Abstract
As circadian processes can impact the immune system and are affected by infections and inflammation, this study examined the expression of circadian rhythm genes in periodontitis. Methods: Macaca mulatta were used with naturally-occurring and ligature-induced periodontitis. Gingival tissue samples were obtained from healthy, diseased, and resolved sites in four groups: young (≤3 years), adolescent (3–7 years), adult (12–26) and aged (18–23 years). Microarrays targeted circadian rhythm (n = 42), inflammation/tissue destruction (n = 11), bone biology (n = 8) and hypoxia pathway (n = 7) genes. Results: The expression of many circadian rhythm genes, across functional components of the pathway, was decreased in healthy tissues from younger and aged animals, as well as showing significant decreases with periodontitis. Negative correlations of the circadian rhythm gene levels with inflammatory mediators and tissue destructive/remodeling genes were particularly accentuated in disease. A dominance of positive correlations with hypoxia genes was observed, except HIF1A, that was uniformly negatively correlated in health, disease and resolution. Conclusions: The chronic inflammation of periodontitis exhibits an alteration of the circadian rhythm pathway, predominantly via decreased gene expression. Thus, variation in disease expression and the underlying molecular mechanisms of disease may be altered due to changes in regulation of the circadian rhythm pathway functions.
Introduction
Circadian rhythms are autonomous, self-sustained oscillations in biologic processes entrained to environmental cues [1]. These circadian rhythms are the basis of the concept of chronobiology. These circadian clocks are intimately involved in controlling multiple physiologic and metabolic features on a daily basis in humans and other mammalian species [2–5]. Importantly, these circadian processes also impact the immune system including cell numbers and functions [1,4,6–16]. Triggering of these circadian processes is driven by entrainment actions that focus on the capacity of environmental factors, including light cycle, temperature, and access to nutrition to impact biological clocks [1,3,17,18]. Virtually all cells in the body display peripheral clock activities that coordinate cellular processes, including cells and tissues of the immune system.
The molecular clock cellular machinery is composed of a set of proteins present as two auto-regulatory pathways of transcription and translation [1,2]. The main loop is composed of a positive loop of Circadian Locomoter Output Cycles Kaput (CLOCK), NPAS2, and ARNT-like protein 1 (i.e., BMAL1). These molecules dimerize to control the timing of expression of various genes in the pathway. CLOCK/BMAL1 also regulate transcription of negative controllers in the loop including Period genes (PER1, PER2, PER3) and Cryptochrome genes (CRY1, CRY2) that dimerize and are phosphorylated by casein kinases 1 δ and ε (CSKN1D, CSKN1E) enabling them to translocate to the nucleus and control the CLOCK/BMAL1 complex. Existing data support that 2–10% of mammalian genes are regulated by these circadian clock pathways [18].
Studies of numerous infectious diseases have identified the expression of circadian rhythm factors on susceptibility and severity to these infections [5,15,19–23]. Additionally, chronic inflammatory diseases are associated with disruptions in circadian rhythm entrainment and pathway functions [5,6,8,24,25]. Thus, as periodontitis represents a global chronic inflammatory disease, understanding circadian patterns of immune responses and how the circadian rhythm genes interface with tissue regulatory genes and responses at mucosal tissues in the oral cavity would be expected to reflect important host components of health and disease [26].
Methods
Animals and diet
Rhesus monkeys (Macaca mulatta) (n = 34; 20 male, 14 female) housed at the Caribbean Primate Research Center at Sabana Seca, Puerto Rico were examined for periodontal health and naturally-occurring disease [27–29]. This included 6 groups: healthy young (≤3 years; n = 5); healthy adolescent (3–7 years; n = 5); healthy adult (12–16 years; n = 7); healthy aged (18–23 years; n = 6); periodontitis adult (12–16 years; n = 5) and periodontitis aged (18–23 years; n = 6). As an estimate, 1 monkey year approximates 3.5 human years, thus the groups represented human subjects about 6–9 yo, 11–25 yo, 42–56 yo, 63–82 yo. A second cohort (n = 36; 17 male, 19 female) was used to determine the results from a ligature-induced periodontitis model. Young, adolescent, adult and aged animals with the same age distribution were used in the study with 9 animals/group with husbandry practices as we have reported previously [30–32] and approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Puerto Rico [33]. The animals are raised in large corrals of family units, and, thus, the housing and environmental enrichment is accomplished via daily interactions of the large group of animals in the corrals with climbing and play opportunities and are rather consistent throughout the study sample interval. Feeding is on a standard daily timeframe using pelleted chow with a 20% protein, 5% fat, and 10% fiber commercial monkey diet (diet 8773, Teklad NIB primate diet modified: Harlan Teklad). The diet is supplemented with fruits and vegetables, and water is provided ad libitum in an enclosed corral setting. As such, related to circadian rhythms, the environmental entrainment of the animals is quite similar due to the husbandry employed in the primate facility. The oral sampling procedure using IV sedation of the animals with a standard nonhuman primate cocktail, generally to sedate the animals for approximately 45 min. for the oral exam and procedures. No analgesia is required since the procedures are not considered painful within USPHS guidelines determined by the veterinary staff. No animals are euthanized in this protocol, and all animals are returned to their family units and corrals after each sampling and at the completion of the study. As these animals are housed in large family unit groups, standard examination of the overall population is made on a daily basis by the animal care staff. This includes assessing eating behaviors, activity, and interaction within the family unit for each of the animals.
The clinical examination included probing pocket depth (PPD) and bleeding on probing (BOP; 0–5 scale) [34]. Periodontal health was defined by mean Pocket Depth (PD) ≤ 3.0 mm and mean Bleeding on Probing (BOP) ≤ 1 (0–5 scale) in a full mouth examination excluding 3rd molars and canines [33]. Ligature-induced periodontal disease was initiated and gingival and subgingival plaque samples taken at 0.5, 1, and 3 months (Initiation/Progression), and 2 months after removal of ligatures (Resolution). Ligated teeth included the 1st premolar and 1st and 2nd molars in each of the four quadrants. Determination of periodontal disease at the sampled site was documented by assessment of the presence of BOP and probing pocket depth of >4 mm, as we have described previously [28]. Each animal provided a gingival tissue sample at baseline, during the three disease times, and at resolution. All of these were obtained from distinct unique sites at each time point. In the ligation model, differences in BOP and PPD in health, during disease initiation and progression, and with resolution in these age groups have been described previously [35]. All animals demonstrated significant increases in BOP within 0.5 months (0.6±0.1 to 3.8±0.1; mean±SEM), with somewhat elevated levels in the younger age groups. PPD increases at ligated teeth were also seen in all animals across all age groups with peak disease at 1–3 months. Both young and adolescent animals showed PPD measures of disease that were less than in the adult and aged groups (young/adolescent: 1.4±0.1 to 3.9±0.2; adult/aged: 2.7±0.1 to 5.3±0.2). The clinical resolution of the sites occurred over 2 months resulting only from removal of the ligatures. At resolution, both BOP and PPD measures decreased across all age groups, albeit generally remaining above measures for the baseline, healthy tissues.
Gingival tissue sample collection and mRNA analysis
Gingival tissue samples from healthy and diseased sites were surgically collected using a standard gingivectomy technique (eg. crevicular incision followed by an interdental incision at the base of the papillae) providing a gingival sample from each animal at each time point and total RNA was extracted for microarray analysis [28]. All samples were collected from the animals between 8:30–11 AM following an overnight NPO requirement for anesthesia. With the naturally-occurring disease model, one gingival biopsy was collected from either a healthy site or periodontal disease site from each animal. In the longitudinal study, each animal provided a gingival tissue sample at baseline, during the three disease times, and at resolution. All of these were obtained from distinct unique sites at each time point. The GeneChip® Rhesus Macaque Genome Array (Affymetrix) was used for the aging health and naturally-occurring periodontitis study and the GeneChip® Rhesus Gene 1.0 ST Array (Affymetrix, Santa Clara, CA, USA) for the ligature-induced periodontitis model, similar to methods we have described previously [28,36–39]. The data were only compared within samples using each type of gene chip, and not combined for the analyses.
Based upon the microarray outcomes we selected 4 genes and performed a qPCR analysis using a standard technique in our laboratory [33,38]. Primers were prepared for RORA (forward—CTATCCCTCCAAGGCACAAG; reverse–AACACAAGACTGACGAGCACA; 110 bp), FOS (forward–GCCTCTCTTACTACCACTCACC; reverse–AGATGGCAGTGACCGTGGGAAT; 126 bp), BMAL1/ARNTL (forward—TGCCACCAATCCATACACAG; reverse–TTCCCTCGGTCACATCCTAC; 123 bp), NPAS2 (forward—AACCTCGGCAGCACTTTAAC; reverse–GGTTCTGACATGGCTGTGTG; 118 bp) and GAPDH (forward–GGTGTGAACCATGAGAAGTATGA; reverse–GAGTCCTTCCACGATACCAAAG; 123 bp) designed using software PrimerQuest at Integrated DNA Technologies website (www.idtdna.com) and were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA). The level of message was determined using the CT values of detected genes calculated in relation to GAPDH by the 2-ΔΔCT method and those levels compared across the RNA samples prepared from each of 5 animals in the young and adult age groups.
Data analysis
Circadian rhythm-associated genes (n = 42) and their correlation with inflammatory, tissue destructive/remodeling, and hypoxia pathway genes were the focus of this analysis (Table 1). The expression intensities across the samples were estimated using the Robust Multi-array Average (RMA) algorithm with probe-level quintile normalization, as implemented in the Partek Genomics Suite software version 6.6 (Partek, St. Louis, MO). The age groups were initially compared using one way ANOVA. For genes that had significant mean differences, two sample t-tests were used to investigate differences compared to healthy adult levels of expression (naturally-occurring disease) or to baseline/healthy tissue samples (ligature-induced disease). Statistical significance was considered by an adujsted p-value < 0.05. The data has been uploaded into the ArrayExpress data base (www.ebi.ac.uk) under accession number: E-MTAB-1977 and into GEO accession GSE180588 (https://www.ncbi.nlm.nih.gov/gds). Correlation analyses were determined using a Pearson Correlation Coefficient with a p-value <0.02.
