Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2022 Dec 7;17(12):e0278539. doi: 10.1371/journal.pone.0278539

Feasibility of combining short tandem repeats (STRs) haplotyping with preimplantation genetic diagnosis (PGD) in screening for beta thalassemia

Vu Viet Ha Vuong 1,2,#, Thinh Huy Tran 1,3,4,‡, Phuoc-Dung Nguyen 1,‡, Nha Nguyen Thi 2,‡, Phuong Le Thi 1,‡, Dang Thi Minh Nguyet 1,‡, Manh-Ha Nguyen 4,‡, The-Hung Bui 1,5,‡, Thanh Van Ta 1,3,4,‡, Van-Khanh Tran 1,*
Editor: J Francis Borgio6
PMCID: PMC9728894  PMID: 36476827

Abstract

β-thalassemia is an autosomal recessive disease with the reduction or absence in the production of β-globin chain in the hemoglobin, which is caused by mutations in the Hemoglobin subunit beta (HBB) gene. In Vietnam, the number of β-thalassemia carriers range from 1.5 to 25.0%, depending on ethnic and geographical areas, which is much higher than WHO’s data worldwide (1.5%). Hence, preimplantation genetic diagnosis (PGD) plays a crucial role in reducing the rate of β-thalassemia affected patients/carriers. In this research, we report the feasibility and reliability of conducting PGD in combination with the use of short tandem repeat (STR) markers in facilitating the birth of healthy children. Six STRs, which were reported to closely linked with the HBB gene, were used on 15 couples of β-thalassemia carriers. With 231 embryos, 168 blastocysts were formed (formation rate of 72.73%), and 88 were biopsied and examined with STRs haplotyping and pedigree analysis. Thus, the results were verified by Sanger sequencing, as a definitive diagnosis. Consequently, 11 over 15 couples have achieved pregnancy of healthy or at least asymptomatic offspring. Only three couples failed to detect any signs of pregnancy such as increased Human Chorionic Gonadotropin (HCG) level, foetal sac, or heart; and one couple has not reached embryo transfer as they were proposed to continue with HLA-matching to screen for a potential umbilical cord blood donor sibling. Thus, these results have indicated that the combination of PGD with STRs analysis confirmed by Sanger sequencing has demonstrated to be a well-grounded and practical clinical strategy to improve the detection of β-thalassemia in the pregnancies of couples at-risk before embryo transfer, thus reducing β-thalassemia rate in the population.

Introduction

β-thalassemia is an autosomal recessive disease with the reduction or absence in the production of β-globin chain, which is caused by mutations in the HBB gene. Based on the zygosity of the β-thalassemia mutations, it is categorized into three groups: a heterozygous mutation results in a β-thalassemia carriers, expressing mild symptoms; and the two others carrying homozygous mutations are β-thalassemia major and intermedia, depending on the severity of the mutations.

According to WHO, about 1.5% of the world population are β-thalassemia carriers [1], in which 0.5 to 12.8% belongs to South-East Asian countries [2]. In Vietnam, this number is even higher, from 1.5 to 25.0%, depending on ethnic and geographical areas [3–5].

One notable difference between α- and β-thalassemia is that not only until the first 6 months of life, β-thalassemia patients express anemia as the HbF production declines and the presence of HbB is required [6]. Hence, preimplantation genetic diagnosis (PGD) is considered as an important tool in cutting down the rate of β-thalassemia infants, which would reduce the financial burden on families of β-thalassemia carriers. Additionally, PGD in conjunction with in vitro fertilisation facilitate the birth of a healthy child by selecting the genetically non-affected embryos to transfer, therefore, no abortion is required. Hence, it would be more popularly acceptable than prenatal genetic diagnosis.

Various indirect and direct strategies using PCR-based techniques have been proposed to optimise the PGD procedure of β-thalassemia, such as allele-specific reverse dot blot, single-stranded confirmation polymorphism and denaturing gradient gel electrophoresis [7], or nested PCR and direct sequencing [8]. However, there are more than 200 of known HBB mutations [9], the risk of having a false negative is quite high due to the possible errors in experiment design or allele drop out due to the low DNA content.

