Skip to main content
PLOS One logoLink to PLOS One
. 2022 Dec 7;17(12):e0278579. doi: 10.1371/journal.pone.0278579

Molecular surveillance for Rickettsia spp. and Bartonella spp. in ticks from Northern Iran

Ahmad Ghasemi 1,2,, Mina Latifian 2,3,, Saber Esmaeili 2,3, Saied Reza Naddaf 4, Ehsan Mostafavi 2,3,*
Editor: Brian Stevenson5
PMCID: PMC9728842  PMID: 36476750

Abstract

Tick-borne zoonotic diseases pose a threat to public health; hence, identifying the pathogenic agents associated with them is critical. The prevalence of Bartonella and Rickettsia in Iran is unknown. This study aimed to detect Rickettsia spp. and Bartonella species in ticks in northeast Iran and conduct phylogenetic analysis on these bacteria. Ticks from the sample bank in the Research Center for Emerging and Re-emerging Diseases were included in this study. The ticks were collected in 2017 and 2018 from domestic animals (sheep, goats, cows, camels, horses, dogs, and donkeys) and rodents in Golestan, Mazandaran, and Guilan provinces. Molecular methods were used to examine the DNA extracted from these samples to detect Rickettsia spp. and Bartonella species. The study examined a total of 3999 ticks. Ixodes ricinus (46.4%), Rhipicephalus turanicus (26.3%), and Rhipicephalus sanguineus (17.1%) were the most prevalent species. Among 638 DNA pools, real-time-PCR detected Rickettsia spp. in 161 (25.2%), mostly belonging to Rh. sanguineus (48.9%) and Rh. turanicus (41.9%). Golestan Province had the highest number of positive pools (29.7%). No positive samples for Bartonella were detected in a 638 pooled samples. Eight distinct Rickettsia species were detected in 65 sequenced samples, the majority of which were R. massiliae (n = 32, 49.2%) and R. sibirica (n = 20, 30.8%). Other species included R. rhipicephali (n = 3), R. aeschlimannii (n = 5), R. helvetica (n = 5), R. asiatica (n = 4), R. monacensis (n = 6), and R. raoultii (n = 1). The research findings may provide helpful information about tick-borne Rickettsiae in Iran and help to clarify the role of these arthropods in maintaining these agents. Rickettsia species were found to be circulating in three Northern provinces; thus, it is recommended that this disease be considered in the differential diagnosis of febrile diseases caused by tick bites and febrile diseases with skin rashes such as Crimean–Congo hemorrhagic fever (CCHF).

Introduction

Zoonotic diseases are a significant cause of infection-related mortality on a global scale and are critical as emerging infectious diseases in humans [1]. These diseases are a significant public health problem and a direct threat to human health, posing a risk of death. Climate change, travel and tourism, migration, animal trade, human factors, and natural factors significantly impact the spread of emerging and re-emerging infections [2].

Ticks are more likely than other blood-feeding arthropods to transmit pathogenic species, affecting humans and livestock [3]. Knowledge of the intricate relationship between ticks and their hosts, the environment, and the pathogens they transmit, is critical to understanding the epidemiology of tick-borne zoonotic diseases [4]. Ticks transmit various zoonotic diseases, including Lyme disease, Ehrlichiosis, and Rocky Mountain Spotted Fever (RMSF) [5]. Tick-borne diseases are a frequent occurrence in both human and veterinary medicine. The number of tick-borne diseases affecting domestic animals and humans has increased in recent years, necessitating additional research into the epidemiology, diagnosis, and ecology of these newly identified diseases [6].

Rickettsia infections transmitted by ticks are known as emerging and zoonotic diseases that affect human and livestock health. The distribution of these diseases worldwide is related to the vector [7]. Rickettsia, an obligate intracellular gram-negative bacterium, is an ancient vector-borne disease. This bacterium is transmitted via arthropods’ bites to animals and humans. Ticks are the primary vectors for this pathogen; however, other vectors, including fleas, lice, mites, and even mosquitoes, may contribute to transmission. These bacteria are classified into more than 30 species, comprising four subgenera: spotted fever, typhus fever, Rickettsia bellii, and Rickettsia canadensis. The typhus group comprises Rickettsia prowazekii and Rickettsia typhi, while the spotted fever group with more than 20 species [8, 9]. Spotted fever group (SFG) is subdivided into two distinct subgroups: Rocky Mountain Spotted Fever (RMSF) and Mediterranean Spotted Fever (MSF). The Mediterranean spotted fever is an endemic disease in the Mediterranean region (Africa, Southern Europe, and India) and is believed to be associated with global warming and increased tick infestation and bites [10]. Rickettsial infections are transmitted to animals via tick bites, and if humans are in the vicinity of tick-infected animals, be bitten by ticks accidentally, are unable to propagate the infection in nature, and are known as dead end host for this pathogen [11].

In humans, the symptoms of this disease are nonspecific and are not diagnosed in time; as a result, necessary treatments are not performed in the majority of cases. Early symptoms include fever, chills, headache, and myalgia, and additional symptoms such as nausea, vomiting, and diarrhea can be seen in the subsequent steps. In untreated patients, mortality rates ranged from 5% to 25% [7]. Eight tick-borne rickettsios including: Rickettsia rickettsii, Rickettsia sibirica, Rickettsia australis, Rickettsia honei, Rickettsia japonica, Rickettsia africae, Rickettsia conorii, and Rickettsia slovaca have been described in a worldwide In recent years, human infections caused by Rickettsia aeschlimannii, Rickettsia helvetica, Rickettsia mongolotimonae, and Rickettsia heilongjiangii have also been reported in various geographical regions [12].

Bartonella is a vector-borne bacterium linked to increased emerging zoonotic infections in humans and animals. The infections range from mild or self-limiting to severe and life-threatening diseases in human. The bacterium is widespread among small mammals and may threaten human health [13]. Bartonella spp. are gram-negative, slow-growing, intracellular pleomorphic bacillus and includes at least 35 species and three subspecies. Numerous animals are considered hosts and reservoirs for this disease, primarily transmitted through flea and lice feces, sandflies, and possibly tick bites [14]. These bacteria cause chronic infections by infecting red blood cells and attacking endothelial cells, CD34+ progenitor cells, and host dendritic cells [15].