Table 1. Pathway genes examined in study.
| Gene ID | Gene Name | Fxn Category | Gene ID | Gene Name | Fxn Category |
|---|---|---|---|---|---|
| ARNTL/ BMAL1 |
Aryl Hydrocarbon Receptor Nuclear Translocator Like | TA | IL10 | Interleukin-10 | AF |
| ARNTL2 | Aryl Hydrocarbon Receptor Nuclear Translocator Like 2 | TA | IL1B | Interleukin-1β | PF |
| BHLHE40 | Basic Helix-Loop-Helix Family Member E40 | TP | IL4 | Interleukin-4 | AF |
| BHLHE41 | Basic Helix-Loop-Helix Family Member E41 | TP | IL6 | Interleukin-6 | PF |
| BTRC | Beta-Transducing Repeat Containing E3 Ubiquitin Protein Ligase | U | TGFB1 | Transforming growth factor β1 | AF |
| CIPC | CLOCK Interacting Pacemaker | TR | TNF | Tumor necrosis factor α | PF |
| CLOCK | Clock Circadian Regulator | TA | CTSK | Cathepsin K | TD/R |
| COMMD3/ BMI1 |
COMM Domain Containing 3 | TR | MMP14 | Matrix metallopeptidase 14 | TD/R |
| CREB1 | CAMP Responsive Element Binding Protein 1 | TF | MMP2 | Matrix metallopeptidase 2 | TD/R |
| CRY1 | Cryptochrome Circadian Regulator 1 | TR | MMP7 | Matrix metallopeptidase 7 | TD/R |
| CRY2 | Cryptochrome Circadian Regulator 2 | TR | MMP9 | Matrix metallopeptidase 9 | TD/R |
| CSNK1D | Casein kinase 1δ | K | BGLAP/OCN | Osteocalcin | BR |
| CSNK1E | Casein kinase 1ε | K | COL1A1 | Collagen type I Alpha 1 | BF |
| DBP | D-Box Binding PAR BZIP Transcription Factor | TF | MKI67 | Marker of proliferation Ki-67 | BF |
| DNMT1 | DNA Methyltransferase 1 | TR | POSTN | Periostin | BF |
| EZH2/ MLL1 |
Enhancer Of Zeste 2 Polycomb Repressive Complex 2 Subunit) | TP | RUNX2 | Runx family transcription factor 2 | BF |
| FBXL3 | F-Box And Leucine Rich Repeat Protein 3 | COR | SPP1/OPN | Secreted phosphoprotein 1/ Osteopontin | BF |
| FBXL21 | F-Box And Leucine Rich Repeat Protein 21, Pseudogene | COR | TNFRSF11B/ OPG |
Osteoprotegerin | BF |
| FOS | Fos Proto-Oncogene, AP-1 Transcription Factor Subunit | TF | TNFSF11/ RANKL |
Receptor activator of nuclear factor-κB ligand | BR |
| HDAC3 | Histone deacetylase 3 | TR | ARNT/ HIF1β |
Aryl Hydrocarbon Receptor Nuclear Translocator | HTF |
| HNF4A | Hepatocyte Nuclear Factor 4 Alpha | TR | COPS5 | COP9 Signalosome Subunit 5 | HR |
| ID2 | Inhibitor Of DNA Binding 2 | TR | EPAS1/ HIF2α |
Endothelial PAS Domain Protein 1 | HTF |
| KITLG | Kit ligand | CS/CP | HIF1A | Hypoxia Inducible Factor 1 Subunit Alpha | HTF |
| MIR155HG | MicroRNA 155 | TR | HIF1AN | Hypoxia Inducible Factor 1 Subunit Alpha Inhibitor | HR |
| NFE2L2 | Nuclear Factor, Erythroid 2 Like 2 | TF | HIF3A | Hypoxia Inducible Factor 3 Subunit Alpha | HR |
| NFIL3 | Nuclear Factor, Interleukin 3 Regulated | TF | NCOA1 | Nuclear receptor coactivator 1 | HR |
| NPAS2 | Neuronal PAS Domain Protein 2 | TA | |||
| NR1D1 | Nuclear Receptor Subfamily 1 Group D Member 1 | TP | |||
| NR1D2 | Nuclear Receptor Subfamily 1 Group D Member 2 | TP | |||
| PER1 | Period Circadian Regulator 1 | TR | |||
| PER2 | Period Circadian Regulator 2 | TR | |||
| PER3 | Period Circadian Regulator 3 | TR | |||
| PRKAA1/ AMPK |
Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 | K | |||
| PTEN | Phosphatase And Tensin Homolog | CS/CP | |||
| RICTOR | RPTOR Independent Companion Of MTOR Complex 2 | CS/CP | |||
| ROMO1 | Reactive Oxygen Species Modulator 1 | CS/CP | |||
| RORA | RAR Related Orphan Receptor A | NR | |||
| RORB | RAR Related Orphan Receptor B | NR | |||
| RORC | RAR Related Orphan Receptor C | NR | |||
| RPS6KA5/ MSK1 |
Ribosomal Protein S6 Kinase A5 | K | |||
| RPTOR | Regulatory Associated Protein Of MTOR Complex 1 | CS/CP | |||
| USP2 | Ubiquitin Specific Peptidase 2 | U |
Functional category designation: COR–circadian oscillation regulator; CS/CP–cell survival/cell proliferation; K–kinase; NR–nuclear receptor; TA–transcription activator; TF–transcription factor; TP–transcription repressor; TR–transcription regulator; U–ubiquination; AF–anti-inflammatory; PF–pro-inflammatory; TD/R–tissue destruction/remodeling; BR–bone resorption; BF–bone formation; HTF–hypoxia transcription factor; HR–hypoxia regulator.
Results
Naturally-occurring periodontitis and circadian rhythm
Fig 1 compares the expression of circadian rhythm pathway genes in health across the lifespan versus healthy adult tissue levels. Young animals showed significantly lower expression of NPAS2, NFIL3, NR1D1, HFN4A, ID2, and MIR155HG, with elevated levels of DBP and FOS. In adolescent tissues, RORA, RORC, DBP, FOS, NR1D1, and PER3 were increased, while HFN4A, ID2 and MIR155HG were decreased similar to the young samples. Aged healthy tissues were generally similar to adult samples albeit ARNTL/BMAL1 and ID2 were both decreased and NR1D1 was increased, as in the other age groups.
Fig 1. Heatmap of expression of circadian rhythm pathway gene profiles in healthy (Y, ADO, AG) and naturally-occurring periodontitis (ADU-PD, AG-PD) gingival tissues samples.

All values are compared as differentially fold-expressed to healthy adult tissues. Functional designation of the genes include: COR–circadian oscillation regulator; CS/CP–cell survival/cell proliferation; K–kinases; NR–nuclear receptor; TA–transcription activator; TF–transcription factor; TP–transcription repressor; TR–transcription regulator; U–ubiquination. Asterisk (*) denotes significantly different from healthy adult levels at p<0.05.
Circadian gene expression in naturally-occurring periodontitis in adult and aged animals is also hown in Fig 1. Naturally-occurring periodontitis is rarely seen in young/adolescent nonhuman primates, similar to humans. Periodontitis in adults resulted in decreased levels of CSNK1D, RORA, CLOCK, DBP, NR1D1, ID2, and PER3 and a substantial increase in expression of FOS. Aged diseased tissues exhibited similar decreases in expression of RORA, DBP, and PER3 together with NR1D2, PER1, and USP2 that were only affected in the aged samples. Increased expression of RORC, FOS, NFIL3, and MIR155HG was limited to the aged tissues.
Experimental ligature-induced periodontitis and circadian rhythm
Using the nonhuman primates provided the ability to follow the gingival transcriptome during initiation, progression, and resolution of disease (Fig 2). A major decrease in FOS was observed in this early disease model and with resolution in samples from young animals. Similarly, all time points showed decreased expression of RORA. Levels of RORC, NPAS2, NFE2L2, PER1/3, and USP2 were all also decreased with disease. ARNTL, NFIL3, and CRY1 were all decreased in resolution samples. In contrast, only RORB and ARNTL2 were increased with disease. Somewhat similar profiles were observed with the adolescent samples. Beyond the substantial decrease in FOS expression at all time points, RORA, RORC, ARNTL, CRY1, PER1/2, and USP2 were decreased with disease. As with the young samples, ARNTL2 was increased with disease. Adult gene expression patterns are also demonstrated in Fig 2. Again, FOS expression was substantially decreased at all time points. RORA, RORC, ARNTL, NPAS2, CRY1/2, PER1/2, and USP2 were all decreased with disease, while RORB and NFIL3 were only decreased in resolution samples, although NFIL3 was elevated early in the disease process. Aged samples also displayed significant decreases in FOS expression at all time points. Also, FBXL3, RPS6KA5, RORA, NFE2L2, NR1D1, NR1D2, PER1/3, and USP2 were all decreased with disease, while CRY1 was only decreased in resolution samples. No circadian pathway genes were up-regulated with disease or resolution in the aged tissue samples.
Fig 2. Circadian rhythm pathway gene expression profiles in young, adolescent, adult, and aged gingival tissues samples during ligature induced disease.
This analysis used a z-score normalization within a gene across all time points compared to adult baseline (healthy) values. Functional designation of the genes are as in Fig 1. Red bars denote decreased levels and asterisk (*) denotes significantly different from healthy adult levels at p<0.05.
