Skip to main content
Bioscience Reports logoLink to Bioscience Reports
. 2022 Dec 6;42(12):BSR20220998. doi: 10.1042/BSR20220998

Analysis of DNMT1 gene variants in progression of neural tube defects—an in silico to in vitro approach

Susanta Sadhukhan 1,*, Nirvika Paul 1,*, Sudakshina Ghosh 2, Dinesh Munian 3, Kausik Ganguly 4,, Krishnendu Ghosh 1, Mainak Sengupta 4, Madhusudan Das 1,
PMCID: PMC9727204  PMID: 36394275

Abstract

Neural tube defects (NTDs) are significant congenital deformities of the central nervous system among which spina bifida is the most common form that occurs due to defect in the neurulation process of embryogenesis. NTDs are among the most common type of birth defects occurring at a range of 0.5–10 in every 1000 live births worldwide and are thought to have multifactorial etiology, including multigenetic and epigenetic notions. Epigenetic regulations control differential gene expression in normal and disease phenotypes. DNA methylation is a significant epigenetic process, guided by DNMT1, one of the most important maintenance methylating agents. However, the relationship between DNMT1 and NTDs had always been inconclusive and poorly understood. In the present study, by utilizing in silico methodologies we tried to figure out potent single nucleotide variants (SNVs) that could play roles in generating functional differences in DNMT1 expression and we also tried to check (by in vitro method) if there is any connection between DNMT1 expression and spina bifida condition. A number of coding and non-coding (both intragenic and intergenic) SNVs of DNMT1 were found (using the in silico methods) that have potentials to alter its expression. From the in vitro experimentations, differential DNMT1 RNA expressions were found between spina bifida affected newborns and their respective mothers when compared with controls. It is the first report of NTD from Eastern India precisely showing inverse correlation between DNMT1 expression and occurrence of NTD. The findings of the present study could be further considered for early prognosis and future experimental designs.

Keywords: in silico, DNMT1, Epigenetics, Methylation, Neural tube defects (NTDs), Spina bifida

Introduction

Chemical modification of DNA or histone protein is mediated by epigenetic processes such as methylation, acetylation, microRNAs and ubiquitination. DNA methylation is a covalent modification occurring at the cytosine residues in CpG sites near the regulatory regions of genes with lasting inheritable effects without changing the sequence. The DNA methylation is mediated by a family of enzymes, are known as DNA methyltransferases (DNMTs) [1].

These enzymes (DNMTs) are of two classes: one is maintenance methyltransferases (DNMT1, cytogenetic location: 19p13.2, OMIM *126375), most abundant form and prefer for methylation of hemi methylated DNA and other one is de novo methyltransferases (DNMT3A and DNMT3B) to establish tissue specific DNA methylation pattern during development [2]. DNMTs catalyze the transfer of methyl group from S-Adenosyl methionine (SAM) to the cytosine residue in CpG dinucleotides of DNA. This methylation of cytosine helps in the formation of 5-methylcytosine and consequently abundance of 5-methylcytosine in their promoter to promote the region-specific silencing process. This in course can affect gene transcription by altering the accessibility of RNA polymerase and transcription factors [3].

This epigenetic regulation is vital during growth and developmental processes. Inconsistency often results into numbers of developmental disorders. DNMT1 shows activity in adult nervous system although its specific function is poorly understood. The enzyme is thought to have regulative roles in neuronal survival, maturation, differentiation, migration and intra-inter neuronal connections. Variations in this gene has been witnessed to be associated with cerebellar ataxia, deafness, and narcolepsy, and neuropathy, hereditary sensory. It has also been shown that a lack of both maternal and zygotic DNMT1 gene expression results into complete demethylation of imprinted genes in blastocysts causing developmental anomalies [4]. In human, DNMT1 gene controls the expression of the maternally imprinted genes like—insulin-like growth factor 2 (IGF2), paternally expressed 3 (PEG3) and long interspersed nuclear elements1 (LINE1) methylation. However, during embryogenesis DNMT1 regulates the process of neural tube formation and its closing, any changes in the imprinted gene can play a crucial role leading to neural tube defects (NTDs) [5]. NTDs are one of the most common and severe congenital malformations. Each year, nearly 300,000 babies worldwide [6] and 2.41–4.1 babies per 1000 live births in India are affected by NTDs [7,8]. Most NTDs are sporadic in nature, with multifactorial polygenic or oligogenic patterns combined with epidemiological and biochemical risk factors [9,10]. Thus, it seems possible that genetic variations in DNMT1 could influence some of the previously described proteins that need to be considered to understand the progression of NTDs.

On the other hand, genetic association studies of nucleotide variants of DNMT1 gene are scattered and sporadic and fail to describe the functional effects of concerned single nucleotide variants (SNVs). Thus, in the present study we had tried to analyze and assess role(s) of DNMT1 (if any) through both in silico and in vitro approaches among two case mothers (both aged 28 years) of two different societal background from Suburban areas of West Bengal and their respective affected newborns (one from each). Both the babies were having spina bifida in terms of NTD and subsequently died at the age of around 5 weeks. Samples procured from two normal mothers were considered as controls. However, no sample had been procured from normal newborns due to ethical and emotional constrains.