Recently, the use of microsatellite markers such as short tandem repeats (STRs) have gained prominent potentials in PGD for β-thalassemia as these selected STRs are linked closely with the HBB gene which helps provide linkage analysis of the mutant presences in the family and avoid allele drop out. Additionally, a series of STRs specific for Vietnamese population has been developed [10], which would further increase the precision of the method.

In this report, we presented the retrospective review of the clinical utility of STRs haplotyping in PGD to facilitate the birth of healthy/asymptomatic children of β-thalassemia carrier couples received reproductive service at our centre.

Methods

Ethics statement

The study was approved by Hanoi Medical University Institutional Ethical Review Board, ID 470/GCN-HDDDNCYSH-DHYHN. Participants were informed, and their written consents were documented after receiving genetic counselling from clinical geneticist.

Patients

This is a retrospective study of patients, including fifteen couples at risks of having β-thalassemia offspring requested for in vitro fertilization (IVF) procedures and PGD at Post Hospital during 2020–2021. Their sequencing results indicated that they were β-thalassemia carriers (heterozygotes—possessing one defective alleles). They all received the similar controlled ovarian stimulation, Intracytoplasmic Sperm Injection (ICSI) protocol and preimplantation genetic screening (PGS).

Test procedure

Each couple and additional family members’ blood samples were subjected to hemoglobin electrophoresis, β-thalassemia gene mutation detection and STRs linkage analysis. DNA samples of the couples and family members were extracted from peripheral blood using QIAmp® DNA Mini Kit (Ref 51304).

To obtain the DNA profile, 6 STR markers were used, 4 upstream (D11S1243, HBB5138, HBB5178, HBB5205) and 2 downstream (D11S1760, HBB5576), which are closely linked with the Hbb gene (Table 1). STRs primers were obtained accordingly to the literature [11]. Multiplex PCR was performed to amplify the STR markers by QIAGEN Multiplex PCR Kit (100) (ID: 206143), and the fragments were separated using Applied Biosystem Bioanalyser 3500. The data was observed and analysed on GeneMarker software.

Table 1. STR markers properties.

STR markers Repeat motif Size Primer 5’–3’ (F & R)
Upstream D11S1243 (TG)n 202–238 HEX -CTGCCCTAATTCTGTCTACC
GTTGTGCACCATGAAGATACAC
HBB5138 (AC)n 386–410 HEX -AGAAATGTCCTTTAGAGAAATACCTTC
GTGGAGAGGAATCTGTTACTG
HBB5178 (TG)n 137–171 FAM -CGTAATTGCTTTCAGTACCATTTATG
GATGTATTCGTCAACAGATAAATGG
HBB5205 (AGAT)n 380–428 FAM -CCAGGGTAGGTGACATATAC
GTAACTCAAAAAATGGGACCCAAAC
Down-stream D11S1760 (CA)n 174–220 FAM -ACCCTGAGTGTCTTCAAAACTC
CAATACTGCTGCATCATGACT
HBB5576 (AAGG)n 306–348 FAM -TCCTTCAGGTAAGAAGGAGC
CTTGAAGAGGCTAGGTGC
Open in a new tab

Embryo cell samples were received from IVF centre after embryo biopsy at day 5. Hence, whole genome amplification (WGA) was performed using QIAGEN REPLI® Single Cell (Ref 150343). STR haplotyping was conducted for the DNA profiles comparison with the couples and family members’ profiles to screen for the mutated alleles.

Results

Pedigree analysis

Couples’ characteristics were represented in Table 2. For most couples, as linkage analysis only provides whether the presence of the mutated allele received parentally, it lacks evidence to confirm which allele carrying β-thalassemia mutation for couples with no β-thalassemia children. Hence, samples from couples’ parents were required to conduct the examination.

Table 2. Characteristics of couples.