Bartonella infects humans and a wide variety of animal species. Bartonella DNA has been detected in ticks suspected of being a source of animal-associated Bartonella infection in humans. Bartonella spp. cause a variety of diseases in humans, including cat-scratch disease (Bartonella henselae), Carrion’s disease (CD) (Bartonella bacilliformis), trench fever (Bartonella quintana), endocarditis (B. quintana and B. henselae), bacillary angiomatosis (B. quintana and B. henselae), and hepatic peliosis (B. henselae) [5, 16]. B. quintana has emerged in homeless individuals who were in poor health [14]. The zoonotic pathogen B. henselae, which causes cat scratch disease, is probably the most prevalent in developed countries and is strongly associated with other syndromes, particularly eye infections and endocarditis. Cats are the main reservoirs; cat fleas (Ctenocephalides felis) are considered the primary vector, but other arthropods, e.g., ticks, may contribute to transmission [16].

Given the threat to public health posed by tick-borne zoonotic diseases, it is critical to study pathogens associated with ticks. There is limited information on the prevalence of Bartonella and Rickettsia in Iran and the prevalence of Bartonella and Rickettsia in human and vector infections. Thus, this study aimed to detect Rickettsia spp. and Bartonella species in ticks in northern Iran and conduct phylogenetic analysis.

Methods

Ethics statement

The Ethics Committee for National Institute for Medical Research Development "NIMAD" approved this study (Ethic Code: IR.NIMAD.REC.1398.373).

Sample collection

Ticks from the Research Center for Emerging and Re-emerging Diseases’ samples bank were used for analysis. The ticks were collected in 2017 and 2018 from domestic animals (sheep, goats, cows, camels, horses, dogs, and donkeys) and rodents in Golestan, Mazandaran, and Guilan provinces in northern Iran. The study area is bounded on the north by the Caspian Sea and the south by the Alborz mountain range. These provinces are covered with forests, mountains, and coasts and, have a temperate climate with three distinct geographical regions including temperate plains, mountainous and semi-arid regions.

Ticks samples were previously identified using morphological keys [17]. After the identification of collected ticks, the ticks were pooled for DNA extraction, based on the same tick’s species, collected locations, hosts, tick sex, and the growth stage of ticks. Finally, the pools of ticks included 1 to 22 ticks based on the above criteria.

DNA extraction from ticks

Pooled ticks were homogenized using liquid nitrogen and sterile PBS, and DNA was extracted using the potassium acetate method. Initially, 500 μl lysis buffer (0.1 M Tris-HCl, 0.05 M EDTA, 0.2 M sucrose, and 0.5% SDS) and 20 μl proteinase K (10 mg/ml) were added to the homogenized samples, and incubated at 56°C for one day. Amounts of 120 μl of 5 M sodium acetate were added to the samples and kept on ice for 10 min. After centrifuging the samples at 9660 RCF for 10 minutes, the supernatant was recovered, and 35 μl of 4 M sodium acetate and 1 ml of pure ethanol were added. The samples were thoroughly mixed and kept on ice for 10 minutes. The supernatant was discarded after centrifuging at 9660 RCF for 20 min, and the precipitates were washed with 500 μl of 70% ethanol, and the remaining alcohol was allowed to dry completely at room temperature. Finally, 200 μl of elution buffer (1 M Tris-HCl, 1 M EDTA) was added to the completely dried precipitates and kept at -20°C until the test [18].

Detection of the Rickettsia genus

Using the TaqMan Real-Time PCR method, DNA extracted from ticks was analyzed for Rickettsia spp. The 20 μl reactions contained 10 μl commercial master mix (RealQ Plus 2x Master Mix Ampliqon, Denmark), 4 μl template DNA, 900 nmol of forward and reverse primers, 200 nmol of a probe (marked with 6-Carboxyfluorescein (6-Fam) fluorescent dye as a reporter dye and TAMRA as a quencher) [19], and sterile distilled water to final volume. R. conorii DNA (Amplirun, Vircell) and distilled water were included in all assays as positive and negative controls, respectively. The amplification was performed in a Corbett 6000 Rotor-Gene system (Corbett, Victoria, Australia) programmed for a 10-min activation at 95°C, followed by 45 cycles at 95°C for 15 sec, and 60°C for 60 sec. The quantitative analysis was performed using the Rotor-Gene Q Series software and reading was taken at the end of each cycle in green at 60°C (Table 1).

Table 1. The primers and the probe used for the detection of Rickettsia spp. & Bartonella spp.

Genus Gene target Sequence (5´ to 3´) Amplicon size (bp)
Rickettsia spp. Rsp 5′- CGCAACCCTYATTCTTATTTGC -3′ 149
5′- CCTCTGTAAACACCATTGTAGCA -3′
6- FAM-TAAGAAAACTGCCGGTGATAAGCCGGAG–TAMRA
Bartonella spp. 16S-23S rRNA 5′-GGGGAAGGTTTTCCGGTTTATC-3′ 92
5′-GAGGACTTGAACCTCCGACC-3′

Amplification of gltA gene

According to the result of Real-Time PCR, positive sample for Rickettsia spp. with a CT ≤ 30 were further analyzed to identify the Rickettsia species by amplifying the gltA gene. The 20 μl reactions contained 10 μl of 2X commercial master mix (2x TEMPase Master Mix RED A Ampliqon, Denmark), 4 μl of DNA template, 500 nmol of g1tA-F primer (GCTCTTCTCATCCTATGGCTATTAT), and 500 nmol of g1tA-R primer (CAGGGTCTTCRTGCATTTCTT), and distilled water to the final volume [20]. The amplification program included an initial denaturation at 95°C followed by 40 cycles at 94°C for 30 sec, 58°C for 30 sec, 72°C for 60 sec, and final annealing at 72°C for 7 min.

Phylogenetic analysis

PCR products were electrophoresed on 1% agarose gel, and samples with specific bands (834 bp) were sent for sequencing (Genomin Co., Tehran, Iran). Chromas 2.6.6 software was used to evaluate the sequences. Final nucleotide sequences were compared with those available in the GenBank® database using the Basic Local Alignment Search Tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The gltA gene sequences for various Rickettsia species were extracted from the GenBank database and phylogenetically analyzed using MEGA software in conjunction with the sequences obtained from the samples in this study (MEGA version X 10.1). Phylogenetic relationships were inferred using the Neighbor-Joining method based on the Kimura 2-parameter model for Rickettsia spp. Gamma distribution (+G) was used to model evolutionary rate differences among sites selected by the best-fit model. Evolutionary analyses were conducted on 1000 bootstrap replications using the MEGA X software.

Bartonella detection

The 16S-23S rRNA gene was targeted in ticks’ DNA using the SYBR Green Real-time PCR method. The 20 μl reactions contained 10 μl of Plus 2x Master Mix Green Low ROXTM (AmpliQon, Denmark), 700 nmol of the forward primer and reverse primers (Table 1), 4 μl of template DNA, and distilled water to the final volume. The amplification was programmed in a Corbett 6000 Rotor-Gene system (Corbett Victoria, Australia) for an initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, 60°C for 20 sec, and 72°C for 20 sec with a melting step in between. Bartonella henselae DNA (Amplirun, Vircell) and distilled water were included in all assays as positive and negative control.