Methods

Selection of genetic variants of DNMT1 for in silico analyses

Intragenic (non-synonymous, synonymous and intronic) SNVs were procured from dbSNP and intergenic variants were searched with Table Browser tool of UCSC genome browser [11] using GRCh37/hg19 assembly and genomic co-ordinates of the DNase hypersensitive sites (DHS). Regulatory Element Database [12] was searched to find out coordinates of correlated DHS of DNMT1.

Analyses of non-synonymous variants (non-syn SNVs)

Any non-synonymous single nucleotide variant (non-syn-SNV) substitutes the canonical amino acid sequence of a protein, thus, we tried to predict the functional effect(s) (if any) of every such nucleotide substitution (tabulated in dbSNP for DNMT1) in terms of sequence conservation, disease related functional annotations and overall stability of protein structure. SIFT [13], PROVEAN [14] and PolyPhen-2 [15] consider multiple sequence alignments and conservation of a particular amino acid residue within a particular position of the concerned protein. We used the ‘PROVEAN HUMAN PROTEIN BATCH’ submission option and submitted the substitutions to be analyzed in the prescribed format. PROVEAN calculates and considers a cut off score of -2.5 for each of the amino acid substitution submitted for analysis. If the individual score of each substitution is less than -2.5, then that substitution is considered ‘Deleterious’, on the other hand, a cut-off of 0.05 is considered with SIFT analyses, where any amino acid substitution procuring a score less than 0.05 is considered as ‘Damaging’ substitution. In PolyPhen-2, we used the ‘Batch Query’ option; it calculates conservation score for each submitted query and gives prediction results as ‘Probably Damaging’, ‘Possibly Damaging’ or ‘Benign’. SNPs&GO [16] considers coherent descriptions of gene products in terms of their associated biological processes, cellular components and molecular functions. Thus, a prediction made by SNPs&GO annotates an amino acid substitution as ‘Disease’ related or ‘Neutral’ with a Reliability Index (R.I.) score within the numerical range of ‘1 to 10’ (more the R.I. score, stronger the prediction is). To get the results using SNPs&GO, we submitted each amino acid substitution separately in the required format. In contrast to the four tools already mentioned, fathmm [17] and I-Mutant Suite [18] consider changes in structural stability of concerned protein based on pre-defined structural attributes like hidden markov model (HMM) and Support Vector Machine (SVM) based calculations, respectively. Whereas, fathmm confers an amino acid substitution as ‘Damaging’ or ‘Tolerated’, I-Mutant Suite calculates ‘Increase’ or ‘Decrease’ in protein stability based on SVM calculations and provides change in free energy values (in Kcal/mol unit). Here, we used the ‘Inherited Disease’ option of fathmm and submitted our queries in a batch. For I-Mutant Suite, we used ‘Prediction of protein stability changes upon single point variation from Protein Sequence’ option. For all the web-tools discussed so far, only the default options were used for our analyses. We used all the above tools, except I-Mutant Suite, for prioritization of non-syn-SNVs. Predictions of I-Mutant Suite were tabulated to check if DNMT1 protein stability increases or decreases due to any single nucleotide variation, as both increase and decrease in protein stability may contribute role toward disease pathogenesis. Finally, the pdb file 4WXX was used to assess the structural alterations like changes in hydrogen bonds, electrostatic potential and introduction of steric clash for the most deteriorating non-synonymous variants as assessed by above mentioned tools, using DeepView - Swiss-PdbViewer [19].

Analyses of synonymous variants (syn SNVs)

We know that any synonymous single nucleotide variant (Syn-SNV) does not bring in any amino acid substitution in the polypeptide chain of concerned protein but it creates functional changes in protein turn-over rate. We analyzed all the Syn-SNVs of DNMT1 tabulated in dbSNP for predicting their possible impacts (if any) in changing codon usage from codon table provided in Codon Usage Database (https://www.kazusa.or.jp/codon/). In doing so, we considered change in ‘fraction’ values before and after a particular nucleotide substitution. A Syn-SNV may contribute in alteration of secondary mRNA structure, which can further change the tertiary and biologically active mRNA structure. To predict the effects of syn-SNVs of DNMT1, we utilized RNA Folding form of mfold Web Server (http://www.unafold.org/mfold/applications/rna-folding-form-v2.php) [20]. All the options of RNA folding form were kept as default and no modification was made. RNA folding form considers all the probable stem-looped structures of the submitted single strand sequence and gives out results on a hierarchical basis of initial ΔG values for all the probable stem-looped secondary structures possible, under the ‘View Individual Structures’ section. We checked and compared the circular structure plots (available with ‘Structure 1’ of each result, representing the most stable secondary folding) for all the alleles concerned with a syn-SNV, noted the change in delG values within result table and checked the comparative pictures of the circular plots of our results. Finally, to assess the impact of a syn-SNV upon exon skipping, we took help of Ex-skip [21]. Ex-skip incorporates Exon Splicing Enhancer/Exon Splicing Suppressor (ESE/ESS) profile between ‘wild type’ and ‘mutant’ nucleotide residues for each of the syn-SNV tested. We tried to check if any syn-SNV incorporated in our study has more or less chance of exon skipping than its other alleles.