Couple Age, female/male (years) Female genotype Male genotype Pregnancy history
1 29/30 CD35 CD26 -
2 28/28 CD17 CD41/42 1 boy after the first PGD cycle
3 31/30 CD17 CD26 -
4 25/36 CD17 CD26 -
5 26/28 CD26 CD26 No pregnancy after the first embryo cycle
6 27/29 CD17 CD41/42 -
7 33/34 CD41/42 CD41/42 -
8 32/32 CD17 CD17 -
9 29/30 CD26 CD71/72 -
10 26/31 CD41/42 CD26 No pregnancy after the first embryo cycle
11 33/35 CD41/42 CD41/42 -
12 38/39 CD26 CD26 -
13 28/28 CD27/28 CD41/42 -
14 26/26 CD26 CD41/42 -
15 28/28 CD17 CD41/42 Has one child carrying CD17 and CD41/42 mutations
Open in a new tab

For couple 15, as they had one child carrying the HBB mutations, thus, only samples from the parents and the child were required for STR haplotyping, however, samples of additional family members were still used to increase the certainty of the method. The STR haplotyping results of couple 15 (Fig 1A) were used to obtain the STRs profile of the family. Hence, in alignment with the Sanger sequencing results of each family members, the mutated alleles were profiled and tracked in the embryos via pedigree analysis. As observed in Couple 15, the mutated alleles were detected and transferred from the parents to the child and the embryo HN4 and HN5 carrying CD41/42 and CD17 respectively (Fig 1B), which agreed with the Sanger sequencing results (S1 Fig).

Fig 1. STRs data and pedigree analysis.

Fig 1

Open in a new tab

(A) STRs data analysed on GeneMarker Software, with HBB5178, D11S1760, HBB5576, HBB5205 in blue, and D11S1243, HBB5138 in green; (B) Pedigree analysis of Couple 15, with mutated allele received from the mother (in red) and the father in (blue). The HBB5138 and HBB5178 signals were not detected for HN3, thus, marked as (-).

The STR markers demonstrated high persistence in the results with only the embryo HN3 showing a different haplotype from the parents, as well as the missing of the HBB5138 and HBB5178 signals. This may be due to some problem in the WGA process, occurring a complete locus drop-out at HBB5138 and an allelic drop-out in HBB5178, as the QIAGEN REPLI® Single Cell was used for WGA still has a small percentage of ADO [12].

Blastocysts

The data regarding the blastocysts from 16 couples is presented in Table 3. Generally, with 271 oocytes underwent ICSI, 229 formed embryos, and only 173 developed into blastocysts, leading to a blastocyst formation rate of 75.55%. Hence, blastocysts were biopsied and followed by WGA and STRs analysis with Sanger sequencing simultaneously to confirm the results for potentially transferred embryos.

Table 3. Summary of the blastocyst development.

Couple Oocytes MII Oocytes ICSI Embryos Blastocysts Blastocyst formation rate % Biopsied blastocysts Blastocyst amplified Amplified rate %
1 14 13 12 6 50.0 3 3 100
2 37 36 28 16 57.14 7 7 100
3 15 14 13 10 76.92 6 6 100
4 11 11 10 6 60.0 5 5 100
5 14 14 14 7 50.0 7 7 100
19 16 15 10 66.67 10 10 100
6 13 12 12 12 100 5 5 100
7 20 18 15 13 86.67 4 4 100
8 20 20 17 17 100.0 7 7 100
9 24 24 21 19 90.48 8 8 100
10 12 11 11 11 100.0 7 7 100
11 12 12 6 6 100.0 4 4 100
12 15 15 14 7 50.0 3 3 100
13 24 24 21 20 95.24 4 2 50
14 22 22 11 2 18.18 2 2 100
15 11 11 11 6 54.54 6 6 100
SUM 283 273 231 168 72.73 88 85 96.59
Open in a new tab

PGD outcome

Among 168 formed blastocysts, 88 blastocysts were examined for the carrying of mutated alleles received parentally, which resulted in 18 normal, 35 carriers, and 18 affected blastocysts, contributing to the transferable embryos of 52. However, there were 14 embryos carried chromosomal abnormalities (detected by PGS) and only 3 out of 88 failed to be amplified, thus, continue with the diagnosis. Hence, the rate of blastocyst amplification is 96.59%. Overall, 11 over 15 couples achieved pregnancy, three couples with no signs of successful pregnancy (Beta HCG, foetal sac, or foetal heart), one with the unsuccessful pregnancy during the first PGD cycle but achieved the second cycle and the last couple with a β-thalassemia major first born have yet proceeded to embryo transfer (Table 4).