Table 2 provides a summary of qPCR validation of 4 genes comparing expression at baseline and 3 months in a subset of young and adult samples. The results demonstrated a general directional agreement in the decreased expression of these genes with disease, and the decrease was somewhat more pronounced in the qPCR analysis.
Table 2. qPCR validation of specific circadian related genes at 3 months of disease progression.
| Gene ID | Young | Adult | |
|---|---|---|---|
| RORA | qPCR | -3.03±3.58 | -1.96±0.58 |
| GeneChip | -1.45±0.44 | -1.59±0.43 | |
| FOS | qPCR | -3.45±1.90 | -2.78±1.70 |
| GeneChip | -9.09±6.61 | -3.45±2.50 | |
| BMAL1/ | qPCR | -1.54±0.28 | -1.72±0.80 |
| ARNTL | GeneChip | -1.23±0.35 | -1.30±1.08 |
| NPAS2 | qPCR | 1.09±0.28 | -1.82±0.46 |
| GeneChip | -1.27±0.30 | -1.45±0.65 |
Values denoted fold-difference from baseline expression with negative value denoting a decreased fold-expression versus baseline for each gene in the young (n = 5) or adult (n = 5) animals. GAPDH was employed as a housekeeping gene for normalization of the results.
Circadian rhythm gene expression and gingival responses in naturally-occurring periodontitis
Extensive evidence has identified an array of host factors produced during chronic inflammation that can account for the range of tissue destructive events occurring in periodontitis [40–44]. Thus, these nonhuman primate data were explored for determining interactions between the circadian pathway genes and expression of pro- (TNF, IL1B, IL6) and anti-inflammatory genes (IL4, IL10, TGFB1), as well as genes for products associated with soft tissue destruction or remodeling (CTSK, MMP2, MMP7, MMP9, MMP14) in the cross-sectional study of health and naturally-occurring periodontitis (Fig 3). The results showed a specific set of circadian rhythm genes significantly correlated with the inflammatory genes, in particular IL1B and IL6 levels, with individual genes showing either positive or negative correlations. Similar circadian genes were also related to the tissue destructive/remodeling genes, particularly MMP7 and MMP9 showing either positive or negative correlations. Of interest was that there was a general lack of any particular circadian pathway functional category associated with these correlations.
Fig 3. Heatmap of circadian rhythm pathway gene expression profiles correlated with inflammatory genes, tissue destructive/remodeling genes, bone biology genes, and hypoxia genes in gingival tissues from healthy and naturally-occurring periodontitis sites across all age groups.
Functional designation of the genes are as in Fig 1. Values denoted by asterisk (*) were significant at p<0.01.
As the integrity of the biology and architecture of alveolar bone is a critical component of periodontitis, we explored the relationship of circadian rhythm genes to gene expression profiles of 8 genes linked to bone functions (Fig 3). We noted no particular aspect of the circadian pathway appeared with a tendency towards correlating with the bone genes. However, there did appear to be a predilection of a subset of the bone genes demonstrating either positive or negative correlations with circadian rhythm genes, ranking in frequency of significant correlations as POSTN>RUNX2>TNFRSF11B/OPG> TNFSF11/RANKL.
Finally, a crucial feature of the dysbiosis in periodontal lesions is a substantial increase in the proportion of the microbiome that is anaerobic. Additionally, an environment with low oxygen availability would also dramatically impact the gene expression profiles even within commensal bacteria in these microbiomes. Thus, we evaluated if the changes in circadian rhythm genes would interface with gingival gene expression reflecting an hypoxic environment that would be consistent with a chronic inflammatory lesion in these tissues. Fig 3 summarizes these correlation patterns, with the greatest frequency of correlations among the circadian pathway transcription activators/factors/repressors. Also, the principal hypoxia transcription factor, HIF1A, showed the greatest frequency of correlations skewed towards being significantly negatively correlated with the circadian rhythm components.
Table 3 provides an overview summary of the directional correlations for the circadian pathway genes with the inflammatory, tissue destruction/remodeling, bone biology and hypoxia genes in naturally-occurring periodontitis. Notable was the frequency of correlations with RORA and the genes related to inflammation, tissue disruption, and hypoxia, as well as the relationship of levels of HIF1A expression to a broad array of the circadian rhythm genes.
Table 3. Significant correlations of circadian rhythm genes with inflammation, tissue destructive/remodeling, bone biology, and hypoxia genes from cross-sectional study in healthy and naturally-occurring periodontitis gingival samples.
| F B L X 2 1 |
F B X L 3 |
R P T O R |
R I C T O R |
R O M O 1 |
P T E N |
P R K A A 1 |
R O R A |
R O R B |
R O R C |
A R N T L |
C L O C K |
N P A S 2 |
A R N T L 2 |
D B P |
N F E 2 L 2 |
N F I L 3 |
F O S |
C R E B 1 |
N R 1 D 1 |
N R 1 D 2 |
B M I 1 |
E H Z 2 |
B H L H E 4 1 |
B H L H E 4 0 |
C I P C |
C R Y 1 |
C R Y 2 |
M I R 1 5 5 |
P E R 1 |
P E R 2 |
P E R 3 |
H D A C 3 |
D N M T 1 |
I D 2 |
U S P 2 |
B T R C |
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| TNF | |||||||||||||||||||||||||||||||||||||
| IL1B | |||||||||||||||||||||||||||||||||||||
| IL6 | |||||||||||||||||||||||||||||||||||||
| IL10 | |||||||||||||||||||||||||||||||||||||
| IL4 | |||||||||||||||||||||||||||||||||||||
| TGFB1 | |||||||||||||||||||||||||||||||||||||
| CTSK | |||||||||||||||||||||||||||||||||||||
| MMP14 | |||||||||||||||||||||||||||||||||||||
| MMP2 | |||||||||||||||||||||||||||||||||||||
| MMP7 | |||||||||||||||||||||||||||||||||||||
| MMP9 | |||||||||||||||||||||||||||||||||||||
| TNFRSF11B/OPG | |||||||||||||||||||||||||||||||||||||
| TNFSF11/RANKL | |||||||||||||||||||||||||||||||||||||
| BGLAP/OCN | |||||||||||||||||||||||||||||||||||||
| SPP1/OPN | |||||||||||||||||||||||||||||||||||||
| RUNX2 | |||||||||||||||||||||||||||||||||||||
| COL1A1 | |||||||||||||||||||||||||||||||||||||
| MKI67 | |||||||||||||||||||||||||||||||||||||
| POSTN | |||||||||||||||||||||||||||||||||||||
| HIF1A | |||||||||||||||||||||||||||||||||||||
| ARNT/HIF1B | |||||||||||||||||||||||||||||||||||||
| EPAS1/HIF2A | |||||||||||||||||||||||||||||||||||||
| HIF3A | |||||||||||||||||||||||||||||||||||||
| COPS5 | |||||||||||||||||||||||||||||||||||||
| HIF1AN | |||||||||||||||||||||||||||||||||||||
| NCOA1 |
Red highlight denotes a significant negative correlation (p<0.02) and green highlight denotes a significant positive correlation (p<0.02).
Circadian rhythm gene expression related to inflammatory and tissue destructive/remodeling genes
A similar assessment was made regarding circadian rhythm genes in health, disease, and resolution samples of ligature-induced periodontitis. For the inflammatory mediators (Fig 4A) Healthy tissue samples (ie. Baseline) showed rather limited correlations with inflammatory mediators, although there appeared some predilection for a relationship to TGFB1 expression. With disease the frequency of significant correlations with inflammatory mediators increased substantially. Additionally, the majority were negative correlations particularly targeted towards TNF, IL1B, and IL6. However, of note, NFIL3, FOS and MIR155 were significantly positively correlated with the bulk of these mediators. Resolution samples demonstrated a limited number of correlations, with TNF and TGFB1 most dominant and circadian representing genes, PTEN and USP2, exhibiting an elevated frequency of these correlations.
Fig 4.
Circadian rhythm pathway gene expression profiles in health, disease, or resolution samples across all age groups correlated with inflammatory genes (A), tissue destructive/remodeling genes (B), bone biology genes (C), and hypoxia genes (D). Functional designation of the genes are as in Fig 1. Values denoted by asterisk (*) were significant at p<0.01.
While a limited number of correlations were noted with the tissue destruction/ remodeling genes in healthy samples (Fig 4B), MMP7 and MMP9 showed the most frequent correlations, and RORB (positive) and ARNTL2 (negative) circadian genes showed multiple significant correlations. Similar to inflammatory genes, correlations with the tissue destruction/remodeling genes were quite frequent with disease. However, in contrast to the inflammatory genes, the preponderance of these responses were positive correlations particularly related to MMP7 and MMP9, and PER2 was positively correlated with all tissue genes but MMP9. Also, numerous circadian genes were negatively correlated with levels of MMP9 expression, and both RPS6KA5/MSK1 and NFE2L2 genes highly correlated with multiple of these tissue destruction/remodeling genes. In resolution samples, the results differed from the inflammatory gene relationships; many circadian genes demonstrated significant correlations with the tissue destruction/remodeling genes. These were enriched for correlations with MMP7, MMP9, and MMP2. Interestingly, RPTOR and BMI1 were positively correlated and EZH2 was negatively correlated with the set of CTSK, MMP14, and MMP2 genes.
Circadian rhythm gene expression related to bone biology genes
Bone resorptive processes are a hallmark of periodontitis being driven by heightened numbers and activity of osteoclasts [45–49]. In healthy samples from the animals, very few of the bone biology genes were robustly correlated with the circadian pathway genes (Fig 4C). These relationships were increased during disease with a wide array of circadian genes significantly correlated with the bone biology genes. However, relative to general functional categorization of the circadian genes there did not appear to be a particular functional category that dominated. In resolution samples, a number of the circadian genes showed individualized correlations with bone biology genes; however, there was no apparent predilection for these interactions.
