTGTAAAACGACGGCCAGTG, R: ATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAG. The positive offspring were backcrossed with C57BL/6 mice to produce generation F1.
Pseudoviruses construction and infection
The replication-competent vesicular stomatitis virus (VSV) based recombinant SARS-CoV-2 pseudovirus (rVSV-SARS-CoV-2) was described previously (Li et al., 2020b). Briefly, glycoprotein coding sequence of VSV was replaced with the codon-optimized spike (S) of SARS-CoV-2 Wuhan-Hu-1 strain (GeneBank: YP_009724390.1) and an eGFP or luciferase reporter was inserted in front of N. For mice injection, 8-week-old male wildtype and hACE2 transgenic mice were used. After anesthesia, 10 μL of rVSV pseudovirus solution (mixture of rVSV pseudovirus with trypan blue, 5 × 106 focus-forming units per mL) was injected into the seminiferous tubules through rete testis using a glass capillary under a stereomicroscope. For the no-infection group, 10 μL PBS was injected. Twenty-four hours later, the mice were analyzed for luminescence using IVIS Spectrum (PerkinElmer IVIS Spectrum, 5717). At D3 and D18 after injection, the testes were collected for further histological analysis.
For cell infection, the viral titers of rVSV-eGFP-SARS-CoV-2 on Sertoli and Leydig cells were determined by a focus-forming assay (FFA). Cells (2 × 104/well) were seeded in 96-well plates at 24 h before infection. Viruses were serially diluted at 1:10 dilution in DMEM with 2% FBS and incubated with cells for 4 h at 37°C. Then, cells were washed once and incubated at 28°C in fresh medium (with 20 mM NH4Cl). GFP-positive cells were counted under a fluorescent microscope at 20 h postinfection.
Authentic SARS-CoV-2 infection
SARS-CoV-2 strain hCoV-19/China/CAS-B001/2020 (National Microbiology Data Center NMDCN0000102-3, GISAID databases EPI_ISL_514256-7) was kindly provided by Prof. Yuhai Bi. The viruses were amplified and tittered on Vero-E6 cells. For intranasal infection, 8-week-old male wildtype mice and hACE2 transgenic mice were anesthetized with isoflurane (5% initial and 1.0%–1.5% for maintenance) through the intranasal route, and then intranasally infected with 5 × 105 TCID50/50 μL of SARS-CoV-2 respectively. For testis injection, a dose of 105 TCID50/mL in 10 μL SARS-CoV-2 was injected into the testis interstitium of 8-week-old male wildtype mice and hACE2 transgenic mice. For no-infection group, 10 μL PBS was injected into the testis interstitium. At indicated days after infection, the testis and lung were harvested for virus RNA and histological analysis.
For cell infection, Sertoli cells and Leydig cells were infected with SARS-CoV-2 at a MOI of 1 in 12-well plates. Twenty-four hours later, the cells were fixed with 4% paraformaldehyde for 48 h and processed for immunofluorescence analysis.
Isolation of viral RNA and real-time RT-PCR
For viral RNA detection, all tissues were weighed and homogenized with zirconia beads in the Bead Ruptor Elite instrument (Omni International, Kennesaw, GA, USA) in 1 mL PBS. All homogenized tissues from infected mice were stored at −80°C until virus titration. Viral RNAs were extracted with RNeasy Mini Kit (QIAGEN) and determined by real-time RT-PCR targeting the ORF1ab gene of SARS-CoV-2 on an ABI QuantStudio 7 instrument (Applied Biosystems, CA, USA) using One Step PrimeScript RT-PCR kit (TaKaRa, Japan). Viral burden was expressed on a log10 scale as viral RNA copies per g after comparison with a standard curve.