Table 4. Summary of PGD outcomes.

Couple Biopsied blastocysts Chromosomal abnormalities Normal Carriers Affected Transferred embryo genotype Beta hCG Fetal sacs Fetal heart Outcome
1 3 3 βN/βCD26 x No pregnancy after the first PGD cycle
2 7 2 1 4 βN/βN x x x 1 girl after the second PGD cycle
3 6 4 2 βN/βCD26 x x x 5 months pregnancy
4 5 2 3 βN/βN x x x Pregnancy
5 7 3 1 1 2 βN/βN x x 1 boy after the second embryo transfer
10 3 2 3 2 βN/βN x x x
6 5 2 3 βN/βN x x x 1 boy
7 4 2 2 βN/βCD41/42 x x x 1 boy
8 7 4 3 βN/βN x x x 1 boy
9 8 1 2 3 2 βN/βN x x x 1 boy
10 7 1 4 2 βN/βCD26 No pregnancy after 2 embryo transfers
βN/βCD26
11 4 3 1 βN/βCD41/42 x x x 1 girl
12 3 2 1 βN/βCD26 No pregnancy after the first PGD cycle
13 4 2 βN/βCD27/28 x x x 1 boy
14 2 1 1 βN/βN x x x Pregnancy
15 6 3 2 Transferred embryo was not yet decided
SUM 88 14 18 35 18
Open in a new tab

For couple 15, they had a β-thalassemia major first born, they were advised to continue with human leukocyte antigen (HLA) matching to facilitate the birth of an HLA-matched healthy sibling, who can provide hematopoietic stem cells (HSC) transplant for the first born.

Discussion

β-thalassemia is a popular genetic disease with a high percentage of carriers, especially in Vietnam, with proportions vary among ethnical and geographical groups such as Tay and Muong with high percentage of carriers (10.7 and 11%, respectively) [13]. On top of that, the movement of different ethnicities to metropolises for occupations and settlements further increases the β-thalassemia population due to cross-ethnic marriage. Thus, despite the attempt of expanding blood transfusion network between national to provincial hospitals to treat β-thalassemia patients, it is being exhausted due to the increasing rate of β-thalassemia infants [13]. This problem raises both financial and social burden to the patients’ family as well as the government, which, to a greater extent, stresses the importance of genetic examination, especially, PGD in combination with IVF.

PGD coping with traditional methods, for example, PCR, sequencing may experience risk of complete locus or allelic dropout (from 10 to 25%) due to the inadequate DNA content [14, 15], which may cause misdiagnoses. The application of multiple displacement amplification, which is currently commercialised in WGA kits such as QIAGEN REPLI® Single Cell, has greatly aided as it increases the genetic material obtained from embryo biopsies with the successful amplification rate of 96.59%, comparable to the reported rate of previous report using the same method (98%) [12]. Hence, STR haplotyping was applied to track the mutated alleles transferred in the family. The method has also proven credibility in other monogenic disorders such as Duchene muscular dystrophy, haemophilia [16, 17]. The selection of markers is the crucial key to the precision of the results in this method as the informativeness of the markers was based on the STR heterozygosity and their tight association to the causative gene. The six selected STRs surround and link closely to the HBB gene (within 0.7 mb) and demonstrated high polymorphic information content and expected heterozygosity in previous research in both Vietnamese as well as Asian populations [10, 11]. Thus, the STR loci was amplified along with the pathogenic loci simultaneously which can maximally monitor and minimize the ADO rate. The potential embryos selected via STR haplotyping were confirmed with Sanger sequencing, of which results stay consistent in most cases (55 over 56 transferable embryos ~98.21%), except for the HN3 of couple 15 with much noise data even after purified with ExoSAP-IT™. This might be due to the contamination during WGA or sample handling afterwards. Additionally, the time conducting STR analysis, and the price are relatively lower than using conventional methods for known mutations. Hence, indirect methods such as STR analysis may pave the way for a better PGD procedure with more ease of use and less resources consumption, especially in β-thalassemia.