Circadian rhythm gene expression related to hypoxia pathway genes
The transition from a symbiotic to dysbiotic microbiome with periodontitis clearly reflects an increasing composition of anaerobic bacteria, supporting the hypoxic nature of the lesions [43,50]. Moreover, chronic inflammation has also been shown to result in tissue hypoxia, thus, examination of the potential role of circadian genes related to these hypoxic changes was explored. In health (Fig 4D) there was a large array of correlations between circadian and hypoxia-related genes, with the majority of these being significant positive correlations. Of particular note was the extensive negative correlations between circadian genes and the major hypoxia transcription factor, HIF1A. This pattern was maintained with disease, although an increased number of circadian genes now showed significant positive correlations with HIF1A. The frequency of the correlations decreased in resolution samples; however, HIF1A remained negatively correlated with numerous circadian genes.
Table 4 provides a summary of these relationships of the circadian pathway genes and these localized biological function genes in the gingival tissues. With inflammatory and tissue destructive/remodeling genes, a dominant number of these correlations were observed with disease, while fewer were noted in health, with resolution samples trending towards the frequency seen in diseased samples, in particular related to MMP7 and MMP9. A high frequency of these correlations were found with the circadian rhythm genes, MSK1, RORA, NFE2L2, NFIL3, FOS, CRY2, MIR155, and PER2. Additionally, TNF, IL1B, IL6, MMP2, MMP7 and MMP9 demonstrated a broad array of correlations across the circadian genes.
Table 4. Significant correlations of circadian rhythm genes with inflammation, tissue destructive/remodeling, bone biology, and hypoxia genes from longitudinal study of ligature-induced periodontitis, healthy, and resolution gingival samples.
| HEALTH | ||||||||||||||||||||||||||||||||||||||||
| FBXL21 | FBXL3 | RPTOR | RICTOR | ROMO1 | PTEN | MSK1 | CSNK1D | CSNK1E | RORA | RORB | RORC | ARNTL | ARNTL2 | CLOCK | NPAS2 | DBP | NFE2L2 | NFIL3 | FOS | CREB1 | NR1D1 | NR1D2 | BMI1 | EZH2 | BHLHE40 | BHLHE41 | CIPC | CRY1 | CRY2 | MIR155 | PER1 | PER2 | PER3 | HDAC3 | DNMT1 | HNF4A | ID2 | USP2 | BTRC | |
| TNF | ||||||||||||||||||||||||||||||||||||||||
| IL1B | ||||||||||||||||||||||||||||||||||||||||
| IL6 | ||||||||||||||||||||||||||||||||||||||||
| IL10 | ||||||||||||||||||||||||||||||||||||||||
| IL4 | ||||||||||||||||||||||||||||||||||||||||
| TGFB1 | ||||||||||||||||||||||||||||||||||||||||
| CTSK | ||||||||||||||||||||||||||||||||||||||||
| MMP14 | ||||||||||||||||||||||||||||||||||||||||
| MMP2 | ||||||||||||||||||||||||||||||||||||||||
| MMP7 | ||||||||||||||||||||||||||||||||||||||||
| MMP9 | ||||||||||||||||||||||||||||||||||||||||
| TNFRSF11B/OPG | ||||||||||||||||||||||||||||||||||||||||
| TNFSF11/RANKL | ||||||||||||||||||||||||||||||||||||||||
| BGLAP/OCN | ||||||||||||||||||||||||||||||||||||||||
| SPP1/OPN | ||||||||||||||||||||||||||||||||||||||||
| RUNX2 | ||||||||||||||||||||||||||||||||||||||||
| COL1A1 | ||||||||||||||||||||||||||||||||||||||||
| MKI67 | ||||||||||||||||||||||||||||||||||||||||
| POSTN | ||||||||||||||||||||||||||||||||||||||||
| HIF1A | ||||||||||||||||||||||||||||||||||||||||
| ARNT/HIF1B | ||||||||||||||||||||||||||||||||||||||||
| EPAS1/HIF2A | ||||||||||||||||||||||||||||||||||||||||
| HIF3A | ||||||||||||||||||||||||||||||||||||||||
| COPS5 | ||||||||||||||||||||||||||||||||||||||||
| HIF1AN | ||||||||||||||||||||||||||||||||||||||||
| NCOA1 | ||||||||||||||||||||||||||||||||||||||||
| DISEASE | ||||||||||||||||||||||||||||||||||||||||
| FBXL21 | FBXL3 | RPTOR | RICTOR | ROMO1 | PTEN | MSK1 | CSNK1D | CSNK1E | RORA | RORB | RORC | ARNTL | ARNTL2 | CLOCK | NPAS2 | DBP | NFE2L2 | NFIL3 | FOS | CREB1 | NR1D1 | NR1D2 | BMI1 | EZH2 | BHLHE40 | BHLHE41 | CIPC | CRY1 | CRY2 | MIR155 | PER1 | PER2 | PER3 | HDAC3 | DNMT1 | HNF4A | ID2 | USP2 | BTRC | |
| TNF | ||||||||||||||||||||||||||||||||||||||||
| IL1B | ||||||||||||||||||||||||||||||||||||||||
| IL6 | ||||||||||||||||||||||||||||||||||||||||
| IL10 | ||||||||||||||||||||||||||||||||||||||||
| IL4 | ||||||||||||||||||||||||||||||||||||||||
| TGFB1 | ||||||||||||||||||||||||||||||||||||||||
| CTSK | ||||||||||||||||||||||||||||||||||||||||
| MMP14 | ||||||||||||||||||||||||||||||||||||||||
| MMP2 | ||||||||||||||||||||||||||||||||||||||||
| MMP7 | ||||||||||||||||||||||||||||||||||||||||
| MMP9 | ||||||||||||||||||||||||||||||||||||||||
| TNFRSF11B/OPG | ||||||||||||||||||||||||||||||||||||||||
| TNFSF11/RANKL | ||||||||||||||||||||||||||||||||||||||||
| BGLAP/OCN | ||||||||||||||||||||||||||||||||||||||||
| SPP1/OPN | ||||||||||||||||||||||||||||||||||||||||
| RUNX2 | ||||||||||||||||||||||||||||||||||||||||
| COL1A1 | ||||||||||||||||||||||||||||||||||||||||
| MKI67 | ||||||||||||||||||||||||||||||||||||||||
| POSTN | ||||||||||||||||||||||||||||||||||||||||
| HIF1A | ||||||||||||||||||||||||||||||||||||||||
| ARNT/HIF1B | ||||||||||||||||||||||||||||||||||||||||
| EPAS1/HIF2A | ||||||||||||||||||||||||||||||||||||||||
| HIF3A | ||||||||||||||||||||||||||||||||||||||||
| COPS5 | ||||||||||||||||||||||||||||||||||||||||
| HIF1AN | ||||||||||||||||||||||||||||||||||||||||
| NCOA1 | ||||||||||||||||||||||||||||||||||||||||
| RESOLUTION | ||||||||||||||||||||||||||||||||||||||||
| FBXL21 | FBXL3 | RPTOR | RICTOR | ROMO1 | PTEN | MSK1 | CSNK1D | CSNK1E | PRKAA1 | RORA | RORB | RORC | ARNTL | ARNTL2 | CLOCK | NPAS2 | DBP | NFE2L2 | NFIL3 | FOS | CREB1 | NR1D1 | NR1D2 | BMI1 | EZH2 | BHLHE40 | BHLHE41 | CRY1 | CRY2 | MIR155 | PER1 | PER2 | PER3 | HDAC3 | DNMT1 | HNF4A | ID2 | USP2 | BTRC | |
| TNF | ||||||||||||||||||||||||||||||||||||||||
| IL1B | ||||||||||||||||||||||||||||||||||||||||
| IL6 | ||||||||||||||||||||||||||||||||||||||||
| IL10 | ||||||||||||||||||||||||||||||||||||||||
| IL4 | ||||||||||||||||||||||||||||||||||||||||
| TGFB1 | ||||||||||||||||||||||||||||||||||||||||
| CTSK | ||||||||||||||||||||||||||||||||||||||||
| MMP14 | ||||||||||||||||||||||||||||||||||||||||
| MMP2 | ||||||||||||||||||||||||||||||||||||||||
| MMP7 | ||||||||||||||||||||||||||||||||||||||||
| MMP9 | ||||||||||||||||||||||||||||||||||||||||
| TNFRSF11B/OPG | ||||||||||||||||||||||||||||||||||||||||
| TNFSF11/RANKL | ||||||||||||||||||||||||||||||||||||||||
| BGLAP/OCN | ||||||||||||||||||||||||||||||||||||||||
| SPP1/OPN | ||||||||||||||||||||||||||||||||||||||||
| RUNX2 | ||||||||||||||||||||||||||||||||||||||||
| COL1A1 | ||||||||||||||||||||||||||||||||||||||||
| MKI67 | ||||||||||||||||||||||||||||||||||||||||
| POSTN | ||||||||||||||||||||||||||||||||||||||||
| HIF1A | ||||||||||||||||||||||||||||||||||||||||
| ARNT/HIF1B | ||||||||||||||||||||||||||||||||||||||||
| EPAS1/HIF2A | ||||||||||||||||||||||||||||||||||||||||
| HIF3A | ||||||||||||||||||||||||||||||||||||||||
| COPS5 | ||||||||||||||||||||||||||||||||||||||||
| HIF1AN | ||||||||||||||||||||||||||||||||||||||||
| NCOA1 | ||||||||||||||||||||||||||||||||||||||||
Red highlight denotes a significant negative correlation (p<0.02) and green highlight denotes a significant positive correlation (p<0.02).