Analyses of intronic and intergenic variants for their potential regulatory roles

Intronic SNVs of DNMT1 recruited from dbSNP and intergenic SNVs recruited using Regulatory Element Database and UCSC genome browser were all tested for checking their probable regulatory roles following the study of rSNPBase (http://rsnp.psych.ac.cn/listSearch.do) [22] utilizing rSNPBase [23]. RegulomeDB [24] and Haploreg v4.1 [25], all of which entails functional experiment-based predictions available with ENCODE database (The ENCODE Project Consortium, 2012). rSNPBase helped in identifying potential target loci based on spatio-temporal and experimental eQTL (expression Quantitative Trait Loci) labels. Linkage disequilibrium (LD) correlations between SNVs are also analyzed to get the results of probable functional regulatory effects of query SNVs in the form of a SNV-set basis, rather than individual single result for each query SNV. In this study, we used ‘List search’ option of rSNPBase (http://rsnp.psych.ac.cn/listSearch.do). SNV IDs were submitted in the search box in enter delimited format, followed by the searching step. It is to be noted that for each query, the ‘rSNP’ column of the result page showed ‘yes’ if any experimental data are available; otherwise ‘no’. We did not include results with ‘no’ output in our filtration. SNVs that were found to have regulatory effects during rSNPBase analyses were searched further in RegulomeDB. RegulomeDB provides a heuristic scoring system, with increasing confidence, for each query variant based on its functional location and consequence, if any. The scoring system ranges from 1 to 6. Score category 1 and all its subcategories indicate that the variant is ‘likely to affect binding and linked to expression of a gene target’. Score category 2 along with its sub-categories; indicate that the query variant is ‘likely to affect binding’. Categories 3 to 6 represent those variants for whom lesser evidences are there with respect to their regulatory potentials. The ‘dbSNP IDs’ option of RegulomeDB was used in this study and all the SNV IDs were submitted in enter delimited format. RegulomeDB (http://www.regulomedb.org) involved manually curated regions that have been experimentally characterized to be involved in regulation, ChIP-seq information for a variety of important regulatory factors across diverse set of cell types, chromatin state information across different cell types and eQTL information to allow the association of distal sites with gene promoters. HaploReg v4.1 (http://archive.broadinstitute.org/mammals/haploreg/haploreg.php) helps to search SNVs within LD blocks based on chromatin state data along with conservation and regulatory motif alteration data for all query SNVs. SNV Ids that obtained score 1 and score 2 during RegulomeDB analysis, were pooled together and further searched in HaploReg v4.1. For searching purpose, we created and uploaded a text file with SNV IDs in enter delimited format having only one SNV ID per line. Before searching, the LD threshold value of HaploReg was set to 0.6 and other setting options were left unchanged. HaploReg v4.1 was used only to check if any of our prioritized SNV was in LD with another query SNP, or not. Therefore, it is worth mentioning that HaploReg v4.1 was not used to prioritize SNVs.

Searching targets of regulations and modes of regulations

After prioritization of intronic and intergenic variants using the afore-mentioned tools, we tried to find the target loci for each of the prioritized potential regulatory single nucleotide variants (rSNVs) of DNMT1. We followed the hyperlinks provided by rSNPBase (on the SNV identifiers) and checked the ‘SNP Report’ page. Types of regulations and targets of such regulations were checked for each query rSNVfrom ‘SNP Report’‘ page. It is important to mention here that the target locus (or loci) of each rSNV provide a hint for plausible functional implication of the variant in question.

STRING v11 analyses

‘The STRING database aims to collect, score and integrate all publicly available sources of protein-protein interaction information, and to complement these with computational predictions. Its goal is to achieve a comprehensive and objective global network, including direct (physical) as well as indirect (functional) interactions’. [26]. After prioritization of intronic and intergenic SNVs for checking their potential regulatory role(s) (if any), we tried to check if the target loci fetched from ‘SNP Report’ page of rSNPBase, showed any interaction among themselves or with DNMT1.

Collection of samples and meta-data

The peripheral blood samples of both mothers and their NTD babies (Figure 1A) were collected from the Department of Neonatology, Institute of Post Graduate Medical Education & Research (IPGME&R), Kolkata, India. Age and ethnicity matched control samples with no familial history of NTDs were recruited from the same clinic. Socio-economic condition, occupation of parents, smoking and drinking habits, regular food habit, folate intake during pregnancy, pregnancy term, status of diabetes and any previous family history of congenital defect, were also considered. The clinical and demographic characteristics of case and control mothers showed that the socio-economic status of case and control groups were similar. None of the mother had any smoking or drinking habits. Both case and control patient groups were on routine folate supplementation. In term of pregnancy all mothers are primigravida. Diabetes condition was not found in any case or control subject.

Figure 1. NTD and DNMT 1 gene expression.

Figure 1

(A,B) Pre-mortal photographs of subject newborns with NTD/ Spina bifida. (C) The column histogram reflecting the comparison of DNMT1 expression in terms of ΔCt values between control mother (CTM, in blue) and case mother (CM, in red) who gave birth to NTD babies (assuming that higher the ΔCt, lower will be the expression. In the current study higher DNMT1 expression was seen in control mothers than case mothers). (D) The column histogram reflecting the comparison of DNMT1 expression fold change (2−ΔΔCt) between case mother (CM, in red) and their respective fetus (CF, in green) having NTD reflecting higher expression in case mothers that their respective fetus.