Despite the fact that our research used less STR markers than the previous research (6 compared to 15) and confirmed the results by Sanger sequencing, no problem regarding the heterozygosity affecting the detection of allele was found, thus, proven the effectiveness of this strategy. Additionally, other method such as reverse dot blot can be used to cross check the results [11], however, by confirming with Sanger sequencing, a wider spectrum of HBB mutations can be checked. Currently, in developed countries, the application of next generation sequencing (NGS) in NGS-based SNP haplotyping has proven superiority as it can reduce misdiagnosis by linkage analyses and detect aneuploidy simultaneously [18]. Combining PGS and PGD to exclude chromosomal abnormal embryo had shown a statistically increased pregnancy rate and 3-fold reduction of spontaneous abortion rate compared with PGD alone [19]. Thus, the ability of detect both mutations and chromosomal abnormalities in one protocol greatly reduce labour works and potential mishandling. However, due to the shortage of availability and expensiveness of NGS, it cannot serve the lower-income populations, therefore, cannot achieve the purpose of increase the accessibility to PGD for β-thalassemia in developing countries.

In this project, we facilitated the birth/pregnancy of 11 out of 15 couples, in which seven couples carried completely normal children and four were carriers, making the clinical pregnancy rate of 73.33% higher than the standard rate of 62% [20], though after implantation 12 over 16 embryos developed into foetal sacs, making the implantation rate of 75%. Positively, nine couples achieved pregnancy after first PGD cycle, thus, the rate of pregnancy after first PGD cycle of 60%, which are relatively higher than previous research [21, 22]. However, the research sample number was still small and inadequate to raise any significant conclusion regarding the method. We also used day 5 or 6 embryos, which have developed into blastocyst stage for biopsy, evaluation of the embryo growth, and transfer, hence, achieved higher implantation rate and pregnancy/live-birth rate compared to day-3 embryos, as well as increase the chance of detecting the presence of mosaicism due to the ability of biopsy higher number of cells [23, 24]. The vitrification system was also highly important as we can store the freeze blastocysts during the time waiting for genetic examination to select the best embryos for the transfer. This strategy has been proven to reduce the likelihood of ovarian hyperstimulation syndrome [25, 26]. which possibly leads to life-threatening in some severe situations.

As HLA gene display a spectacular degree of polymorphism [27], and the ideal donor for HSC transplant should be compatible at HLA-A, HLA-B, HLA-C and DBR1 [28]. Thus, if it is possible to implement both PGD and HLA-matching to have a normal child and simultaneously find a permanent cure for the first one should be highly recommended. This has been recommended to the couple with one infected offspring.

Conclusion

In this report, by the use of an indirect method, STR markers to track the mutated alleles transmitting in the family, we have facilitated the birth of nine babies, three pregnancies, all were healthy or asymptomatic, carrying only one mutated allele of HBB gene. Only three couples resulted in no pregnancy with no increase in Beta HCG level or detection of the foetal sac or heart via ultrasound. One couple have not reached embryo transfer due to as they were waiting for the HLA typing results. Thus, STR haplotyping is a much cheaper method for the detection of mutated alleles running in a family, which has proved to exert reliable results.

Supporting information

S1 Fig. Sequencing data of couple 15 and the transferable embryos: C15.P1 & C15.P2 were the parents, and the others were the embryos (HN1 to HN6), indicating similar results to ones using STR haplotyping.

(TIFF)

Click here for additional data file. (2.5MB, tiff)

Acknowledgments

We thank the patients and their families for their voluntary involvement in this study.

Data Availability

All relevant data are within the paper and its Supporting information files.

Funding Statement

The author(s) received no specific funding for this work.