With respect to the bone biology genes, there was a limited array of interactions in healthy tissues (Table 4). With disease, RANKL, MKI67, and POSTN demonstrated numerous correlations with the circadian genes, with RICTOR, DBP, CREB1, and EZH2 showing association with multiple bone biology genes. In resolution samples, numerous correlations with the circadian genes were shown with SPP1/OPN, COL1A1, MKI67, and POSTN bone biology genes. Only DBP and EZH2 circadian genes exhibited frequent correlations with the bone biology genes with disease resolution. Additionally there was substantial overlap in the repertoire of circadian genes demonstrating multiple correlations with the bone biology genes, including RORA and PER1 in health, RPTOR, RORA, DBP, NR1D2, PER1, and USP2 in disease, and RORA and DBP in resolution samples.
In health and disease, except for HIF1A, virtually all of the correlations between circadian and hypoxia genes were positive (Table 4). With disease, the circadian genes RPTOR, RORA, DBP, EZH2, MIR155, PER2, PER3 and USP2 were all enriched for these correlations. Interestingy, both FOS and PER demonstrated somewhat unique patterns of negative correlations with an array of the hypoxia genes, except for HIF1A that was positively correlated with these circadian genes. Resolution samples showed more limited relationships for circadian and hypoxia genes; however, the pattern with negative correlations with HIF1A remained. Additionally, RORA was unique in showing numerous correlations.
Circadian gene interactome
Fig 5 provides a schematic of the potential circadian gene interactome within the healthy and diseased gingival tissues. The first notable observation is that the majority of differential expression of these genes in healthy tissues of both younger and older individuals was decreased (down-regulated) compared to adult levels. Additionally, longitudinal changes in expression with disease were also generally decreased compared to baseline healthy tissues. Comparison of levels of the circadian pathway genes did appear to identify substantial differences in ARNT/BMAL1, FOS, NFIL3, and RORA that varied in healthy and diseased tissues.
Fig 5. Schematic of interactome of circadian rhythm and circadian-associated genes denoted by black lines connecting the nodes.
Colored nodes denote functional categorization of each gene. Green and red symbols denote significant differences in expression in healthy samples (young/adolescent/aged versus adult) or comparing naturally-occurring disease (versus health) and ligature-induced disease (versus baseline healthy samples).
Discussion
While it is clear that aspects of the oral microbiome trigger a dysregulation of host responses resulting in periodontal lesions, data are still lacking regarding the detailed molecular features of these processes that dictate the initiation, progression and resolution of an individual lesion. An array of host response characteristics [28,40,51–62], which might be predicted to be affected with disease, have been identified with disease. However, some unexpected response profiles and gene polymorphisms [63–69] have been observed with disease. This report describes results of another novel pathway, circadian rhythm, which is altered with both aging and periodontitis.
Inflammation can affect circadian clock pathways [1,4,8,10,70], and clock genes affect the development of various chronic inflammatory diseases, as well as increasing their severity [5]. This study examined circadian pathway gene expression and its relationship to genes associated with tissue alterations occurring in disease using a nonhuman primate model of naturally-occurring and ligature-induced periodontitis. Circadian pathway genes showed some differential expression in healthy tissues from young and adolescent animals compared to adult levels. These were primarily represented by genes related to transcription activator, transcription regulator, and transcription factor functions. In contrast, periodontitis tissues showed an array of genes, including kinases and a broad array of transcription-associated genes related to circadian rhythm that were altered, generally decreased, in both adult and aged tissues. This could be of interest related to the clear evidence of increases in prevalence and severity of periodontitis with age. Extensive variation in aging processes occurs across the human population, and contribute to differences in time of onset of age-associated diseases. Within the mucosa, and specifically oral mucosa, that is continually under septic challenge it must be expected that a combination of multiple pathways are necessary for tissue homeostasis, while substantial breakdown in an individual pathway could significantly enhance risk for disease. Thus, the down-regulation of genes of the circadian pathway with aging could reflect one mechanism increasing the risk for disease on older individuals. The data that showed a general down-regulation of genes that would regulate the circadian pathway with periodontitis is consistent with reports on age effects on maintaining normal circadian rhythm processes and the impact of infection and inflammation on these processes. As periodontitis presents both of these features, this relationship might be expected. However, lacking in this cross-sectional model of naturally-occurring disease is insights into the kinetics of the relationship. Thus, does periodontitis drive alterations in cellular circadian rhythm contributing to chronicity, or does an altered regulation of the circadian pathway increase the risk for triggering the initiation and progression of disease. Further studies will need to be developed potentially with small animal models, albeit, the longitudinal experimental periodontitis models in the nonhuman primates provided some additional guidance.
As in naturally-occurring disease, generally the circadian rhythm gene expression was significantly decreased with ligature-induced periodontitis and this was observed in all age groups. Similar genes were affected, and the timing of these changes during disease initiation and progression appeared generally similar, as has been reported in rheumatoid arthritis [1] and in response to microbial stimulation [11,13,71]. Altered regulation of the circadian rhythm pathway can elevate intracellular production of reactive oxygen species [72] and links directly to the mTOR and PI3K signaling processes related to apoptosis and autophagy [73], as well as processes contributing to cellular senescence [74]. As the circadian rhythm pathway demonstrates multiple control levels, components of the negative feedback loop that are up-regulated by CLOCK and ARNT/BMAL1 include PER1/2/3 and CRY1/2, as well as NR1D1/NR1D2 (REV-ERBα/β) [2]. Of particular interest was that many of these specific genes were significantly altered with periodontitis in the gingival tissues and remained affected even with clinical disease resolution that could be predicted to increase the risk for disease progression, and negatively impact biological resolution. Of interest from this model was that many of the changes in circadian rhythm gene expression were noted as early as 2 weeks post-ligature placement during disease initiation in all age groups. These appeared coincident with increases in inflammation (ie. BOP), but generally were noted prior to the increases in destructive disease measures (ie. PPD). These circadian rhythm gene changes were also observed in the younger animals with more minimal disease expression. Additionally, many of these down-regulated responses were maintained in the clinical resolution samples. Each of these observations suggest that altered circadian rhythm pathway functions may presage and contribute to the risk for disease.
Circadian genes contribute to development of B cells and pro-inflammatory responses [1] in response to infection [2]. This pathway genes also interact with the NF-κB transcription processes [75] to regulate a variety of inflammatory cytokines [76,77] and alter levels of various response molecules in inflammatory reactions [78–80]. Studies of circadian rhythm functions in the oral cavity include data with oral bacteria (ie. P. gingivalis) [81] and outcomes of oral cells [82] showing effects on this pathway. Moreover, circadian genes have been associated with altered bone metabolism and osteoclast functions [82–84]. Finally, some limited information is available regarding circadian gene expression modulated by hypoxia in oral cells [85,86]. Thus, we explored if the circadian rhythm genes specifically related to various host response components that are present in health and disease in the periodontium. We identified various circadian rhythm genes that significantly correlated with the inflammatory genes and tissue destructive/remodeling genes. These generally were negative correlations, albeit some selected genes related to the circadian pathway were significantly positively correlated (NFIL3, FOS, MIR155). With resolution, the circadian rhythm genes demonstrated significant correlations primarily with the tissue destruction/remodeling genes. The frequency of significant correlations of wide array of circadian rhythm genes and those related to bone biology was generally increased during disease progression. A large array of positive correlations between circadian and hypoxia-related genes was observed in healthy tissue samples. However, an extensive frequency of negative correlations occurred between circadian genes and the major hypoxia transcription factor, HIF1A, in health and resolution, while an increased number of circadian genes showed significant positive correlations with HIF1A in disease. Thus, a clear interaction between the circadian rhythm pathway and potential for important regulation of inflammation, tissue destructive molecules, biomolecules of bone biology, and a tissue hypoxia microenvironment affecting the health of the periodontium was apparent. However, one primary interpretation of the data was that the effects on the circadian genes across the age groups with the development of periodontitis was actually quite similar, rather than substantially different, and in disease there was a somewhat distinctive pattern of circadian gene and local tissue biology gene expression. This observation actually differed from a number of our other analyses targeting immune and inflammatory pathways in gingival tissues that demonstrated substantial differences in expression and regulation with age and disease [31,33,37,38,55,87–90]. Thus, the effects on this pathway seemed to be “conserved” in disease.
While it needs to be acknowledged that many of these circadian pathway transcription regulators and factors have overlap with numerous other cellular pathways, including immune response regulation, apoptosis, autophagy, oxidative stress responses, and fundamental control of cellular survival, there exists substantial data showing mechanistic links of circadian clock functions with health and disease [17]. This is the first study to document in situ relationships of genes contributing to this critical host pathway to features of the biology of the mucosal gingival tissues. Importantly, experimental manipulations that can be accomplished in this nonhuman primate disease model, limited clear cause-and-effect conclusions regarding the relationship of the circadian rhythm pathway to molecular aspects of periodontitis triggering pathways. However, the interesting features of circadian pathway changes and correlations with local tissue environmental gene expression may help explain disease variation, as well as suggesting the potential for new targets for management of this chronic disease.
Data Availability
The data has been uploaded into the ArrayExpress data base (www.ebi.ac.uk) under accession number: E-MTAB-1977 and into GEO accession GSE180588 (https://www.ncbi.nlm.nih.gov/gds).