The entire study was kept under the loop depending on the questionnaire approved by ethical committee of IPGME&R, Kolkata [Memo No. Inst/IEC/2015/43] abiding by the Declaration of Helsinki of World medical Council. All the participants were being told meticulously about the research utilities, outcomes and also their orientations of association in their own dialect(s) prior taking their confirmation (in writing, from the patients themselves or their related keen, as applicable in time) willing to participate in this said study abiding by all the medico-legal norms (without any pay-off in cash or kind either) under close monitoring of the concerned medical team.

qRT PCR

Quantitative mRNA expression was analyzed using real-time quantitative PCR (qRT-PCR). Respective primers were CAACGGATTTGGTCGTATTGG (FP) and GCAACAATATCCACTTTACCAGAGTTAA (RP) for GAPDH as housekeeping & CCCCTGAGCCCTACCGAAT (FP) and CTCGCTGGAGTGGACTTGTG (RP) for DNMT1 as methylation marker. Product sizes of the primers were calculated from ‘NCBI PCR PRIMER BLAST’ and their optimum annealing temperature were determined by array of gradient PCR runs. Both the primers were having Tm of 59.1°C. The product length of DNMT1 was 142 bp while product length of GAPDH was 72 bp. ‘SYBR Green I master mix’ (Agilent Technologies, U.S.A.) was used for fluorescent master mix along with ‘ROX’ (Agilent Technologies, U.S.A.) as reference dye diluted in DEPC water (1:100). Entire reaction mixture along with respective primers, DEPC water and cDNA was taken into ‘AriaMX Real Time PCR cycler’ (Agilent Technologies, U.S.A.). The amplification and melt curve were obtained along with Cq values by analyzing with ‘AriaMX Software v1.0’ (Agilent Technologies, U.S.A.). This Cq and successive ΔCt values (by substracting Housekeeping GAPDH Cq value from DNMT1 Cq) had been plotted graphically. The lesser the ΔCt value, greater will be the expression level. Moreover, fold changes in expression were calculated in terms of ΔΔCt value and plotted furthermore, where needed.

Results

Result of selection of genetic variants of DNMT1 for in silico analyses

We found 775 non-syn SNVs, 576 syn-SNVs, 14336 intronic SNVs from dbSNP during SNV curation. When we searched Regulatory Element Database for number of DHS correlated with expression of DNMT1, we found 1781 DHS to be positively correlated and 133 DHS to be negatively correlated with DNMT1 expression. We found 129 SNVs from all the positively correlated DHS and 9 SNVs from the negatively correlated DHS which we termed as intergenic SNVs.

Result of prioritization of non-synonymous SNVs (non-syn SNVs)

As mentioned, we found 775 non-syn SNVs for DNMT1 from dbSNP and after analyzing them, we found 227, 277, 171, 284, 190 (Supplementary Table S1) non-syn SNVs to get annotated as - ‘deleterious’, ‘damaging’, ‘disease’ causing, ‘damaging’ and ‘damaging’ substitutions by PROVEAN, SIFT, SNPs&GO, PolyPhen 2 and fathmm, respectively. We found 17 non-syn SNVs (Table 1) being commonly predicted by all the aforementioned tools to have ‘damaging’, ‘deleterious’ or ‘disease’ causing effects upon respective substitutions. Of those 17 non-syn SNVs, 6 SNVs [S1556F (rs1388362405), R1555C (rs1461695373), G1449R (rs770571074), R1261W (rs1052868434), G806R (rs183555527), D785H (rs1244845928)] were found to have changes in number of hydrogen bonds, changes in electrostatic potentials and also introduction of steric clashes upon allelic alterations when assessed through DeepView - Swiss-PdbViewer (see Table 2 and Supplementary Figure S4) thus, these six non-synonymous SNVs can be termed as most potent and their roles can further be assessed using functional experimentations.

Table 1. Summary of non-synonymous single nucleotide variant (Non-syn-SNV) analyses of DNMT1.

Non-synonymous SNV rs930531589 rs1388362405 rs1461695373 rs770571074 rs1182970957 rs1052868434 rs759915904 rs1167927296 rs776149246 rs1303994790 rs1314966532 rs868584117 rs183555527 rs1244845928 rs1181332562 rs199473690 rs199473692
Amino acid substitution H1573Q S1556F R1555C G1449R C1294G R1261W G1231R I996T Y991C A874V F864L S840C G806R D785H Y775C Y495C Y495H
PROVEAN predictions DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS DELETERIOUS
PROVEAN score (cut off > -2.5) -6.57 -5.02 -6.82 -6.64 -10.83 -5.85 -7.37 -4.58 -5.77 -3.65 -5.36 -2.98 -7.13 -3.46 -5.11 -8.11 -4.51
SIFT prediction DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING
SIFT score (cutoff = 0.05) 0.001 0 0 0 0.004 0.001 0.001 0.001 0.001 0.002 0.045 0.021 0.005 0.004 0.05 0 0
SNPs&GO predictions for effect of substitution DISEASE DISEASE DISEASE DISEASE DISEASE DISEASE DISEASE DISEASE DISEASE DISEASE DISEASE DISEASE DISEASE DISEASE DISEASE DISEASE DISEASE
Reliability Index (R.I.) of SNPs&GO prediction 1 0 4 1 2 2 4 4 4 2 4 2 7 1 2 6 6
POLYPHEN2 (HumDiv) predictions probably damaging probably damaging probably damaging probably damaging probably damaging probably damaging probably damaging probably damaging probably damaging probably damaging probably damaging probably damaging probably damaging probably damaging probably damaging probably damaging probably damaging
POLYPHEN2 scores 1 1 1 1 0.998 1 1 1 0.999 0.999 0.997 0.999 0.987 0.993 0.999 1 1
fathmm predictions DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING DAMAGING
fathmm scores -1.79 -1.74 -2.62 -1.86 -1.81 -1.87 -1.79 -2.77 -2.37 -2.08 -2.02 -2.04 -2.1 -2.1 -2.08 -3.34 -3.32
Cumulative prediction scores 6 3 5 6 8 6 3 8 4 5 7 1 2 2 2 2 6
Protein stability precition of iMutant Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease
DDG values (Kcal/mol) of predictions from iMutant 3.0 (DDG<0: Decrease Stability; DDG>0: Increase Stability) -0.57 0.14 -1.2 -0.63 -1.22 -0.74 -0.34 -1.87 -1.2 -0.11 -1 -0.4 -0.39 -0.38 -1.06 -0.93 -1.22