Results

In this study, 3999 ticks were examined by molecular method. After morphological examinations, ticks were pooled according to species, location, sex, and growth stage. There were 1415 male ticks (35.38%), 2542 female ticks (63.56%), and 42 nymphs (1.05%). A total of 1926 ticks were collected from cattle (48.16%), 1458 ticks were collected from sheep (36.45%), 383 ticks were collected from goats (9.57%), 50 ticks were collected from dogs (1.25%), 128 ticks were collected from camels (3.20%), five ticks were collected from horses (0.12%), two ticks were collected from donkeys (0.05%), and 47 ticks were collected from hedgehogs (1.17%). The study identified 11 tick species using morphological keys. They were classified into four genera: Ixodes, Haemaphysalis, Hyalomma, and Rhipicephalus, with the highest percentage belonging to Ixodes ricinus (46.4%), followed by Rhipicephalus turanicus (26.3%) and Rhipicephalus sanguineus (17.1%) (Table 2). The most numerous species in the prepared pools were I. ricinus (n = 259, 40.59%), Rh. sanguineus (n = 145, 22.73%), and Rh. turanicus (n = 131, 20.53%), respectively (Table 2).

Table 2. The population of ticks collected in the studied provinces, and the prevalence of positive tick pools for Rickettsia spp.es in 2017–18.

Genus Species No. of collected ticks in each province Total N (%) Number of tested pools No. of positive pools for Rickettsia sp. (%)
Mazandaran N (%) Golestan N (%) Guilan N (%) Per tick species Per tick genus (%)
Ixodes I. ricinus 1805(76.6) 6(0.41) 140(74.8) 1951(46.4) 259 13(5) 13(5)
Haemaphysalis H. concinna 6(0.25) - 1(0.53) 7(0.16) 4 0(0) 1(11.1)
H. inermis 3(0.12) - 1(0.53) 4(0.09) 4 1(25)
H. punctata - - 1(0.53) 1(0.02) 1 0 (0)
Hyalomma H. anatolicum - 40(2.74) - 40(1.0) 10 1(10) 15(25.8)
H. marginatum 56(2/37) 65(4.46) 16(8.5) 137(3.42) 44 13(29.5)
H. dromedarii - 18(1.23) - 18(0.45) 4 1(25)
Rhipicephalus Rh. bursa 48(2.03) 1(0.06) - 49(1.22) 13 4(3.07) 132(42.3)
Rh. sanguineus 343(14.5) 343(23.5) 1(0.53) 687(17.1) 145 71(48.9)
Rh. turanicus 61(2.58) 983(67.5) 9(4.81) 1053(26.3) 131 55(41.9)
Rh. annulatus 34(1.4) - 18(9.6) 52(1.3) 23 2(8.69)
Total 2356(100) 1456(100) 187 (100) 3999(100) 638 161 (25.23) 161 (25.23)

In this study, 638 pools of ticks were prepared for DNA extraction and molecular analysis. Finally, 59.2%(n = 378), 31.6% (n = 202), and 9.09% (n = 58) of the prepared pools belonged to Mazandaran, Golestan, and Guilan provinces, respectively (Table 3).

Rickettsia detection by Real-Time PCR

Of 638 DNA pooled samples tested by the Real-Time PCR, 161 pools (25.2%) were positive Rickettsia. Rhipicephalus genus had the highest percentage of positive pools (42.3%), and also, the highest percentage of positive pools belongs to Rh. sanguineus (48.9%), Rh. turanicus (41.9%), Hyalomma marginatum (29.5%), and Haemaphysalis inermis (25%) respectively(Table 2). Rickettsia infection was highest (42.3%) in the Rhipicephalus genus and lowest (5%) in the Ixodes genus (P<0.001). According to the number of positive pools in each province, 29.7% of Golestan province, 25.9% of Mazandaran province, and 17.5% of Guilan province were positive (Table 3). Rickettsial infection was significantly higher in ticks from Mazandaran and Golestan provinces than in ticks from Guilan (P<0.001). There was no statistically significant difference in Rickettsia infection between ticks from Mazandaran and Golestan provinces (P = 0.33).

Table 3. Prevalence of Rickettsia spp. in ticks based on counties and provinces.

Counties provinces Number of pools tested The number of positive pools for Rickettsia spp. per genus (%) N
Golestan Aq Qala 67 16(23.8)
Bandar Torkaman 56 11(19.6)
Aliabad 8 3(37.5)
Gorgan 39 19(48.7)
Gomishan 8 1(12.5)
Aliabad-e-Katul 23 10(43.4)
Gonbad Kavus 1 0(0)
Total 202 60(29.7)
Mazandaran Nur 62 17(27.4)
Amol 78 18(23)
Babol 45 13(28.8)
Sari 71 20(28.1)
Qaemshahr 55 22(40)
Mahmudabad 16 2(12.5)
Savadkuh 31 3(9.67)
Unknown 20 3(15)
Total 378 98(25.9)
Guilan Talesh 46 2(4.34)
Masal 5 1(20)
Rudsar 1 0(0)
Lahijan 6 0(0)
Total 58 3(5.17)

Identification and phylogenetic analysis of Rickettsia species

A total of 65 pool samples positive for Rickettsia were selected for species identification in such a way that the selected samples included different tick species, and from all the studied counties and from different hosts. Also, the Load of Rickettsia DNA (CT ≤30) was considered in sample selection for the phylogeny survey. Based on results of sequences Blast in GenBank® and phylogenetic analysis, eight distinct species were identified from a total of 65 sequenced Rickettsia gltA samples, the majority of which were R. massiliae (49.2%) (n = 32) and R. sibirica (30.8%) (n = 20). Other species of Rickettsia identified in present study included R. rhipicephali (n = 3), R. aeschlimannii (n = 5), R. helvetica (n = 5), R. asiatica (n = 4), R. monacensis (n = 6), and R. raoultii (n = 1) (Table 4 and Fig 1).

Table 4. Distribution of different species of Rickettsia spp. identified in tick species and provinces in this study.