Isolation and culture of sertoli cell
Sertoli cells were isolated from 4-week-old mice as previously described (Chen et al., 2014). Briefly, the testes were decapsulated and sequentially digested in 3 steps of enzymes: 1 mg/mL collagenase IV (VETEC, V900893) and 1 mg/mL DNase I (AppliChem, A37780500) in DMEM for 15 min, then 1 mg/mL collagenase I, 1 mg/mL DNase I and 1 mg/mL hyaluronidase (SIGMA, SIAL-H3506) for 10 min, and then 1 mg/mL collagenase IV, 1 mg/mL hyaluronidase, 2.5 mg/mL trypsin and 1 mg/mL DNase I for 20 min. FBS was added to terminate the digestion and cell suspension was filtered through a 40 μm filter. Cells were centrifuged, washed, and resuspended in DMEM/F12 supplemented with 10% FBS. Forty-eight hrs later, the cells were subjected to hypotonic treatment with 20 mM Tris (pH 7.4) at room temperature for 2.5 min to remove the residual spermatogonia and the unlysed cells were ready for virus infection.
Isolation and culture of leydig cell
Percoll-purified Leydig cells from 4-week-old mice were prepared as previously described (Chen et al., 2017). Briefly, the testes were decapsulated and incubated in PBS containing 1 mg/mL collagenase IV in a water bath with circular agitation (100 rpm) at 37°C for 15 min. Tubules were allowed to settle, and the cell suspension was filtered through a 40 μm filter. After washing in DMEM/F12, the cell suspension was separated in a discontinuous Percoll (GE) gradient of 30%, 40%, 50%, and 60% at 800 × g for 30 min. The gradient fraction containing Leydig cells between 50% and 60% layers (1.067–1.077 g/mL) was collected and washed in DMEM/F12 and then resuspended in DMEM/F12 supplemented with 10% FBS. Forty-eight hrs later, when cells were approximately 70% confluent, Leydig cells were ready for virus infection.
Immunohistochemistry and immunofluorescence analysis
Immunohistochemistry and immunofluorescence analysis were performed as described previously (Chen et al., 2021). After rehydration and antigen retrieval, the 5-μm sections were blocked with 5% BSA, incubated with the primary antibody for 1 h and the corresponding secondary antibody for 1 h. The following primary antibodies were used: MVH (Abcam, ab13840), SOX9 (Millipore, AB5535; Sigma, AMAB90795), Nucleoprotein (Sino biological, 40143-R001), CD3 (Abcam, ab11089), 3β-HSD (Santa Cruz, sc-30820). The secondary antibodies were: FITC-conjugated donkey anti-rabbit IgG (Jackson ImmunoResearch, 711-095-152), TRITC-conjugated donkey anti-mouse IgG (Jackson ImmunoResearch, 715-025-151), TRITC-conjugated donkey anti-goat IgG (Jackson ImmunoResearch, 705-025-147). For immunohistochemistry, staining was visualized using a diaminobenzidine substrate kit, examined with a Nikon microscope, and images were captured by a Nikon DS-Ri1 CCD camera. For immunofluorescence, the sections were examined with a confocal laser scanning microscope (Carl Zeiss Inc, Thornwood, NY).
Western blot analysis
Tissues were lysed with RIPA buffer (50 mM Tris–HCl [pH 7.5], 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% sodium deoxycholate, 5 mM EDTA) supplemented with protease inhibitors cocktail (Roche) and 1 mM PMSF. Equal amounts of total protein were separated by SDS/PAGE gels, transferred to nitrocellulose membrane, and probed with the primary antibodies. The images were captured with the ODYSSEY Sa Infrared Imaging System (LI-COR Biosciences, Lincoln, NE). The antibodies used were ACE2 (Abcam, ab108209) and GAPDH (Boao, ab1039t).
Statistical analysis
For mice infection experiments, five mice for each group at each time point were used for immunostaining or quantitative experiments. For immunostaining, one representative picture of similar results from five mice at each time point is presented. All Sertoli and Leydig cell culture experiments were repeated at least three times by using three different cell preparations. The quantitative results are presented as the mean ± SEM. Statistical analyses were conducted using GraphPad Prism version 9.0.0. Data were analyzed using one-way ANOVA. P-values < 0.05 were considered to indicate significance.