Table 2. Summary of assessment of non-synonymous single nucleotide variants using DeepView - Swiss-PdbViewer.

Non-synonymous SNV Amino acid substitution Change in hydrogen bonds Introduction of steric clash Change in electrostatic potential
rs930531589 H1573Q Lost 2 bonds Gain of 3 hydrogen bonds None
rs1388362405 S1556F Lost 3 bonds Gain of 1 hydrogen bond and 3 steric clashes Change found
rs1461695373 R1555C Lost 5 bonds Gain 2 hydrogen bonds Change found
rs770571074 G1449R Lost 1 bond Gain 3 hydrogen bonds Change found
rs1182970957 C1294G Lost 1 bond No change None
rs1052868434 R1261W Lost 4 bonds Gain 2 hydrogen bonds Change found
rs759915904 G1231R Lost 1 bond Gain 2 hydrogen bonds None
rs1167927296 I996T Lost 1 and Gain 1 Gain 5 hydrogen bonds None
rs776149246 Y991C Lost 1 bond Gain of 5 hydrogen bonds and 1 steric clash None
rs1303994790 A874V No change Gain 2 hydrogen bonds None
rs1314966532 F864L Lost 1 bond Gain 2 hydrogen bonds None
rs868584117 S840C No change Gain 2 hydrogen bonds None
rs183555527 G806R Lost 1 bond Gain 3 hydrogen bonds Change found
rs1244845928 D785H Lost 1 bond Gain of 1 hydrogen bond and 1 steric clashe Change found
rs1181332562 Y775C Lost 1 bond Lost 1 bond None
rs199473690 Y495C Lost 2 bonds Gain 4 hydrogen bonds None
rs199473692 Y495H Lost 2 bonds Gain 4 hydrogen bonds None

Result of prioritization of synonymous SNVs (syn SNVs)

We found 576 syn SNVs from dbSNP and checked them all for potential changes in Codon Usage Biasness, alteration in secondary mRNA structures and potential alterations in exon skipping. We found 55 syn SNVs to have 2-fold or more increase and 105 syn SNVs to have 2-fold or more decrease in codon usage upon concerned allelic changes, respectively. After checking all the 576 syn SNVs for changes in secondary mRNA structure, 82syn SNVs (see Supplementary Figure S1) were found to have significant alterations in mRNA secondary structures as evident from the respective ‘circular plots’ and 146 syn SNVs were found to have significant changes in exon skipping after EX-SKIP analyses. Altogether, 72 syn SNVs (see Supplementary Table S2) were found to get commonly predicted as having codon usage changes of 2-fold or more, significant alteration in secondary mRNA structures and chances of altered exon skipping upon concerned allelic changes, which may alter the equilibrium of DNMT1 mRNA at molecular level.

Result of prioritization of intronic SNVs

We checked 14336 intronic SNVs for assessing their probable regulatory roles (if any). 815 intronic SNVs out of 14336 were assigned as ‘rSNP’ after rSNPBase analyses. After RegulomeDB analyses, 65 intronic SNVs obtained scores 1 or 2 which further support their regulatory activities with maximum evidences in form of functional data available with RegulomeDB. Out of the 65 intronic SNVs 9 were found to be in LD with other query intronic SNVs (see Supplementary Table S3).

Result of prioritization of intergenic SNVs

We found 1781 intergenic SNVs to reside within positively correlated DHS and 133 intergenic SNVs to reside within negatively correlated DHS of DNMT1. After rSNPBase analyses, we found 129 SNV of positively correlated DHS and 9 SNV of negatively correlated DHS to be assigned as ‘rSNP’. All the ‘rSNP’s were then subjected to RegulomeDB analyses and 29 ‘rSNP’ from positively correlated DHS and 2 ‘rSNP’ from negatively correlated DHS were found to obtained either score 1 or 2 with maximal evidences in support of their regulatory activities. After HaploReg v4.1 analysis we found no SNV from positively correlated DHS to be in LD with other query SNVs (see Supplementary Table S4).