Tick specie Province Host No. of positive sample typed Rickettsia spp (N)
Rh. turanicus Golestan Cattle 1 R. massiliae (1)
Dog 3 R. massiliae (3)
Goat 2 R. massiliae (2)
Sheep 4 R. massiliae (4)
Mazandaran Cattle 1 R. sibirica (1)
Dog 4 R. sibirica (2), R. massiliae (2)
Goat 2 R. sibirica (1), R. massiliae (1)
Sheep 7 R. sibirica (4), R. massiliae (3), R. rhipicephali (1)
Rh. sanguineous Golestan Goat 1 R. massiliae (1)
Sheep 4 R. massiliae (4)
Mazandaran Cattle 2 R. sibirica (1), R. massiliae (1)
Goat 8 R. sibirica (2), R. massiliae (4), R. rhipicephali (2)
Sheep 13 R. sibirica (8), R. massiliae (6), R. aeschlimannii (1)
Rh. bursa Mazandaran ND 1 R. sibirica (1)
I. ricinus Guilan Cattle 1 R. monacensis (1)
Mazandaran Cattle 6 R. helvetica (5), R. asiatica (4), R. monacensis (5)
H. marginatum Guilan Cattle 1 R. aeschlimannii (1)
Mazandaran Cattle 1 R. aeschlimannii (1)
Goat 1 R. aeschlimannii (1)
Sheep 2 R. aeschlimannii (1), R. raoultii (1)
Total 65 R. sibirica (20), R. massiliae (32), R. rhipicephali (3), R. aeschlimannii (5), R. helvetica (5), R. asiatica (4), R. monacensis (6), R. raoultii (1)

Fig 1. Phylogenetic analysis based on Rickettsia gltA gene sequencing and Neighbor-Joining method algorithm (Kimura 2-parameter model).

Fig 1

The test was performed with bootstrap (1000 repetitions) by MEGA X 10.1 software. Sample ID included R_number were the studied samples in this study.

R. massiliae infection was detected in ticks (Rh. turanicus and Rh. sanguineous)from different hosts (cattle, sheep, goats, and dogs) in Mazandaran and Golestan provinces. This species was identified in all Rh. turanicus ticks collected in Golestan province. Additionally, R. massiliae infection was detected in Rh. sanguineus ticks isolated from dogs and sheep in Golestan province and ticks isolated from dogs, sheep, and goats in Mazandaran province. Thirty samples (99.75%) of R. massiliae detected in this study were identical in gltA gene sequence, and matched 100% to the reference strain R. massiliae MTU5 (CP000683.1) in BLAST analysis. Two samples (R33 and R22a) were identical (100% and 99.87%, respectively) to the Genbank reference strain R. massiliae AZT80 (CP003319.1) and R. massiliae MTU5 (CP000683.1), respectively. No R. massiliae DNA was detected in R. bursa, I. ricinus, and H. marginatum ticks.

Rh. sanguineus, Rh. turanicus, and Rh. bursa ticks showed R. sibirica infection in Mazandaran province. According to gltA gene blast analysis in the Genbank, the majority (80%) of R. sibirica sequencesgenerated in the study were identical to R. sibirica strain (MF098405.1), and three R. sibirica identified (15%) also had 99.78% similarity with the above reference strain. Furthermore, a sample was matched 100% with another R. sibirica strain (acc. no. MF098404.1). There were no positive samples for R. sibirica in I. ricinus or H. marginatum ticks. Moreover, there were no positive samples for R. sibirica in ticks from Guilan and Golestan provinces.

Only H. marginatum and Rh. sanguineus ticks in the Mazandaran and Guilan provinces were infected with R. aeschlimannii, the most frequently isolated Rickettsia from H. marginatum ticks collected from cattle (Mazandaran, Guilan), sheep (Mazandaran), and goats (Mazandaran). Based on the gltA gene blast in the GenBank, two R. aeschlimannii detected in the present study (R6 and R21c) had a 99.88% similarity to a R. aeschlimannii strain (KY411135.1) belonging to the H. marginatum, and Rh. sanguineus ticks in Mazandaran province. Also three samples R31 (Mazandaran), R35 (Mazandaran), and R55 (Guilan) which were detected in H. marginatum had a 99.78% similarity to a R. aeschlimannii strain (KU961540.1), 99.78% similarity to R. aeschlimannii (HQ335513.1), and a 100% similarity to R. aeschlimannii (MH932014.1) in the GenBank for gltA gene sequence blast.

In Mazandaran province, R. helvetica was detected only in I. ricinus ticks isolated from cattle. Four R. helvetica samples (R48a, R49a, R52a, and R53a) were 100% identical to the R. helvetica sequence (KU310588.1) in the GenBank, and a sample (R50) was 99.88% identical to the recorded sequence in GanBanke database. Additionally, no infection with R. helvetica was detected in ticks collected from the other provinces.

R. asiatica infection was detected in four samples of I. ricinus isolated from cattle in Mazandaran province. When the gltA gene sequences of all samples were compared to the sequence of R. asiatica (AP019563.1) in the GenBank, 99.74% similarity was observed. Other tick species collected from other provinces were not infected with R. asiatica.

Furthermore, R. monacensis was isolated from I. ricinus ticks collected from cattle in Mazandaran and Guilan provinces. All five R. monacensis samples detected in the study were identical to the R. monacensis (LN794217.1) reference strains.

Only in Mazandaran province were R. rhipicephali infections observed in Rh. sanguineus (isolated from goats) and Rh. turanicus (isolated from sheep). When the gltA gene sequences of samples R22b, R24, and R37 were compared, they matched the R. rhipicephali (CP001313.1) reference strain in the GenBank by 97.87%, 99.5%, and 99.48%, respectively.

Moreover, we had a positive sample for R. raoultii in a H. marginatum tick isolated from sheep in Mazandaran province. The sample’s gltA gene sequence was 99.83% identical to the sequence of R. raoultii (MT178338.1) in the GenBank.

Five samples contained three different Rickettsia species, four of which were I. ricinus isolates from cattle in Mazandaran province co-infected with R. helvetica, R. asiatica, and R. monacensis. Infections with R. sibirica, R. massiliae, and R. aeschlimannii were detected in a sample of Rh. sanguineus ticks isolated from sheep in Mazandaran province. Furthermore, an Rh. turanicus isolate from sheep in Mazandaran province was found to be co-infected with R. massiliae and R. sibirica.

Bartonella detection

Based on the results of Real-time PCR, no positive samples for Bartonella spp. were detected among 638 tick pools.

Discussion

Zoonotic diseases are a significant threat to public health. Here, we examined Rickettsia and Bartonella pathogens in ticks from three northern Iranian provinces using Real-time PCR to better understand their epidemiology and possible transmission via vectors. According to the results, Rickettsia spp. was detected in 161 of 638 pools (25.2%).

Rickettsial pathogens have received significant attention over the last 25 years, as several tick-borne species previously considered non-pathogenic are now associated with human infections [21]. There are few studies for detection of Rickettsia spp on ticks in Iran. However, numerous studies have been conducted in neighboring countries of Iran on this pathogen as an infectious and high-risk agent for public health [22]. According to the results of gltA gene sequencing on 65 positive samples, the majority of species were identified as belonging to R. massiliae (49.2%) and R. sibirica (30.8%). R. massiliae was initially isolated from the Rhipicephalus genus, and the majority of reports in France, Greece, and Spain have been associated with Rh. turanicus and Rh. sanguineus [23]. The first human infection with this species was reported in 2005 in Italy. In humans, R. massiliae causes a disease similar to MSF [24].