CRediT authorship contribution statement
Min Chen, Shihua Li: Conceptualization, Methodology, Data curation, Investigation, Validation, Writing - Original draft, Review & Editing. Shujun Liu, Yuhang Zhang: Methodology, Data curation, Investigation, Validation. Xiuhong Cui, Limin Lv, Bowen Liu: Methodology, Data curation. Aihua Zheng, Qihui Wang, Shuguang Duo: Conceptualization, Methodology, Data curation, Investigation, Validation, Writing - Review & Editing. Fei Gao: Conceptualization, Methodology, Data curation, Investigation, Validation, Writing - Original draft, Review & Editing.
Conflict of interest
The authors declare that they have no conflict of interest.
Acknowledgments
We appreciate the staff of the biosafety level 3 (BSL3) laboratory in the institute of Microbiology, Chinese Academy of Sciences. This work was supported by National key R&D program of China (2018YFA0107700), the National Natural Science Foundation of China (32170855, 31970785), and Biological Resources Program of Chinese Academy of Sciences (KFJ-BRP-005).
Footnotes
Supplementary data to this article can be found online at https://doi.org/10.1016/j.jgg.2022.11.011.
Appendix A Supplementary data
The following is the Supplementary data to this article:
References
- Bao L., Deng W., Huang B., Gao H., Liu J., Ren L., Wei Q., Yu P., Xu Y., Qi F., et al. The pathogenicity of SARS-CoV-2 in hACE2 transgenic mice. Nature. 2020;583:830–833. doi: 10.1038/s41586-020-2312-y. [DOI] [PubMed] [Google Scholar]
- Campos R.K., Camargos V.N., Azar S.R., Haines C.A., Eyzaguirre E.J., Rossi S.L. SARS-CoV-2 infects hamster testes. Microorganisms. 2021;9:1318. doi: 10.3390/microorganisms9061318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen M., Dong F., Chen M., Shen Z., Wu H., Cen C., Cui X., Bao S., Gao F. PRMT5 regulates ovarian follicle development by facilitating Wt1 translation. Elife. 2021;10 doi: 10.7554/eLife.68930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen M., Wang X., Wang Y., Zhang L., Xu B., Lv L., Cui X., Li W., Gao F. Wt1 is involved in leydig cell steroid hormone biosynthesis by regulating paracrine factor expression in mice. Biol. Reprod. 2014;90:71. doi: 10.1095/biolreprod.113.114702. [DOI] [PubMed] [Google Scholar]
- Chen M., Zhang L., Cui X., Lin X., Li Y., Wang Y., Wang Y., Qin Y., Chen D., Han C., et al. Wt1 directs the lineage specification of sertoli and granulosa cells by repressing Sf1 expression. Development. 2017;144:44–53. doi: 10.1242/dev.144105. [DOI] [PubMed] [Google Scholar]
- Clarke N.E., Turner A.J. Angiotensin-converting enzyme 2: the first decade. Int. J. Hypertens. 2012;2012:307315. doi: 10.1155/2012/307315. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Douglas G.C., O'Bryan M.K., Hedger M.P., Lee D.K., Yarski M.A., Smith A.I., Lew R.A. The novel angiotensin-converting enzyme (ACE) homolog, ACE2, is selectively expressed by adult Leydig cells of the testis. Endocrinology. 2004;145:4703–4711. doi: 10.1210/en.2004-0443. [DOI] [PubMed] [Google Scholar]
- Gonzalez D.C., Khodamoradi K., Pai R., Guarch K., Connelly Z.M., Ibrahim E., Arora H., Ramasamy R. A systematic review on the investigation of SARS-CoV-2 in semen. Res. Rep. Urol. 2020;12:615–621. doi: 10.2147/RRU.S277679. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guo L., Zhao S., Li W., Wang Y., Li L., Jiang S., Ren W., Yuan Q., Zhang F., Kong F., et al. Absence of SARS-CoV-2 in semen of a COVID-19 patient cohort. Andrology. 2021;9:42–47. doi: 10.1111/andr.12848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hoffmann M., Kleine-Weber H., Schroeder S., Kruger N., Herrler T., Erichsen S., Schiergens T.S., Herrler G., Wu N.H., Nitsche A., et al. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell. 2020;181:271–280. doi: 10.1016/j.cell.2020.02.