Result of searching targets of regulatory SNVs of DNMT1

All the prioritized 65 intronic SNVs were found to target 40 different loci other than DNMT1 through ‘distal transcriptional regulation’. On the other hand, 29 prioritized intergenic SNVs from positively correlated DHS of DNMT1 were found to target 10 loci other than DNMT1 through ‘proximal transcriptional regulation’, 74 loci other than DNMT1 through ‘distal transcriptional regulation’ and 6 different loci through ‘RNA binding protein mediated regulations’. Two prioritized intergenic SNV from negatively correlated DHS were found to target only EIF3G through ‘proximal transcriptional regulation’ and 7 different loci other than DNMT1 through ‘distal transcriptional regulation’. Altogether, prioritized rSNVs of DNMT1 were found to target 76 different loci other than DNMT1 through different modes of regulations.

Result of STRING v11.0 analyses

After intronic and intergenic SNV specific analyses we found 76 different loci to be targeted by DNMT1 harboring rSNVs. But after STRING analyses we found only 4 loci (HIST1H3H, Eukaryotic translation initiation factor 3 subunit G or EIF3G, Mitochondrial Ribosomal Protein L4 or MRPL4 and Eukaryotic Translation Elongation Factor 2 or EEF2) to reside within the same interactome with DNMT1 (see Supplementary Figure S2) when ‘experiment’, ‘co-expression’, ‘gene fusion’ specific filters of STRING were applied i.e. filters associated with functional experimental data.

qRT-PCR Result

The DNMT1 expression in term of SYBR expression had been considered while keeping GAPDH as the housekeeping expression. The Figure 1C suggested lower ΔCt (higher expression level of DNMT1) in control mother (blue histogram columns) than the NTD case mothers (red histogram columns). On the other hand, DNMT1 related maintenance methylation had mostly been observed in experimental case mothers (red histogram columns) yielding higher level of 2−ΔΔCt expression fold change of 0.43 and 0.38, respectively. However, in their respective NTD fetus (green histogram columns of Figure 1D), the degree of subsequent DNMT1 expression also being reduced giving lower level of 2−ΔΔCt expression fold change of 0.09 and 0.06, respectively. Thus, from this experimental case analysis it was evident that decrease of DNMT1 expression is coherent with the disease both in case mothers and their respective NTD fetus when compared with control mothers.

Discussion

DNA methylation is a major epigenetic modification predominantly involved in eukaryotic gene silencing. During embryonic development, future lineage specific differentiations without any unwanted cellular regression are carried out by the DNMT genes [27]. DNMT1, the predominant maintenance methylator, contains numerous regulatory domains finely tuned with normal embryological development in mammals. Any DNMT1 related change in the imprinted genes and transposable elements responsible for normal neurulation process, could result NTD in offspring [5].

All the curated SNVs of DNMT1 were checked for their plausible deleterious effects which may translate into altered DNMT1 expression and function. Upon completion of prioritization of all the possible SNVs of DNMT1, we found 17 non-syn-SNVs, 82 syn-SNVs, 65 intronic SNVs and 31 intergenic SNVs to be most potent genetic variants for checking their association(s) and functional role(s), (if any), using follow-up association and functional experiments, respectively. As already mentioned that after STRING v11.0 analyses, we found HIST1H3H, EIF3G, MRPL4 and EEF2 to reside within same interactome with DNMT1. It became necessary for us to check if we could find any probable role of any of the 4 interacting proteins of DNMT1 in terms of their involvement in any neurological altered manifestation. Interestingly, after extensive literature search, we found that variations in HIST1H3H are well known for their roles in pediatric non-brain stem glioblastoma [28]. On one hand, EIF3G is well known for its ubiquitous roles in eukaryotic translation initiation and on the other hand MRPL4 codes an integral component of mitochondrial large ribosomal subunit. Recently, it has been seen that Mrpl4 plays important role for development of hypertension and stroke in rats [29]. Mice homolog of EEF2 is already known for its role in generation of long-term depression [30]. It is important to mention here that several studies opined association of defective function of DNMT gene with various complex disorders like hereditary sensory and autonomic neuropathy type 1 (HSAN1), dementia [31], schizophrenia [32] and cancer [1]. All the 17 prioritized non-syn SNVs of DNMT1, were checked in DeepView - Swiss-PdbViewer for alteration in protein structure and interestingly, 6 of them were found to modulate different structural conformational changes in protein (electrostatic potential and steric clashes), which could result into altered function of DNMT1 enzyme.

After successfully prioritizing potential functional SNVs of DNMT1 using in silico tools, it became necessary for us to check the expression pattern of DNMT1 in NTD model and in respective control. From our qRT-PCR based result, it is evident that lower DNMT1 gene expression is prevalent in NTD affected babies when compared to their respective mothers, which is in contrast with the fact that levels of DNMT1 stay at comparative level in both normal embryo and adult blood (data procured from SCREEN interface of ENCODE, Supplementary Figure S3) [33]. Thus, our study portrayed a plausible relationship between occurrence of NTD and lowered DNMT1 level in the newborns which in turn could be result of anomalous expression of DNMT1-regulated (imprinted) genes like IGF2, PEG3 and LINE1 contributing to neuro-pathogenesis.

Conclusion

We believe our case report would pave ways for future association and functional studies in quest of searching functional relationship between variations in DNMT1 expression and NTD manifestation. With the best of our knowledge, this is the first report from this part of the globe which could be helpful in better diagnosis of NTD and might also be helpful to evaluate the genetic consequences in ethnically distinct East Indian population sublimely.