R. massiliae was detected in ticks Rh. turanicus and Rh. sanguineus isolated from cattle, sheep, goats, and dogs in the provinces of Golestan, Mazandaran, and Guilan. In Palestine, a study was conducted to detect Rickettsial SFG in 867 ticks collected from various hosts. In this study, 148 samples were identified as positive for Rickettsia infection R. massiliae was the most frequently identified Rickettsia in this study. Twenty-eight ticks were positive for this species, with the most positive samples belonging to Rh. turanicus. Rh. sanguineus ticks were collected from dogs and sheep, corroborating the current study [25].

In 1991, R. sibirica was isolated for the first time from H. asiaticum ticks in Mongolia. This pathogen was subsequently isolated from members of the genus Hyalomma, particularly H. truncatum and H. excavatum, worldwide. The first human infection with R. sibirica was reported in 1996 in France, and the patient presented with a mild illness that included fever, skin rashes, and scarring R. sibirica was identified in Rh. sanguineus, Rh. turanicus, and Rh. bursa, but not in any of the Hyalomma genera in this study [26]. R. aeschlimannii was initially isolated in 1997 from Hy. marginatum ticks on cattle in Hungary. Furthermore, this species infects H. marginatum in Niger, Zimbabwe, and Mali. In humans, R. aeschlimannii causes a febrile illness similar to MSF, and the first case was diagnosed in a tourist to Hungary in 2000 [27]. As with the previous studies, most positive samples for R. aeschlimannii were detected in H. marginatum ticks isolated from cattle, sheep, and goats. Moreover, it was detected in the Rh. sanguineus ticks isolated from sheep in Mazandaran.

According to a study in Turkey, from 322 ticks were isolated from humans Rickettsia spp. was detected in 100 samples, and following species were identified: R. aeschlimannii, R. slovaca, R. raoultii, R. hoogstraalii, R. sibirica, and R. monacensis. R. aeschlimannii was the most frequently detected species (19.5%), in Hy. marginatum ticks. After R. massiliae, the most positive samples in present study belonged to R. sibirica, but in Turkey, only 0.31% of samples were infected with R. sibrica [28].

R. monacensis, a member of the spotted fever group, was isolated for the first time using molecular methods from I. ricinus ticks in Germany. It has also been isolated from I. ricinus ticks in Hungary and Portugal. The pathogenesis of R. monacensis is unknown, but human infections with this species have been reported in Spain, Italy, and the Netherlands [29]. In this study, R. monacensis was also detected in I. ricinus ticks in Mazandaran.

In a study conducted in Turkey, 25 out of 1019 ticks collected from various country regions were found to be positive for Rickettsia infection. Four of the 25 samples were reported positive for R. monacensis, only in I. ricinus ticks, and was consistent with the findings of this study. Additionally, R. raoultii was detected in Dermacentor marginatus ticks in the study in Turkey [30], but only positive samples for R. raoultii were detected in H. marginatum isolated from sheep in Mazandaran province. R. raoultii was first discovered in 1999 in Rhipicephalus pomilius and Dermacentor nuttalli ticks in the former Soviet Union and was later named R. raoultii in 2008 as a member of the Rickettsia family. Moreover, this pathogen was identified in D. marginatum isolated from a patient in France, demonstrating the pathogen’s pathogenicity in humans [31].

R. helvetica, a member of the spotted fever group, was first detected in many European and Asian countries from I. ricinus ticks. Although this species is generally considered non-pathogenic, mild to severe disease cases, have been reported in humans [32]. R. helvetica was isolated from I. ricinus ticks collected from cattle in this study. in Turkey, 69 of 167 ticks isolated from humans hospitalized across the country tested positive for Rickettsia infection. According to the findings, this study found that R. monacensis (70%) was the most frequently detected species in I. ricinus ticks. Moreover, 2 (3%) I. ricinus ticks tested positive for R. helvetica, consistent with our findings in present study [33].

R. rhipicephali was isolated for the first time from Rh. sanguineus ticks in Mississippi but has not been associated with human infections [34]. R. rhipicephali was also found in Rh. sanguineus and Rh. turanicus ticks in this study. R. asiatica, originally designated Rickettsia IO-1T, was isolated from Ixodes ticks in Japan in 1993 [35]. R. asiatica was detected in I. ricinus ticks isolated from cattle in this study. The R. rhipicephali and R. asiatica species appeared to have not been isolated in neighboring countries and were described for the first time in this study.

In this study, the collected ticks were identified using only morphological keys. It is recommended to do the molecular identification of ticks as a confirmatory in future studies. Another limitation was that the main focus of the current study was on the detection of Bartonella spp that they are pathogenic in humans and animals. Therefore, it is possible that we could not detect some non-pathogenic Bartonella.

Conclusion

According to the result of our study, Rickettsia species were found to be circulating in three Northern provinces. Based on data available in the world, a number of these identified pathogens in this study are capable of causing disease in humans. This is a cautionary tale for the health care system. As a result, it is recommended that these diseases be considered in the differential diagnosis of febrile diseases caused by tick bites, skin rashes, or Crimean–Congo hemorrhagic fever (CCHF) and that the healthcare system be educated about the disease’s critical importance and symptoms.

Acknowledgments

We would also express our gratitude to Dr. Ahmad Mahmoudi, Hamed Hanifi, Amir Hesam Neamati, Alireza Mordadi, Ali Mohammadi, and Seyyed Adel Hosseini from Department of Epidemiology and Biostatistics of Pasteur Institute of Iran, who helped us in tick’s collection and some of the laboratory process.

Data Availability

All relevant data are within the paper.

Funding Statement

The study was supported by a grant from the National Institute for Medical Research Development (NIMAD) (grant no: 987978). Also supported by Pasteur Institute of Iran (grant no: 1744) and Prof. Mostafavi received the fund.