References

  • 1.Modell B, Darlison M. Global epidemiology of haemoglobin disorders and derived service indicators. Bulletin of the World Health Organization 2008;86:480–7. doi: 10.2471/blt.06.036673 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Kattamis A, Forni GL, Aydinok Y, Viprakasit V. Changing patterns in the epidemiology of β-thalassemia. European Journal of Haematology 2020;105:692–703. doi: 10.1111/ejh.13512 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Saovaros Svasti ML, Hieu TM, Munkongdee T, Winichagoon P, Van Be T, Van Binh T, et al. Molecular analysis of β-thalassemia in South Vietnam. American Journal of Hematology 2002;71:85–8. doi: 10.1002/ajh.10193 [DOI] [PubMed] [Google Scholar]
  • 4.Goh LPW, Chong ETJ, Lee PC. Prevalence of alpha(α)-thalassemia in Southeast Asia (2010–2020): A meta-analysis involving 83,674 subjects. International Journal of Environmental Research and Public Health 2020;17:1–11. doi: 10.3390/ijerph17207354 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.O’Riordan S, Hien TT, Miles K, Allen A, Quyen NN, Hung NQ, et al. Large scale screening for haemoglobin disorders in southern Vietnam: Implications for avoidance and management. British Journal of Haematology 2010;150:359–64. doi: 10.1111/j.1365-2141.2010.08237.x [DOI] [PubMed] [Google Scholar]
  • 6.Martin A, Thompson AA. Thalassemias. Pediatric Clinics of North America 2013;60:1383–91. doi: 10.1016/j.pcl.2013.08.008 [DOI] [PubMed] [Google Scholar]
  • 7.Bhardwaj U, Zhang YH, Lorey F, McCabe LL, McCabe ERB. Molecular genetic confirmatory testing from newborn screening samples for the common African-American, Asian Indian, Southeast Asian, and Chinese β-thalassemia mutations. American Journal of Hematology 2005;78:249–55. doi: 10.1002/ajh.20269 [DOI] [PubMed] [Google Scholar]
  • 8.Hussey ND, Davis T, Hall JR, Barry MF, Draper R, Norman RJ, et al. Preimplantation genetic diagnosis for β-thalassaemia using sequencing of single cell PCR products to detect mutations and polymorphic loci. Molecular Human Reproduction 2002;8:1136–43. doi: 10.1093/molehr/8.12.1136 [DOI] [PubMed] [Google Scholar]
  • 9.Cao A, Galanello R. Beta-thalassemia. Genetics in Medicine 2010;12:61–76. doi: 10.1097/GIM.0b013e3181cd68ed [DOI] [PubMed] [Google Scholar]
  • 10.Truong DT, Minh NVN, Nhung DP, Van Luong H, Quyet D, Anh TN, et al. Short tandem repeats used in preimplantation genetic testing of Β-thalassemia: Genetic polymorphisms for 15 linked loci in the Vietnamese population. Open Access Macedonian Journal of Medical Sciences 2019;7:4383–8. doi: 10.3889/oamjms.2019.840 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Fan L, Qin A, Li W, Li X, Wei L, Cai R, et al. Genetic diagnosis of β-thalassemia preimplantation using short tandem repeats in human cryopreserved blastocysts. International Journal of Clinical and Experimental Pathology 2017;10:7586–95. [PMC free article] [PubMed] [Google Scholar]
  • 12.Deleye L, Vander Plaetsen AS, Weymaere J, Deforce D, Van Nieuwerburgh F. Short Tandem Repeat analysis after Whole Genome Amplification of single B-lymphoblastoid cells. Scientific Reports 2018;8. doi: 10.1038/s41598-018-19509-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Nguyen HN. AB035. Thalassemia in Vietnam. Annals of Translational Medicine 2015;3. doi: 10.3978/J.ISSN.2305-5839.2015.AB035 [DOI] [Google Scholar]
  • 14.Thornhill AR, Snow K. Molecular Diagnostics in Preimplantation Genetic Diagnosis. The Journal of Molecular Diagnostics: JMD 2002;4:11. doi: 10.1016/S1525-1578(10)60676-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.De Vos A, Sermon K, Van De Velde H, Joris H, Vandervorst M, Lissens W, et al. Pregnancy after preimplantation genetic diagnosis for Charcot-Marie-Tooth disease type 1A. Molecular Human Reproduction 1998;4:978–84. doi: 10.1093/molehr/4.10.978 [DOI] [PubMed] [Google Scholar]