Supplementary Material

Supplementary Figures S1-S4 and Tables S1-S4

Acknowledgements

The authors would like to thank the study participants who gave their written consent in this study and we were also thankful to the medical staffs for their cooperation in sample collections.

Abbreviations

DNMT

de novo methyltransferase

LD

linkage disequilibrium

NTD

neural tube defect

SAM

S-adenosyl methionine

SNV

single nucleotide variant

Data Availability

The data that support the findings of this study are available from the corresponding author upon reasonable request. The data may be available upon request.

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

We are highly grateful to the Department of Science and Technology, Government of West Bengal (West Bengal State Council of Science and Technology 319/WBSCST/F/0443/12) for financial support.

CRediT Author Contribution

Susanta Sadhukhan: Conceptualization, Data curation, Formal analysis, Validation, Methodology, Writing—original draft, Writing—review & editing. Nirvika Paul: Conceptualization, Data curation, Software, Formal analysis, Methodology, Writing—original draft, Writing—review & editing. Sudakshina Ghosh: Supervision, Writing—review & editing. Dinesh Munian: Resources, Data curation, Supervision. Kausik Ganguly: Resources, Software, Formal analysis. Krishnendu Ghosh: Resources, Formal analysis. Mainak Sengupta: Software, Formal analysis. Madhusudan Das: Conceptualization, Supervision, Investigation, Visualization, Writing—review & editing.

Ethics Approval

Ethics approval was taken from the participants under the questionnaire approved by ethical committee of IPGME&R, Kolkata [Memo No. Inst/IEC/2015/43] abiding by the Declaration of Helsinki of World medical Council.