Funding Statement
This work was supported by NIH National Institute of General Medical Sciences grant P20GM103538 to JLE. We express our gratitude to the Caribbean Primate Research Center (CPRC) supported by NIH National Center for Research Resources grant P40RR03640 to Dr. Melween Martinez, and specifically Drs. Janis Gonzalez Martinez, Luis Orraca, and Armando Burgos, and the Center for Oral Health Research in the College of Dentistry at the University of Kentucky, especially Dr. Sreenatha Kirakodu. We also thank the Microarray Core of University Kentucky for their invaluable technical assistance, and Dr. Arnold Stromberg for initial normalization of the microarray data. The authors acknowledge no conflict of interest with the content of this report. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Carter SJ, Durrington HJ, Gibbs JE, Blaikley J, Loudon AS, Ray DW, et al. A matter of time: study of circadian clocks and their role in inflammation. Journal of leukocyte biology. 2016;99(4):549–60. doi: 10.1189/jlb.3RU1015-451R . [DOI] [PubMed] [Google Scholar]
- 2.McAlpine CS, Swirski FK. Circadian Influence on Metabolism and Inflammation in Atherosclerosis. Circulation research. 2016;119(1):131–41. doi: 10.1161/CIRCRESAHA.116.308034 ; PubMed Central PMCID: PMC4922503. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Sellix MT, Evans JA, Leise TL, Castanon-Cervantes O, Hill DD, DeLisser P, et al. Aging differentially affects the re-entrainment response of central and peripheral circadian oscillators. J Neurosci. 2012;32(46):16193–202. doi: 10.1523/JNEUROSCI.3559-12.2012 ; PubMed Central PMCID: PMC3507430. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Castanon-Cervantes O, Wu M, Ehlen JC, Paul K, Gamble KL, Johnson RL, et al. Dysregulation of inflammatory responses by chronic circadian disruption. J Immunol. 2010;185(10):5796–805. doi: 10.4049/jimmunol.1001026 ; PubMed Central PMCID: PMC2974025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Kizaki T, Sato S, Shirato K, Sakurai T, Ogasawara J, Izawa T, et al. Effect of Circadian Rhythm on Clinical and Pathophysiological Conditions and Inflammation. Critical reviews in immunology. 2015;35(4):261–75. doi: 10.1615/critrevimmunol.2015014925 . [DOI] [PubMed] [Google Scholar]
- 6.Shivshankar P, Fekry B, Eckel-Mahan K, Wetsel RA. Circadian Clock and Complement Immune System-Complementary Control of Physiology and Pathology? Frontiers in cellular and infection microbiology. 2020;10:418. doi: 10.3389/fcimb.2020.00418 ; PubMed Central PMCID: PMC7456827. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Ramsey AM, Stowie A, Castanon-Cervantes O, Davidson AJ. Environmental Circadian Disruption Increases Stroke Severity and Dysregulates Immune Response. J Biol Rhythms. 2020;35(4):368–76. doi: 10.1177/0748730420929450 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Pourcet B, Duez H. Circadian Control of Inflammasome Pathways: Implications for Circadian Medicine. Frontiers in immunology. 2020;11:1630. doi: 10.3389/fimmu.2020.01630 ; PubMed Central PMCID: PMC7410924. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Hergenhan S, Holtkamp S, Scheiermann C. Molecular Interactions Between Components of the Circadian Clock and the Immune System. Journal of molecular biology. 2020;432(12):3700–13. doi: 10.1016/j.jmb.2019.12.044 ; PubMed Central PMCID: PMC7322557. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Baxter M, Ray DW. Circadian rhythms in innate immunity and stress responses. Immunology. 2019. doi: 10.1111/imm.13166 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Curtis AM, Fagundes CT, Yang G, Palsson-McDermott EM, Wochal P, McGettrick AF, et al. Circadian control of innate immunity in macrophages by miR-155 targeting Bmal1. Proc Natl Acad Sci U S A. 2015;112(23):7231–6. doi: 10.1073/pnas.1501327112 ; PubMed Central PMCID: PMC4466714. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Silver AC, Arjona A, Walker WE, Fikrig E. The circadian clock controls toll-like receptor 9-mediated innate and adaptive immunity. Immunity. 2012;36(2):251–61. doi: 10.1016/j.immuni.2011.12.017 ; PubMed Central PMCID: PMC3315694. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Gibbs JE, Blaikley J, Beesley S, Matthews L, Simpson KD, Boyce SH, et al. The nuclear receptor REV-ERBalpha mediates circadian regulation of innate immunity through selective regulation of inflammatory cytokines. Proc Natl Acad Sci U S A. 2012;109(2):582–7. doi: 10.1073/pnas.1106750109 ; PubMed Central PMCID: PMC3258648. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Arjona A, Silver AC, Walker WE, Fikrig E. Immunity’s fourth dimension: approaching the circadian-immune connection. Trends Immunol. 2012;33(12):607–12. doi: 10.1016/j.it.2012.08.007 ; PubMed Central PMCID: PMC3712756. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Waggoner SN. Circadian Rhythms in Immunity. Current allergy and asthma reports. 2020;20(1):2. doi: 10.1007/s11882-020-0896-9 ; PubMed Central PMCID: PMC7357859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Timmons GA, O’Siorain JR, Kennedy OD, Curtis AM, Early JO. Innate Rhythms: Clocks at the Center of Monocyte and Macrophage Function. Frontiers in immunology. 2020;11:1743. doi: 10.3389/fimmu.2020.01743 ; PubMed Central PMCID: PMC7417365. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kim SM, Neuendorff N, Alaniz RC, Sun Y, Chapkin RS, Earnest DJ. Shift work cycle-induced alterations of circadian rhythms potentiate the effects of high-fat diet on inflammation and metabolism. FASEB J. 2018;32(6):3085–95. doi: 10.1096/fj.201700784R ; PubMed Central PMCID: PMC5956251. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Comas M, Gordon CJ, Oliver BG, Stow NW, King GL, Sharma P, et al. A circadian bsed inflammatory response—implications for respiratory disease and treatment. Sleep Science and Practice. 2017;1:18. doi: 10.1186/s41606-017-0019-2 [DOI] [Google Scholar]
- 19.Rahman SA, Castanon-Cervantes O, Scheer FA, Shea SA, Czeisler CA, Davidson AJ, et al. Endogenous circadian regulation of pro-inflammatory cytokines and chemokines in the presence of bacterial lipopolysaccharide in humans. Brain Behav Immun. 2015;47:4–13. doi: 10.1016/j.bbi.2014.11.003 ; PubMed Central PMCID: PMC4430446. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Mazzoccoli G, Vinciguerra M, Carbone A, Relogio A. The Circadian Clock, the Immune System, and Viral Infections: The Intricate Relationship Between Biological Time and Host-Virus Interaction. Pathogens. 2020;9(2). doi: 10.3390/pathogens9020083 ; PubMed Central PMCID: PMC7168639. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Diallo AB, Coiffard B, Leone M, Mezouar S, Mege JL. For Whom the Clock Ticks: Clinical Chronobiology for Infectious Diseases. Frontiers in immunology. 2020;11:1457. doi: 10.3389/fimmu.2020.01457 ; PubMed Central PMCID: PMC7363845. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Costantini C, Renga G, Sellitto F, Borghi M, Stincardini C, Pariano M, et al. Microbes in the Era of Circadian Medicine. Frontiers in cellular and infection microbiology. 2020;10:30. doi: 10.3389/fcimb.2020.00030 ; PubMed Central PMCID: PMC7013081. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Butler TD, Gibbs JE. Circadian Host-Microbiome Interactions in Immunity. Frontiers in immunology. 2020;11:1783. doi: 10.3389/fimmu.2020.01783 ; PubMed Central PMCID: PMC7456996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Gombert M, Carrasco-Luna J, Pin-Arboledas G, Codoner-Franch P. The connection of circadian rhythm to inflammatory bowel disease. Transl Res. 2019;206:107–18. doi: 10.1016/j.trsl.2018.12.001 . [DOI] [PubMed] [Google Scholar]
- 25.Cutolo M, Straub RH. Circadian rhythms in arthritis: hormonal effects on the immune/inflammatory reaction. Autoimmunity reviews. 2008;7(3):223–8. doi: 10.1016/j.autrev.2007.11.019 . [DOI] [PubMed] [Google Scholar]
- 26.Chapple ILC, Mealey BL, Van Dyke TE, Bartold PM, Dommisch H, Eickholz P, et al. Periodontal health and gingival diseases and conditions on an intact and a reduced periodontium: Consensus report of workgroup 1 of the 2017 World Workshop on the Classification of Periodontal and Peri-Implant Diseases and Conditions. J Periodontol. 2018;89 Suppl 1:S74–S84. doi: 10.1002/JPER.17-0719 . [DOI] [PubMed] [Google Scholar]
- 27.Gonzalez OA, Novak MJ, Kirakodu S, Stromberg AJ, Shen S, Orraca L, et al. Effects of aging on apoptosis gene expression in oral mucosal tissues. Apoptosis: an international journal on programmed cell death. 2013;18(3):249–59. Epub 2013/01/22. doi: 10.1007/s10495-013-0806-x ; PubMed Central PMCID: PMC3592930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Gonzalez OA, Stromberg AJ, Huggins PM, Gonzalez-Martinez J, Novak MJ, Ebersole JL. Apoptotic genes are differentially expressed in aged gingival tissue. J Dent Res. 2011;90(7):880–6. doi: 10.1177/0022034511403744 ; PubMed Central PMCID: PMC3148008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ebersole JL, Steffen MJ, Reynolds MA, Branch-Mays GL, Dawson DR, Novak KF, et al. Differential gender effects of a reduced-calorie diet on systemic inflammatory and immune parameters in nonhuman primates. J Periodontal Res. 2008;43(5):500–7. Epub 2008/06/21. JRE1051 [pii] doi: 10.1111/j.1600-0765.2008.01051.x . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Ebersole J, Kirakodu S, Chen J, Nagarajan R, Gonzalez OA. Oral Microbiome and Gingival Transcriptome Profiles of Ligature-Induced Periodontitis. J Dent Res. 2020;99(6):746–57. doi: 10.1177/0022034520906138 ; PubMed Central PMCID: PMC7243415. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Ebersole JL, Orraca L, Novak MJ, Kirakodu S, Gonzalez-Martinez J, Gonzalez OA. Comparative Analysis of Gene Expression Patterns for Oral Epithelium-Related Functions with Aging. Adv Exp Med Biol. 2019;1197:143–63. doi: 10.1007/978-3-030-28524-1_11 . [DOI] [PubMed] [Google Scholar]