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Holtmann N., Edimiris P., Andree M., Doehmen C., Baston-Buest D., Adams O., Kruessel J.S., Bielfeld A.P. Assessment of SARS-CoV-2 in human semen—a cohort study. Fertil. Steril. 2020;114:233–238. doi: 10.1016/j.fertnstert.2020.05.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jiang R.D., Liu M.Q., Chen Y., Shan C., Zhou Y.W., Shen X.R., Li Q., Zhang L., Zhu Y., Si H.R., et al. Pathogenesis of SARS-CoV-2 in transgenic mice expressing human angiotensin-converting enzyme 2. Cell. 2020;182:50–58. doi: 10.1016/j.cell.2020.05.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kayaaslan B., Korukluoglu G., Hasanoglu I., Kalem A.K., Eser F., Akinci E., Guner R. Investigation of SARS-CoV-2 in semen of patients in the acute stage of COVID-19 infection. Urol. Int. 2020;104:678–683. doi: 10.1159/000510531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li C., Ye Z., Zhang A.J., Chan J.F., Song W., Liu F., Chen Y., Kwan M.Y., Lee A.C., Zhao Y., et al. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infections by intranasal or testicular inoculation induces testicular damage preventable by vaccination in golden Syrian hamsters. Clin. Infect. Dis. 2022;75:e974–e990. doi: 10.1093/cid/ciac142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li D., Jin M., Bao P., Zhao W., Zhang S. Clinical characteristics and results of semen tests among men with coronavirus disease 2019. JAMA Netw. Open. 2020;3 doi: 10.1001/jamanetworkopen.2020.8292. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li H., Zhao C., Zhang Y., Yuan F., Zhang Q., Shi X., Zhang L., Qin C., Zheng A. Establishment of replication-competent vesicular stomatitis virus-based recombinant viruses suitable for SARS-CoV-2 entry and neutralization assays. Emerg. Microb. Infect. 2020;9:2269–2277. doi: 10.1080/22221751.2020.1830715. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li Q., Guan X., Wu P., Wang X., Zhou L., Tong Y., Ren R., Leung K.S.M., Lau E.H.Y., Wong J.Y., et al. Early transmission dynamics in Wuhan, China, of novel coronavirus-infected pneumonia. N. Engl. J. Med. 2020;382:1199–1207. doi: 10.1056/NEJMoa2001316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lu R., Zhao X., Li J., Niu P., Yang B., Wu H., Wang W., Song H., Huang B., Zhu N., et al. Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet. 2020;395:565–574. doi: 10.1016/S0140-6736(20)30251-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ma L., Xie W., Li D., Shi L., Ye G., Mao Y., Xiong Y., Sun H., Zheng F., Chen Z., et al. Evaluation of sex-related hormones and semen characteristics in reproductive-aged male COVID-19 patients. J. Med. Virol. 2021;93:456–462. doi: 10.1002/jmv.26259. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moshrefi M., Ghasemi-Esmailabad S., Ali J., Findikli N., Mangoli E., Khalili M.A. The probable destructive mechanisms behind COVID-19 on male reproduction system and fertility. J. Assist. Reprod. Genet. 2021;38:1691–1708. doi: 10.1007/s10815-021-02097-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Munoz-Fontela C., Dowling W.E., Funnell S.G.P., Gsell P.S., Riveros-Balta A.X., Albrecht R.A., Andersen H., Baric R.S., Carroll M.W., Cavaleri M., et al. Animal models for COVID-19. Nature. 2020;586:509–515. doi: 10.1038/s41586-020-2787-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Omolaoye T.S., Adeniji A.A., Cardona Maya W.D., du Plessis S.S. SARS-COV-2 (Covid-19) and male fertility: where are we? Reprod. Toxicol. 2021;99:65–70. doi: 10.1016/j.reprotox.2020.11.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pan F., Xiao X., Guo J., Song Y., Li H., Patel D.P., Spivak A.M., Alukal J.P., Zhang X., Xiong C., et al. No evidence of severe acute respiratory syndrome-coronavirus 2 in semen of males recovering from coronavirus disease 2019. Fertil. Steril. 2020;113:1135–1139. doi: 10.1016/j.fertnstert.2020.04.