References

  • 1.Slingenbergh J., et al., Ecological sources of zoonotic diseases. Revue scientifique et technique-Office international des épizooties, 2004. 23(2): p. 467–484. doi: 10.20506/rst.23.2.1492 [DOI] [PubMed] [Google Scholar]
  • 2.Rahman M., et al., Zoonotic diseases: etiology, impact, and control. Microorganisms, 2020. 8(9): p. 1405. doi: 10.3390/microorganisms8091405 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Durden L.A., Taxonomy, host associations, life cycles and vectorial importance of ticks parasitizing small mammals, in Micromammals and Macroparasites. 2006, Springer. p. 91–102. [Google Scholar]
  • 4.Pfäffle M., et al., The ecology of tick-borne diseases. International journal for parasitology, 2013. 43(12–13): p. 1059–1077. [DOI] [PubMed] [Google Scholar]
  • 5.Chang C., et al., Molecular evidence of Bartonella spp. in questing adult Ixodes pacificus ticks in California. Journal of Clinical Microbiology, 2001. 39(4): p. 1221–1226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Dantas-Torres F., Chomel B.B., and Otranto D., Ticks and tick-borne diseases: a One Health perspective. Trends in parasitology, 2012. 28(10): p. 437–446. [DOI] [PubMed] [Google Scholar]
  • 7.Sosa-Gutiérrez C.G., et al., Tick-borne rickettsial pathogens in rodents from Mexico. Journal of Biomedical Science and Engineering, 2014. 7(11): p. 884. [Google Scholar]
  • 8.Blanda V., et al., New real-time PCRs to differentiate Rickettsia spp. and Rickettsia conorii. Molecules, 2020. 25(19): p. 4431. doi: 10.3390/molecules25194431 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Pacheco R.C., et al., Rickettsial infection in ticks (Acari: Ixodidae) collected on birds in southern Brazil. Journal of medical entomology, 2012. 49(3): p. 710–716. doi: 10.1603/me11217 [DOI] [PubMed] [Google Scholar]
  • 10.Parola P., Paddock C.D., and Raoult D., Tick-borne rickettsioses around the world: emerging diseases challenging old concepts. Clinical microbiology reviews, 2005. 18(4): p. 719–756. doi: 10.1128/CMR.18.4.719-756.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kuo C.-C., et al., High prevalence of Rickettsia spp. infections in small mammals in Taiwan. Vector-Borne and Zoonotic Diseases, 2015. 15(1): p. 13–20. doi: 10.1089/vbz.2014.1584 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Parola P., et al., Detection of Ehrlichia spp., Anaplasma spp., Rickettsia spp., and other eubacteria in ticks from the Thai-Myanmar border and Vietnam. Journal of clinical microbiology, 2003. 41(4): p. 1600–1608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gundi V.A., et al., Bartonella spp. in rats and zoonoses, Los Angeles, California, USA. Emerging infectious diseases, 2012. 18(4): p. 631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Oteo J.A., et al., Prevalence of Bartonella spp. by culture, PCR and serology, in veterinary personnel from Spain. Parasites & vectors, 2017. 10(1): p. 1–9. doi: 10.1186/s13071-017-2483-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Billeter S., et al., Vector transmission of Bartonella species with emphasis on the potential for tick transmission. Medical and veterinary entomology, 2008. 22(1): p. 1–15. [DOI] [PubMed] [Google Scholar]
  • 16.Cotté V., et al., Transmission of Bartonella henselae by Ixodes ricinus. Emerging infectious diseases, 2008. 14(7): p. 1074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Walker A.R., Ticks of domestic animals in Africa: a guide to identification of species. 2003: Bioscience Reports Edinburgh. [Google Scholar]
  • 18.Rodríguez I., et al., An alternative and rapid method for the extraction of nucleic acids from ixodid ticks by potassium acetate procedure. Brazilian Archives of Biology and Technology, 2014. 57(4): p. 542–547. [Google Scholar]
  • 19.Giulieri S., et al., Development of a duplex real time PCR for the detection of Rickettsia spp. and typhus group rickettsia in clinical samples. FEMS Immunology & Medical Microbiology, 2012. 64(1): p. 92–97. [DOI] [PubMed] [Google Scholar]
  • 20.Labruna M.B., et al., Molecular evidence for a spotted fever group Rickettsia species in the tick Amblyomma longirostre in Brazil. Journal of Medical Entomology, 2004. 41(3): p. 533–537. [DOI] [PubMed] [Google Scholar]
  • 21.Parola P., et al., Update on tick-borne rickettsioses around the world: a geographic approach. Clinical microbiology reviews, 2013. 26(4): p. 657–702. doi: 10.1128/CMR.00032-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Khamesipour F., et al., Tick-borne zoonoses in the Order Rickettsiales and Legionellales in Iran: A systematic review. PLoS neglected tropical diseases, 2018. 12(9): p. e0006722. doi: 10.1371/journal.pntd.0006722 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Cardeñosa N., Segura F., and Raoult D., Serosurvey among Mediterranean spotted fever patients of a new spotted fever group rickettsial strain (Bar29). European journal of epidemiology, 2003. 18(4): p. 351–354. doi: 10.1023/a:1023654400796 [DOI] [PubMed] [Google Scholar]
  • 24.Vitale G., et al., Rickettsia massiliae human isolation. Emerging infectious diseases, 2006. 12(1): p. 174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ereqat S., et al., Molecular detection and identification of spotted fever group rickettsiae in ticks collected from the West Bank, Palestinian territories. PLoS neglected tropical diseases, 2016. 10(1): p. e0004348. doi: 10.1371/journal.pntd.0004348 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.De Sousa R., et al., Rickettsia sibirica isolation from a patient and detection in ticks, Portugal. Emerging infectious diseases, 2006. 12(7): p. 1103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Raoult D., et al., First documented human Rickettsia aeschlimannii infection. Emerging infectious diseases, 2002. 8(7): p. 748. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Karasartova D., et al., Bacterial and protozoal pathogens found in ticks collected from humans in Corum province of Turkey. PLoS neglected tropical diseases, 2018. 12(4): p. e0006395. doi: 10.1371/journal.pntd.0006395 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kim Y.S., et al., First isolation of Rickettsia monacensis from a patient in South Korea. Microbiology and immunology, 2017. 61(7): p. 258–263. [DOI] [PubMed] [Google Scholar]
  • 30.Orkun Ö., et al., Turkey tick news: A molecular investigation into the presence of tick-borne pathogens in host-seeking ticks in Anatolia; Initial evidence of putative vectors and pathogens, and footsteps of a secretly rising vector tick, Haemaphysalis parva. Ticks and tick-borne diseases, 2020. 11(3): p. 101373. doi: 10.1016/j.ttbdis.2020.101373 [DOI] [PubMed] [Google Scholar]
  • 31.Jia N., et al., Human infections with Rickettsia raoultii, China. Emerging infectious diseases, 2014. 20(5): p. 866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Nilsson K., Elfving K., and Påhlson C., Rickettsia helvetica in patient with meningitis, Sweden, 2006. Emerging infectious diseases, 2010. 16(3): p. 490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Gargili A., et al., Rickettsia species in ticks removed from humans in Istanbul, Turkey. Vector-Borne and zoonotic diseases, 2012. 12(11): p. 938–941. doi: 10.1089/vbz.2012.0996 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Labruna M.B., et al., Isolation of Rickettsia rhipicephali and Rickettsia bellii from Haemaphysalis juxtakochi ticks in the state of São Paulo, Brazil. Applied and Environmental Microbiology, 2007. 73(3): p. 869–873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Thu M.J., et al., Complete Genome Sequence of Rickettsia asiatica Strain Maytaro1284, a Member of Spotted Fever Group Rickettsiae Isolated from an Ixodes ovatus Tick in Japan. Microbiology resource announcements, 2019. 8(37): p. e00886–19. doi: 10.1128/MRA.00886-19 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Brian Stevenson

Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.