- 32.Ebersole JL, Kirakodu S, Novak MJ, Orraca L, Stormberg AJ, Gonzalez-Martinez J, et al. Comparative analysis of expression of microbial sensing molecules in mucosal tissues with periodontal disease. Immunobiology. 2019;224(2):196–206. doi: 10.1016/j.imbio.2018.11.007 ; PubMed Central PMCID: PMC6486441. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Ebersole JL, Kirakodu S, Novak MJ, Stromberg AJ, Shen S, Orraca L, et al. Cytokine gene expression profiles during initiation, progression and resolution of periodontitis. J Clin Periodontol. 2014. doi: 10.1111/jcpe.12286 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Ebersole JL, Steffen MJ, Gonzalez-Martinez J, Novak MJ. Effects of age and oral disease on systemic inflammatory and immune parameters in nonhuman primates. Clin Vaccine Immunol. 2008;15(7):1067–75. Epub 2008/05/02. CVI.00258-07 [pii] doi: 10.1128/CVI.00258-07 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Ebersole JL, Nguyen L, Gonzalez OA. Gingival tissue antibody gene utilization in aging and periodontitis. Journal of Immunology. 2021. [DOI] [PubMed] [Google Scholar]
- 36.Gonzalez OA, Novak MJ, Kirakodu S, Stromberg A, Nagarajan R, Huang CB, et al. Differential Gene Expression Profiles Reflecting Macrophage Polarization in Aging and Periodontitis Gingival Tissues. Immunological investigations. 2015;44(7):643–64. doi: 10.3109/08820139.2015.1070269 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Gonzalez OA, Novak MJ, Kirakodu S, Orraca L, Chen KC, Stromberg A, et al. Comparative analysis of gingival tissue antigen presentation pathways in ageing and periodontitis. J Clin Periodontol. 2014;41(4):327–39. doi: 10.1111/jcpe.12212 ; PubMed Central PMCID: PMC3951170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Gonzalez OA, John Novak M, Kirakodu S, Stromberg AJ, Shen S, Orraca L, et al. Effects of aging on apoptosis gene expression in oral mucosal tissues. Apoptosis. 2013;18(3):249–59. doi: 10.1007/s10495-013-0806-x ; PubMed Central PMCID: PMC3592930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Meka A, Bakthavatchalu V, Sathishkumar S, Lopez MC, Verma RK, Wallet SM, et al. Porphyromonas gingivalis infection-induced tissue and bone transcriptional profiles. Mol Oral Microbiol. 2010;25(1):61–74. doi: 10.1111/j.2041-1014.2009.00555.x ; PubMed Central PMCID: PMC3001241. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Ebersole JL, Dawson D 3rd, Emecen-Huja P, Nagarajan R, Howard K, Grady ME, et al. The periodontal war: microbes and immunity. Periodontol 2000. 2017;75(1):52–115. doi: 10.1111/prd.12222 . [DOI] [PubMed] [Google Scholar]
- 41.Zhang S, Yu N, Arce RM. Periodontal inflammation: Integrating genes and dysbiosis. Periodontol 2000. 2020;82(1):129–42. doi: 10.1111/prd.12267 ; PubMed Central PMCID: PMC6924568. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Loos BG, Van Dyke TE. The role of inflammation and genetics in periodontal disease. Periodontol 2000. 2020;83(1):26–39. doi: 10.1111/prd.12297 ; PubMed Central PMCID: PMC7319430. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Curtis MA, Diaz PI, Van Dyke TE. The role of the microbiota in periodontal disease. Periodontol 2000. 2020;83(1):14–25. doi: 10.1111/prd.12296 . [DOI] [PubMed] [Google Scholar]
- 44.Moutsopoulos NM, Konkel JE. Tissue-Specific Immunity at the Oral Mucosal Barrier. Trends Immunol. 2018;39(4):276–87. doi: 10.1016/j.it.2017.08.005 ; PubMed Central PMCID: PMC5843496. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Shin J, Maekawa T, Abe T, Hajishengallis E, Hosur K, Pyaram K, et al. DEL-1 restrains osteoclastogenesis and inhibits inflammatory bone loss in nonhuman primates. Science translational medicine. 2015;7(307):307ra155. doi: 10.1126/scitranslmed.aac5380 ; PubMed Central PMCID: PMC4593066. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Souza PP, Lerner UH. The role of cytokines in inflammatory bone loss. Immunological investigations. 2013;42(7):555–622. doi: 10.3109/08820139.2013.822766 . [DOI] [PubMed] [Google Scholar]
- 47.Jiao Y, Darzi Y, Tawaratsumida K, Marchesan JT, Hasegawa M, Moon H, et al. Induction of bone loss by pathobiont-mediated Nod1 signaling in the oral cavity. Cell host & microbe. 2013;13(5):595–601. doi: 10.1016/j.chom.2013.04.005 ; PubMed Central PMCID: PMC3721316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Cochran DL. Inflammation and bone loss in periodontal disease. J Periodontol. 2008;79(8 Suppl):1569–76. doi: 10.1902/jop.2008.080233 . [DOI] [PubMed] [Google Scholar]
- 49.Belibasakis GN, Bostanci N. The RANKL-OPG system in clinical periodontology. J Clin Periodontol. 2012;39(3):239–48. doi: 10.1111/j.1600-051X.2011.01810.x . [DOI] [PubMed] [Google Scholar]
- 50.Solbiati J, Frias-Lopez J. Metatranscriptome of the Oral Microbiome in Health and Disease. J Dent Res. 2018;97(5):492–500. doi: 10.1177/0022034518761644 ; PubMed Central PMCID: PMC5958373. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Alvarez C, Rojas C, Rojas L, Cafferata EA, Monasterio G, Vernal R. Regulatory T Lymphocytes in Periodontitis: A Translational View. Mediators Inflamm. 2018;2018:7806912. doi: 10.1155/2018/7806912 ; PubMed Central PMCID: PMC5901475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Hajishengallis G, Kajikawa T, Hajishengallis E, Maekawa T, Reis ES, Mastellos DC, et al. Complement-Dependent Mechanisms and Interventions in Periodontal Disease. Frontiers in immunology. 2019;10:406. doi: 10.3389/fimmu.2019.00406 ; PubMed Central PMCID: PMC6422998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Hajishengallis G. Aging and its Impact on Innate Immunity and Inflammation: Implications for Periodontitis. Journal of oral biosciences / JAOB, Japanese Association for Oral Biology. 2014;56(1):30–7. doi: 10.1016/j.job.2013.09.001 ; PubMed Central PMCID: PMC3974203. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Hajishengallis G. Immunomicrobial pathogenesis of periodontitis: keystones, pathobionts, and host response. Trends Immunol. 2014;35(1):3–11. doi: 10.1016/j.it.2013.09.001 ; PubMed Central PMCID: PMC3947349. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Ebersole JL, Kirakodu SS, Novak MJ, Orraca L, Martinez JG, Cunningham LL, et al. Transcriptome Analysis of B Cell Immune Functions in Periodontitis: Mucosal Tissue Responses to the Oral Microbiome in Aging. Frontiers in immunology. 2016;7:272. doi: 10.3389/fimmu.2016.00272 ; PubMed Central PMCID: PMC4947588. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Demmer RT, Behle JH, Wolf DL, Handfield M, Kebschull M, Celenti R, et al. Transcriptomes in healthy and diseased gingival tissues. J Periodontol. 2008;79(11):2112–24. doi: 10.1902/jop.2008.080139 ; PubMed Central PMCID: PMC2637651. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Zhang J, Wang CM, Zhang P, Wang X, Chen J, Yang J, et al. Expression of programmed death 1 ligand 1 on periodontal tissue cells as a possible protective feedback mechanism against periodontal tissue destruction. Molecular medicine reports. 2016;13(3):2423–30. doi: 10.3892/mmr.2016.4824 ; PubMed Central PMCID: PMC4768984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Bullon P, Cordero MD, Quiles JL, Ramirez-Tortosa Mdel C, Gonzalez-Alonso A, Alfonsi S, et al. Autophagy in periodontitis patients and gingival fibroblasts: unraveling the link between chronic diseases and inflammation. BMC medicine. 2012;10:122. doi: 10.1186/1741-7015-10-122 ; PubMed Central PMCID: PMC3523085. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Liu C, Mo L, Niu Y, Li X, Zhou X, Xu X. The Role of Reactive Oxygen Species and Autophagy in Periodontitis and Their Potential Linkage. Front Physiol. 2017;8:439. doi: 10.3389/fphys.2017.00439 ; PubMed Central PMCID: PMC5481360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Gu Y, Han X. Toll-Like Receptor Signaling and Immune Regulatory Lymphocytes in Periodontal Disease. International journal of molecular sciences. 2020;21(9). doi: 10.3390/ijms21093329 ; PubMed Central PMCID: PMC7247565. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Silva N, Abusleme L, Bravo D, Dutzan N, Garcia-Sesnich J, Vernal R, et al. Host response mechanisms in periodontal diseases. Journal of applied oral science: revista FOB. 2015;23(3):329–55. doi: 10.1590/1678-775720140259 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Preshaw PM, Henne K, Taylor JJ, Valentine RA, Conrads G. Age-related changes in immune function (immune senescence) in caries and periodontal diseases: a systematic review. J Clin Periodontol. 2017;44 Suppl 18:S153-S77. doi: 10.1111/jcpe.12675 . [DOI] [PubMed] [Google Scholar]