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Paoli D., Pallotti F., Colangelo S., Basilico F., Mazzuti L., Turriziani O., Antonelli G., Lenzi A., Lombardo F. Study of SARS-CoV-2 in semen and urine samples of a volunteer with positive naso-pharyngeal swab. J. Endocrinol. Invest. 2020;43:1819–1822. doi: 10.1007/s40618-020-01261-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peng L., Liu J., Xu W., Luo Q., Chen D., Lei Z., Huang Z., Li X., Deng K., Lin B., et al. SARS-CoV-2 can be detected in urine, blood, anal swabs, and oropharyngeal swabs specimens. J. Med. Virol. 2020;92:1676–1680. doi: 10.1002/jmv.25936. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rathnasinghe R., Strohmeier S., Amanat F., Gillespie V.L., Krammer F., Garcia-Sastre A., Coughlan L., Schotsaert M., Uccellini M.B. Comparison of transgenic and adenovirus hACE2 mouse models for SARS-CoV-2 infection. Emerg. Microb. Infect. 2020;9:2433–2445. doi: 10.1080/22221751.2020.1838955. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rawlings S.A., Ignacio C., Porrachia M., Du P., Smith D.M., Chaillon A. No Evidence of SARS-CoV-2 seminal shedding despite SARS-CoV-2 persistence in the upper respiratory tract. Open Forum Infect. Dis. 2020;7 doi: 10.1093/ofid/ofaa325. ofaa325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Seymen C.M. The other side of COVID-19 pandemic: effects on male fertility. J. Med. Virol. 2021;93:1396–1402. doi: 10.1002/jmv.26667. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sheikhzadeh Hesari F., Hosseinzadeh S.S., Asl Monadi Sardroud M.A. Review of COVID-19 and male genital tract. Andrologia. 2021;53 doi: 10.1111/and.13914. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Song C., Wang Y., Li W., Hu B., Chen G., Xia P., Wang W., Li C., Diao F., Hu Z., et al. Absence of 2019 novel coronavirus in semen and testes of COVID-19 patientsdagger. Biol. Reprod. 2020;103:4–6. doi: 10.1093/biolre/ioaa050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun S.H., Chen Q., Gu H.J., Yang G., Wang Y.X., Huang X.Y., Liu S.S., Zhang N.N., Li X.F., Xiong R., et al. A mouse model of SARS-CoV-2 infection and pathogenesis. Cell Host Microbe. 2020;28:124–133. doi: 10.1016/j.chom.2020.05.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang W., Xu Y., Gao R., Lu R., Han K., Wu G., Tan W. Detection of SARS-CoV-2 in different types of clinical specimens. JAMA. 2020;323:1843–1844. doi: 10.1001/jama.2020.3786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Z., Xu X. scRNA-seq profiling of human testes reveals the presence of the ACE2 receptor, a target for SARS-CoV-2 infection in spermatogonia, leydig and sertoli cells. Cells. 2020;9:920. doi: 10.3390/cells9040920. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang M., Chen S., Huang B., Zhong J.M., Su H., Chen Y.J., Cao Q., Ma L., He J., Li X.F., et al. Pathological findings in the testes of COVID-19 patients: clinical implications. Eur. Urol. Focus. 2020;6:1124–1129. doi: 10.1016/j.euf.2020.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Younis J.S., Abassi Z., Skorecki K. Is there an impact of the COVID-19 pandemic on male fertility? The ACE2 connection. Am. J. Physiol. Endocrinol. Metab. 2020;318:E878–E880. doi: 10.1152/ajpendo.00183.2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou P., Yang X.L., Wang X.G., Hu B., Zhang L., Zhang W., Si H.R., Zhu Y., Li B., Huang C.L., et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature. 2020;579:270–273. doi: 10.1038/s41586-020-2012-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu N., Zhang D., Wang W., Li X., Yang B., Song J., Zhao X., Huang B., Shi W., Lu R., et al. A novel coronavirus from patients with pneumonia in China, 2019. N. Engl. J. Med. 2020;382:727–733. doi: 10.1056/NEJMoa2001017. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.