References

  • 1.Dhe-Paganon S., Syeda F. and Park L. (2011) Review article DNA methyl transferase 1: regulatory mechanisms and implications in health and disease. Int. J. Biochem. Mol. Biol. 2, 58–66 [PMC free article] [PubMed] [Google Scholar]
  • 2.Xie T., Yu J., Fu W., Wang Z., Xu L., Chang S.et al. (2019) Insight into the selective binding mechanism of DNMT1 and DNMT3A inhibitors: a molecular simulation study. Phys. Chem. Chem. Phys. 21, 12931–12947 10.1039/C9CP02024A [DOI] [PubMed] [Google Scholar]
  • 3.Okano M., Bell W.D., Haber A.D. and Li E. (1999) DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99, 247–257 10.1016/S0092-8674(00)81656-6 [DOI] [PubMed] [Google Scholar]
  • 4.Li E., Timothy H., Bestor T. and Jaenisch R. (1992) Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69, 915–926 10.1016/0092-8674(92)90611-F [DOI] [PubMed] [Google Scholar]
  • 5.Waterland A.R. and Jirtle L.R. (2004) Early nutrition, epigenetic changes at transposons and imprinted genes, and enhanced susceptibility to adult chronic diseases. Nutrition 20, 63–68 10.1016/j.nut.2003.09.011 [DOI] [PubMed] [Google Scholar]
  • 6.Zaganjor I., Sekkarie A., Tsang B.L., Williams J., Razzaghi H. and Mulinare J. (2016) Describing the prevalence of neural tube defects worldwide: a systematic literature review. PLoS ONE 11, e0151586 10.1371/journal.pone.0151586 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Allagh P.K., Shamanna R.B., Murthy V.S.G., Ness R.A., Doyle P., Neogi B.S.et al. (2015) Birth prevalence of neural tube defects and orofacial clefts in india: a systematic review and meta-analysis. PLoS ONE 10, 1–15 10.1371/journal.pone.0118961 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kant S., Malhotra S., Singh K.A., Haldar P., Kaur R., Misra P.et al. (2017) Prevalence of neural tube defects in a rural area of North India from 2001 to 2014: a population-based survey. Birth Defects Res. 109, 203–210 10.1002/bdra.23578 [DOI] [PubMed] [Google Scholar]
  • 9.Paul S., Sadhukhan S., Munian D., Bankura B. and Das M. (2018) Association of FOLH1, DHFR, and MTHFR gene polymorphisms with susceptibility of neural tube defects: a case control study from Eastern India. Birth Defects Res. 110, 1129–1138 10.1002/bdr2.1365 [DOI] [PubMed] [Google Scholar]
  • 10.Chen C.P. (2007) Chromosomal abnormalities associated with neural tube defects. Taiwan J. Obstet. Gynecol. 46, 325–335 10.1016/S1028-4559(08)60002-9 [DOI] [PubMed] [Google Scholar]
  • 11.Karolchik D., Hinrichs A.S., Furey T.S., Roskin K.M., Sugnet C.W., Haussler D.et al. (2004) The UCSC Table Browser data retrieval tool. Nucleic Acids Res. 32, D493–D496 10.1093/nar/gkh103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Sheffield N.C., Thurman R.E., Song L., Safi M.A., Stamatoyannopoulos J.A., Lenhard B.et al. (2013) Patterns of regulatory activity across diverse human cell-types predict tissue identity, transcription factor binding, and long-range interactions. Genome Res. 23, 777–788, www.genome.org 10.1101/gr.152140.112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Choi Y., Sims G.E., Murphy S., Miller J.R. and Chan A.P. (2012) Predicting the functional effect of amino acid substitutions and indels. PLoS ONE 7, e46688 10.1371/journal.pone.0046688 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Choi Y. and Chan A.P. (2015) PROVEAN web server:a tool to predict the functional effect of amino acid substitutions and indels. Bioinformatics 31, 2745–2747 10.1093/bioinformatics/btv195 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Adzhubei I., Jordan D.M. and Sunyaev S.R. (2013) Predicting functional effect of human missense mutations using PolyPhen-2. Curr. Protoc. Hum. Genet. Chapter 7, Unit7.20 10.1002/0471142905.hg0720s76 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Calabrese R., Capriotti E., Fariselli P., Martelli P.L. and Casadio R. (2009) Functional annotations improve the predictive score of human disease-related mutations in proteins. Hum. Mutat. 30, 1237–1244 10.1002/humu.21047 [DOI] [PubMed] [Google Scholar]
  • 17.Shihab H.A., Gough J., Mort M., Cooper D.N., Day I.N.M. and Gaunt T. (2014) Ranking non-synonymous single nucleotide polymorphisms based on disease concepts. Hum. Genomics 8, 11 10.1186/1479-7364-8-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Capriotti E., Calabrese R. and Casadio R. (2006) Predicting the insurgence of human genetic diseases associated to single point protein mutations with support vector machines and evolutionary information. Bioinformatics 22, 2729–2734 10.1093/bioinformatics/btl423 [DOI] [PubMed] [Google Scholar]
  • 19.Guex N. and Peitsch M.C. (1997) SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18, 2714–2723 10.1002/elps.1150181505 [DOI] [PubMed] [Google Scholar]
  • 20.Zuker M. (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406–3415 10.1093/nar/gkg595 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Raponi M., Kralovicova J., Copson E., Divina P., Eccles D., Johnson P.et al. (2011) Prediction of single-nucleotide substitutions that result in exon skipping: identification of a splicing silencer in BRCA1 exon 6. Hum. Mutat. 32, 436–444 10.1002/humu.21458 [DOI] [PubMed] [Google Scholar]
  • 22.Ganguly K., Saha T. and Saha A. (2019) Meta-analysis and prioritization of human skin pigmentation-associated GWAS-SNPs using ENCODE data-based web-tools. Arch. Dermatol. Res. 311, 163–171 10.1007/s00403-019-01891-3 [DOI] [PubMed] [Google Scholar]
  • 23.Guo L., Du Y., Chang S., Zhang K. and Wang J. (2013) rSNPBase: a database for curated regulatory SNPs. Nucleic Acids Res. 42, D1033–D1039 10.1093/nar/gkt1167 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Boyle P.A., Hong L.E., Hariharan M., Cheng Y., Schaub A.M., Kasowsk M.et al. (2012) Annotation of functional variation in personal genomes using RegulomeDB. Genome Res. 22, 1790–1797 10.1101/gr.137323.112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ward D.L. and Kellis M. (2012) HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants. Nucleic Acid Res. 40, D930–D934 10.1093/nar/gkr917 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Szklarczyk D., Gable L.A., Lyon D., Junge A., Wyder S., Cepas H.J.et al. (2019) STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 47, D607–D613 10.1093/nar/gky1131 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zheng W., Yan Z., He R., Huang Y., Lin A., Huang W.et al. (2018) Identification of a novel DNMT1 mutation in a Chinese patient with hereditary sensory and autonomic neuropathy type IE. BMC Neurol. 18, 174 10.1186/s12883-018-1177-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wu G., Broniscer A. and McEachron T.A. (2012) Somatic histone H3 alterations in pediatric diffuse intrinsic pontine gliomas and non-brainstem glioblastomas. Nat. Genet. 44, 251–253 10.1038/ng.1102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Zhao Q., Sun H., Yin L. and Wang L. (2019) miR-126a-5p-Dbp and miR-31a-Crot/Mrpl4 interaction pairs crucial for the development of hypertension and stroke. Mol. Med. Rep. 20, 4151–4167 10.3892/mmr.2019.10679 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Park S., Park J.M., Kim S., Kim J.A., Shepherd J.D., Smith-Hicks C.L.et al. (2008) Elongation Factor 2 and Fragile X mental retardation protein control the dynamic translation of Arc/Arg3.1 Essential for mGluR-LTD. Neuron 59, 70–83 10.1016/j.neuron.2008.05.023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Klein J.C., Botuyan V.M., Wu Y., Ward J.C., Nicholson A.G., Hammans S.et al. (2011) Mutations in DNMT1 cause hereditary sensory neuropathy with dementia and hearing loss 2. Nat. Genet. 43, 595–600 10.1038/ng.830 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Saradalekshmi K.R., Neetha N.V., Sathyan S., Nair I.V. and Nair C.M. (2014) DNA Methyl Transferase (DNMT) Gene Polymorphisms Could Be a Primary Event in Epigenetic Susceptibility to Schizophrenia. PLoS ONE 9, e98182 10.1371/journal.pone.0098182 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.The ENCODE Project Consortium (2012) An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57–74 10.1038/nature11247 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures S1-S4 and Tables S1-S4

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request. The data may be available upon request.


Articles from Bioscience Reports are provided here courtesy of Portland Press Ltd

RESOURCES