- 63.Munz M, Willenborg C, Richter GM, Jockel-Schneider Y, Graetz C, Staufenbiel I, et al. A genome-wide association study identifies nucleotide variants at SIGLEC5 and DEFA1A3 as risk loci for periodontitis. Human molecular genetics. 2017;26(13):2577–88. doi: 10.1093/hmg/ddx151 . [DOI] [PubMed] [Google Scholar]
- 64.Zhang Z, Zheng Y, Li X. Interleukin-10 gene polymorphisms and chronic periodontitis susceptibility: Evidence based on 33 studies. J Periodontal Res. 2019;54(2):95–105. doi: 10.1111/jre.12612 . [DOI] [PubMed] [Google Scholar]
- 65.Shungin D, Haworth S, Divaris K, Agler CS, Kamatani Y, Keun Lee M, et al. Genome-wide analysis of dental caries and periodontitis combining clinical and self-reported data. Nature communications. 2019;10(1):2773. doi: 10.1038/s41467-019-10630-1 ; PubMed Central PMCID: PMC6591304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Masumoto R, Kitagaki J, Fujihara C, Matsumoto M, Miyauchi S, Asano Y, et al. Identification of genetic risk factors of aggressive periodontitis using genomewide association studies in association with those of chronic periodontitis. J Periodontal Res. 2019;54(3):199–206. doi: 10.1111/jre.12620 . [DOI] [PubMed] [Google Scholar]
- 67.Ferrin J, Kirakodu S, Jensen D, Al-Attar A, Peyyala R, Novak MJ, et al. Gene expression analysis of neuropeptides in oral mucosa during periodontal disease in non-human primates. J Periodontol. 2018;89(7):858–66. doi: 10.1002/JPER.17-0521 ; PubMed Central PMCID: PMC6322539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Linden GJ, Mullally BH, Burden DJ, Lamey PJ, Shaw C, Ardill J, et al. Changes in vasoactive intestinal peptide in gingival crevicular fluid in response to periodontal treatment. J Clin Periodontol. 2002;29(6):484–9. doi: 10.1034/j.1600-051x.2002.290602.x . [DOI] [PubMed] [Google Scholar]
- 69.Lundy FT, Mullally BH, Burden DJ, Lamey PJ, Shaw C, Linden GJ. Changes in substance P and neurokinin A in gingival crevicular fluid in response to periodontal treatment. J Clin Periodontol. 2000;27(7):526–30. doi: 10.1034/j.1600-051x.2000.027007526.x . [DOI] [PubMed] [Google Scholar]
- 70.Keller M, Mazuch J, Abraham U, Eom GD, Herzog ED, Volk HD, et al. A circadian clock in macrophages controls inflammatory immune responses. Proc Natl Acad Sci U S A. 2009;106(50):21407–12. doi: 10.1073/pnas.0906361106 ; PubMed Central PMCID: PMC2795539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Haimovich B, Calvano J, Haimovich AD, Calvano SE, Coyle SM, Lowry SF. In vivo endotoxin synchronizes and suppresses clock gene expression in human peripheral blood leukocytes. Crit Care Med. 2010;38(3):751–8. doi: 10.1097/CCM.0b013e3181cd131c ; PubMed Central PMCID: PMC2929957. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Silveira EJD, Nascimento Filho CHV, Yujra VQ, Webber LP, Castilho RM, Squarize CH. BMAL1 Modulates Epidermal Healing in a Process Involving the Antioxidative Defense Mechanism. International journal of molecular sciences. 2020;21(3). doi: 10.3390/ijms21030901 ; PubMed Central PMCID: PMC7038047. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Matsumoto CS, Almeida LO, Guimaraes DM, Martins MD, Papagerakis P, Papagerakis S, et al. PI3K-PTEN dysregulation leads to mTOR-driven upregulation of the core clock gene BMAL1 in normal and malignant epithelial cells. Oncotarget. 2016;7(27):42393–407. doi: 10.18632/oncotarget.9877 ; PubMed Central PMCID: PMC5173143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Zagni C, Almeida LO, Balan T, Martins MT, Rosselli-Murai LK, Papagerakis P, et al. PTEN Mediates Activation of Core Clock Protein BMAL1 and Accumulation of Epidermal Stem Cells. Stem Cell Reports. 2017;9(1):304–14. doi: 10.1016/j.stemcr.2017.05.006 ; PubMed Central PMCID: PMC5511049. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Bellet MM, Zocchi L, Sassone-Corsi P. The RelB subunit of NFkappaB acts as a negative regulator of circadian gene expression. Cell cycle. 2012;11(17):3304–11. doi: 10.4161/cc.21669 ; PubMed Central PMCID: PMC3467027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Kim SM, Neuendorff N, Earnest DJ. Role of Proinflammatory Cytokines in Feedback Modulation of Circadian Clock Gene Rhythms by Saturated Fatty Acids. Scientific reports. 2019;9(1):8909. doi: 10.1038/s41598-019-45322-9 ; PubMed Central PMCID: PMC6586641. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Spengler ML, Kuropatwinski KK, Comas M, Gasparian AV, Fedtsova N, Gleiberman AS, et al. Core circadian protein CLOCK is a positive regulator of NF-kappaB-mediated transcription. Proc Natl Acad Sci U S A. 2012;109(37):E2457–65. doi: 10.1073/pnas.1206274109 ; PubMed Central PMCID: PMC3443185. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Arjona A, Sarkar DK. The circadian gene mPer2 regulates the daily rhythm of IFN-gamma. Journal of interferon & cytokine research: the official journal of the International Society for Interferon and Cytokine Research. 2006;26(9):645–9. doi: 10.1089/jir.2006.26.645 . [DOI] [PubMed] [Google Scholar]
- 79.Arjona A, Boyadjieva N, Sarkar DK. Circadian rhythms of granzyme B, perforin, IFN-gamma, and NK cell cytolytic activity in the spleen: effects of chronic ethanol. J Immunol. 2004;172(5):2811–7. doi: 10.4049/jimmunol.172.5.2811 . [DOI] [PubMed] [Google Scholar]
- 80.Liu J, Malkani G, Shi X, Meyer M, Cunningham-Runddles S, Ma X, et al. The circadian clock Period 2 gene regulates gamma interferon production of NK cells in host response to lipopolysaccharide-induced endotoxic shock. Infect Immun. 2006;74(8):4750–6. doi: 10.1128/IAI.00287-06 ; PubMed Central PMCID: PMC1539582. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Xie M, Tang Q, Nie J, Zhang C, Zhou X, Yu S, et al. BMAL1-Downregulation Aggravates Porphyromonas Gingivalis-Induced Atherosclerosis by Encouraging Oxidative Stress. Circulation research. 2020;126(6):e15–e29. doi: 10.1161/CIRCRESAHA.119.315502 . [DOI] [PubMed] [Google Scholar]
- 82.Hilbert DA, Memmert S, Marciniak J, Jager A. Molecular biology of periodontal ligament fibroblasts and orthodontic tooth movement: Evidence and possible role of the circadian rhythm. J Orofac Orthop. 2019;80(6):336–47. doi: 10.1007/s00056-019-00195-5 . [DOI] [PubMed] [Google Scholar]
- 83.Song C, Tan P, Zhang Z, Wu W, Dong Y, Zhao L, et al. REV-ERB agonism suppresses osteoclastogenesis and prevents ovariectomy-induced bone loss partially via FABP4 upregulation. FASEB J. 2018;32(6):3215–28. doi: 10.1096/fj.201600825RRR . [DOI] [PubMed] [Google Scholar]
- 84.Song C, Wang J, Kim B, Lu C, Zhang Z, Liu H, et al. Insights into the Role of Circadian Rhythms in Bone Metabolism: A Promising Intervention Target? BioMed research international. 2018;2018:9156478. doi: 10.1155/2018/9156478 ; PubMed Central PMCID: PMC6180976. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Janjic K, Kurzmann C, Moritz A, Agis H. Expression of circadian core clock genes in fibroblasts of human gingiva and periodontal ligament is modulated by L-Mimosine and hypoxia in monolayer and spheroid cultures. Arch Oral Biol. 2017;79:95–9. doi: 10.1016/j.archoralbio.2017.03.007 . [DOI] [PubMed] [Google Scholar]
- 86.Janjic K, Kurzmann C, Moritz A, Agis H. Core circadian clock gene expression in human dental pulp-derived cells in response to L-mimosine, hypoxia and echinomycin. Eur J Oral Sci. 2018;126(4):263–71. doi: 10.1111/eos.12535 ; PubMed Central PMCID: PMC6585758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Ebersole JL, Kirakodu SS, Novak MJ, Dawson D, Stromberg A, Orraca L, et al. Gingival tissue autophagy pathway gene expression profiles in peirodontitis and aging. Journal of Periodontal Research. 2020;55. [DOI] [PubMed] [Google Scholar]
- 88.Gonzalez OA, Kirakodu S, Novak MJ, Stromberg AJ, Orraca L, Gonzalez-Martinez J, et al. Comparative analysis of microbial sensing molecules in mucosal tissues with aging. Immunobiology. 2018;223(3):279–87. doi: 10.1016/j.imbio.2017.10.034 ; PubMed Central PMCID: PMC5821569. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Ebersole JL, Novak MJ, Orraca L, Martinez-Gonzalez J, Kirakodu S, Chen KC, et al. Hypoxia-inducible transcription factors, HIF1A and HIF2A, increase in aging mucosal tissues. Immunology. 2018;154(3):452–64. doi: 10.1111/imm.12894 ; PubMed Central PMCID: PMC6002220. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Pandruvada SN, Gonzalez OA, Kirakodu S, Gudhimella S, Stromberg AJ, Ebersole JL, et al. Bone biology-related gingival transcriptome in ageing and periodontitis in non-human primates. J Clin Periodontol. 2016;43(5):408–17. doi: 10.1111/jcpe.12528 ; PubMed Central PMCID: PMC4844783. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data has been uploaded into the ArrayExpress data base (www.ebi.ac.uk) under accession number: E-MTAB-1977 and into GEO accession GSE180588 (https://www.ncbi.nlm.nih.gov/gds).