6 Oct 2022

PONE-D-22-25506Molecular Detection of Infection with Rickettsia spp. and Bartonella spp. in collected Ticks from Northern IranPLOS ONE

Dear Dr. Mostafavi,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses all of the points raised during the review process. In addition, I ask that you revise the title of your manuscript. The current title implies that you detected Bartonella in ticks, whereas you did not actually find any.  Perhaps something like:Molecular Surveillance for Rickettsia spp. and Bartonella spp. in Ticks from Northern Iran

Please submit your revised manuscript by Nov 20 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Brian Stevenson, Ph.D.

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1.  Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf  and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.  If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.

Upon resubmission, please provide the following:

The name of the colleague or the details of the professional service that edited your manuscript

A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)

A clean copy of the edited manuscript (uploaded as the new *manuscript* file)

3. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.

In your revised cover letter, please address the following prompts:

a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.

b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.

We will update your Data Availability statement on your behalf to reflect the information you provide

4. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript by Ghasemi et al., present data on Molecular Detection of Infection with Rickettsia spp. and Bartonella spp. in collected Ticks from Northern Iran. Overall, the manuscript is well described, and the information is interesting and important for researchers in the field of tick-borne diseases and ticks.

Only minor revisions are suggested to improve the manuscript.

Results section: the authors mentioned the identification of 11 collected tick species Line 197- using only morphological keys, some of them are very similar it would be good if they were able to do molecular identification of tick species as a confirmatory for morphological keys.

Table 1 title: Bartonella spp (spp. Shouldn’t be italic)

Table 3 title: Bartonella spp (spp. Shouldn’t be italic)

Line 180 table 1 remove reference 20 from the table title and if it is for the primers sets put in the method section.

Line 212: (P<0.001) P should be italic

Line 182 table 1 Bartonella correct to italic

Line 297 correct Bartonella to italic

Line 298 correct Bartonella to italic

Reviewer #2: Ghasemi et al. present an interesting piece of descriptive work on the prevalence of Rickettsia species in a region of Iran that includes ~7.5 million people that could be at risk of tick-borne illness. The work does a reasonable job cataloging Rickettsia species in the region, but I would like to see additional controls confirming their finding that Bartonella species were not present in ticks in the region. Otherwise, my concerns are largely minor and should not hold up publication.

Major Concerns

1) If the authors choose to include their Bartonella result, a positive control is necessary. The best experiment would be to amplify DNA from an arthropod known to be infected with Bartonella. The second best experiment would be Bartonella DNA spiked into one of their tick pools to confirm that the authors can detect Bartonella using their methods. qPCR on purified Bartonella DNA itself would not suffice.

2) Caution should be used comparing frequencies across the pools and a sentence pointing out that it is possible that the proportions of infections across species could have been skewed by the pool design (eg. Uneven distribution of infections across the pools) may be important to include around line 216 or so. Regardless, the findings themselves are interesting.

Minor Concerns

1) Some additional detail on pool design is necessary—is it correct to assume the pool size was around 5-6 ticks per pool? It appears that pools also contained a single species from a single region, is that correct? Details should be included in the methods, as well as when the study design is introduced around line 193.

2) Line 63 – I believe typhus fever, rather than Typhoid fever, is meant here.

3) Line 71 – Propagate/Spread may be more precise language than sustain here.

4) Line 228 – How were these 65 pools chosen. Table 4 suggests that the ticks and regions they came from were diverse, but some information in the text could be useful

5) Methods – Reporting centrifugation steps in terms of “times g” or “RCF” is preferred to RPM.

Reviewer #3: In this manuscript the authors have made a screening of the different rickettsia species present in northern Iranian regions. Using qPCR methodology they detected many positive ticks for rickettsia and were able to identify and classify the bacteria species.

The minor concerns I have focusses on the text, and some standard name usage.

1. It is complicated to differentiate Rickettsia (e.g R. sibrica) from Rhipicephalus ticks (R. sanguineus). I propose that authors change the writing of Rhipicephalus tick species in the whole manuscripts and use Rh. as done in the discussion (line 327).

Some part of text could be better explained for non-specific reader

line 70 It is hard to understand how animal transmission differ from human one, this part need better explanations.

line 122 I do not understand the meaning of "separated into groups of one to several" maybe you could said: After identifying tick samples, we separated ticks in groups of one to several individuals using different criteria: species, host, sex....

line 194 Could the authors give further details concerning the molecular analysis performed.

line 208 Rickettsia need to be added after the word "positive", to be sure that we understand the test conducted.

line 335 Re-write the "from 322 ticks were isolated"

line 346 wrong verb conjugation "In a study was conducted in Turkey" take out "was"

line 371-372 the author should explain explicitly what are the study limitations. These sentences are hard to understand.

Minor typos in the text:

line 72 missing space diagnosedin

line 117 is covered is use twice, may delete one.

line 133 . in a middle of a sentence (after the world ethanol)

line 249 In Cap i not necessary

line 256 sequneces to be change to sequences

line 268 Alsothree missing spaces between the 2 world

line 353 andwas missing space

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Jeffrey Bourgeois

Reviewer #3: Yes: Marine J. Petit

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Dec 7;17(12):e0278579. doi: 10.1371/journal.pone.0278579.r002

Author response to Decision Letter 0


5 Nov 2022

Response to Editor and Reviewer Comments

From the handling editor:

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses all of the points raised during the review process.

Editor Comments 1: In addition, I ask that you revise the title of your manuscript. The current title implies that you detected Bartonella in ticks, whereas you did not actually find any. Perhaps something like: Molecular Surveillance for Rickettsia spp. and Bartonella spp. in Ticks from Northern Iran

Author’s response 1: Thanks for your kind attention. The manuscript was revised based on editor comments.

Reviewer #1:

The manuscript by Ghasemi et al., present data on Molecular Detection of Infection with Rickettsia spp. and Bartonella spp. in collected Ticks from Northern Iran. Overall, the manuscript is well described, and the information is interesting and important for researchers in the field of tick-borne diseases and ticks.

Only minor revisions are suggested to improve the manuscript.

Reviewer Comments 1: Results section: the authors mentioned the identification of 11 collected tick species Line 197- using only morphological keys, some of them are very similar it would be good if they were able to do molecular identification of tick species as a confirmatory for morphological keys.

Author’s response 2: Thanks for your attention. In this study, the collected ticks were identified using only morphological keys. We understand your concern, but unfortunately, it is not possible for us to do it now, and we will try to consider your valuable advice in the future studies. Also, this limitation was added to the manuscript.

Reviewer Comments 2: Table 1 title: Bartonella spp (spp. Shouldn’t be italic)

Table 3 title: Bartonella spp (spp. Shouldn’t be italic)

Line 180 table 1 remove reference 20 from the table title and if it is for the primers sets put in the method section.

Line 212: (P<0.001) P should be italic

Line 182 table 1 Bartonella correct to italic

Line 297 correct Bartonella to italic

Line 298 correct Bartonella to italic

Author’s response 1: Thanks. The manuscript was revised based on the reviewer comments.

Reviewer #2:

Ghasemi et al. present an interesting piece of descriptive work on the prevalence of Rickettsia species in a region of Iran that includes ~7.5 million people that could be at risk of tick-borne illness. The work does a reasonable job cataloging Rickettsia species in the region, but I would like to see additional controls confirming their finding that Bartonella species were not present in ticks in the region. Otherwise, my concerns are largely minor and should not hold up publication.

Major Concerns

Reviewer Comments 1: If the authors choose to include their Bartonella result, a positive control is necessary. The best experiment would be to amplify DNA from an arthropod known to be infected with Bartonella. The second best experiment would be Bartonella DNA spiked into one of their tick pools to confirm that the authors can detect Bartonella using their methods. qPCR on purified Bartonella DNA itself would not suffice.

Author’s response 1: We understand your concern. The negative result of Bartonella detection in all tick samples was surprising for us as well. We have checked our diagnosis protocol several times, and we tried different methods to make sure the results obtained for Bartonella are correct. Such as, before DNA extraction, we added a certain amount of positive control DNA to a few tick samples. Then the genomic DNA of these ticks was extracted and Bartonella was successfully detected in these samples by qPCR. Also, we spiked purified Bartonella DNA to a few extracted DNA of ticks, and Bartonella was successfully detected in these samples by qPCR, too.

Reviewer Comments 2: Caution should be used comparing frequencies across the pools and a sentence pointing out that it is possible that the proportions of infections across species could have been skewed by the pool design (eg. Uneven distribution of infections across the pools) may be important to include around line 216 or so. Regardless, the findings themselves are interesting.

Author’s response 2: Please see our previous response.

Reviewer Comments 3: Some additional detail on pool design is necessary—is it correct to assume the pool size was around 5-6 ticks per pool? It appears that pools also contained a single species from a single region, is that correct? Details should be included in the methods, as well as when the study design is introduced around line 193.

Author’s response 3: Thanks, the manuscript was revised.

“After the identification of collected ticks, the ticks were pooled for DNA extraction, based on the same tick’s species, collected locations, hosts, tick sex, and the growth stage of ticks. Finally, the pools of ticks included 1 to 22 ticks based on the above criteria”.

Reviewer Comments 4: Line 63 – I believe typhus fever, rather than Typhoid fever, is meant here.

Author’s response 4: Thanks, revised.

Reviewer Comments 5: Line 71 – Propagate/Spread may be more precise language than sustain here.

Author’s response 5: Thanks, revised.

Reviewer Comments 6: Line 228 – How were these 65 pools chosen. Table 4 suggests that the ticks and regions they came from were diverse, but some information in the text could be useful

Author’s response 6: A total of 65 positive Rickettsia samples were selected for the phylogenetic study based on the diversity of tick species, host, and geographical area. Also, the Load of Rickettsia DNA (CT ≤30) was considered in sample selection for the phylogeny survey.

Reviewer Comments 7: Methods – Reporting centrifugation steps in terms of “times g” or “RCF” is preferred to RPM.

Author’s response 7: Thanks, revised.

Reviewer #3:

In this manuscript the authors have made a screening of the different rickettsia species present in northern Iranian regions. Using qPCR methodology they detected many positive ticks for rickettsia and were able to identify and classify the bacteria species.

The minor concerns I have focusses on the text, and some standard name usage.

Reviewer Comments 1: It is complicated to differentiate Rickettsia (e.g R. sibrica) from Rhipicephalus ticks (R. sanguineus). I propose that authors change the writing of Rhipicephalus tick species in the whole manuscripts and use Rh. as done in the discussion (line 327).

Author’s response 1: Thanks, revised.

Reviewer Comments 2: Some part of text could be better explained for non-specific reader:

line 70 It is hard to understand how animal transmission differ from human one, this part need better explanations.

line 122 I do not understand the meaning of "separated into groups of one to several" maybe you could said: After identifying tick samples, we separated ticks in groups of one to several individuals using different criteria: species, host, sex....

line 194 Could the authors give further details concerning the molecular analysis performed.

line 208 Rickettsia need to be added after the word "positive", to be sure that we understand the test conducted.

line 335 Re-write the "from 322 ticks were isolated":

line 346 wrong verb conjugation "In a study was conducted in Turkey" take out "was"

Author’s response 2: Thanks. All done.

Reviewer Comments 3: line 371-372 the author should explain explicitly what are the study limitations. These sentences are hard to understand.

Author’s response 3: The limitations of study were revised.

Reviewer Comments 4: Minor typos in the text:

line 72 missing space diagnosedin

line 117 is covered is use twice, may delete one.

line 133 . in a middle of a sentence (after the world ethanol)

line 249 In Cap i not necessary

line 256 sequneces to be change to sequences

line 268 Alsothree missing spaces between the 2 world

line 353 andwas missing space

Author’s response 4: Thanks for your kind attention. The manuscript was revised based on your comments

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 1

Brian Stevenson

21 Nov 2022

Molecular Surveillance for Rickettsia spp. and Bartonella spp. in Ticks from Northern Iran

PONE-D-22-25506R1

Dear Dr. Mostafavi,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Brian Stevenson, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Brian Stevenson

28 Nov 2022

PONE-D-22-25506R1

Molecular Surveillance for Rickettsia spp. and Bartonella spp. in Ticks from Northern Iran

Dear Dr. Mostafavi:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Prof. Brian Stevenson

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Attachment

    Submitted filename: Response to Reviewers.docx

    Data Availability Statement

    All relevant data are within the paper.


    Articles from PLOS ONE are provided here courtesy of PLOS

    RESOURCES