  • 16.Chang LJ, Huang CC, Tsai YY, Hung CC, Fang MY, Lin YC, et al. Blastocyst biopsy and vitrification are effective for preimplantation genetic diagnosis of monogenic diseases. Human Reproduction 2013;28:1435–44. doi: 10.1093/humrep/det048 [DOI] [PubMed] [Google Scholar]
  • 17.De Rycke M, Berckmoes V. Preimplantation Genetic Testing for Monogenic Disorders. Genes 2020;11:1–15. doi: 10.3390/genes11080871 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Chen D, Shen X, Wu C, Xu Y, Ding C, Zhang G, et al. Eleven healthy live births: a result of simultaneous preimplantation genetic testing of α- and β-double thalassemia and aneuploidy screening. Journal of Assisted Reproduction and Genetics 2020;37:549–57. doi: 10.1007/s10815-020-01732-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Rechitsky S, Pakhalchuk T, San Ramos G, Goodman A, Zlatopolsky Z, Kuliev A. First systematic experience of preimplantation genetic diagnosis for single-gene disorders, and/or preimplantation human leukocyte antigen typing, combined with 24-chromosome aneuploidy testing. Fertility and Sterility 2015;103:503–12. doi: 10.1016/j.fertnstert.2014.11.007 [DOI] [PubMed] [Google Scholar]
  • 20.Huisman GJ, Fauser BCJM, Eijkemans MJC, Pieters MHEC. Implantation rates after in vitro fertilization and transfer of a maximum of two embryos that have undergone three to five days of culture. Fertility and Sterility 2000;73:117–22. doi: 10.1016/s0015-0282(99)00458-6 [DOI] [PubMed] [Google Scholar]
  • 21.Smith ADAC, Tilling K, Nelson SM, Lawlor DA. Live-birth rate associated with repeat in vitro fertilisation treatment cycles. JAMA 2015;314:2654. doi: 10.1001/JAMA.2015.17296 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Boisson J, Thomasset A, Racine E, Cividino P, Banchelin Sainte-Luce T, Poisson JF, et al. Hydroxymethyl-Branched Polyhydroxylated Indolizidines: Novel Selective α-Glucosidase Inhibitors. Organic Letters 2015;17:3662–5. doi: 10.1021/acs.orglett.5b01505 [DOI] [PubMed] [Google Scholar]
  • 23.Chang J, Boulet SL, Jeng G, Flowers L, Kissin DM. Outcomes of in vitro fertilization with preimplantation genetic diagnosis: an analysis of the United States Assisted Reproductive Technology Surveillance Data, 2011–2012. Fertility and Sterility 2016;105:394. doi: 10.1016/j.fertnstert.2015.10.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Palini S, De Stefani S, Primiterra M, Galluzzi L. Pre-implantation genetic diagnosis and screening: now and the future. Gynecological Endocrinology: The Official Journal of the International Society of Gynecological Endocrinology 2015;31:755–9. doi: 10.3109/09513590.2015.1068752 [DOI] [PubMed] [Google Scholar]
  • 25.Spijkers S, Lens JW, Schats R, Lambalk CB. Fresh and Frozen-Thawed Embryo Transfer Compared to Natural Conception: Differences in Perinatal Outcome. Gynecologic and Obstetric Investigation 2017;82:538. doi: 10.1159/000468935 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wong KM, van Wely M, Mol F, Repping S, Mastenbroek S. Fresh versus frozen embryo transfers in assisted reproduction. The Cochrane Database of Systematic Reviews 2017;2017:CD011184. doi: 10.1002/14651858.CD011184.pub2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Williams TM. Human Leukocyte Antigen Gene Polymorphism and the Histocompatibility Laboratory. The Journal of Molecular Diagnostics: JMD 2001;3:98. doi: 10.1016/S1525-1578(10)60658-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Howard CA, Fernandez-Vina MA, Appelbaum FR, Confer DL, Devine SM, Horowitz MM, et al. Recommendations for donor human leukocyte antigen assessment and matching for allogeneic stem cell transplantation: consensus opinion of the Blood and Marrow Transplant Clinical Trials Network (BMT CTN). Biology of Blood and Marrow Transplantation: Journal of the American Society for Blood and Marrow Transplantation 2015;21:4–7. doi: 10.1016/j.bbmt.2014.09.017 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

J Francis Borgio

8 Jun 2022

PONE-D-22-11235Feasibility of combining short tandem repeats (STRs) haplotyping with preimplantation genetic diagnosis (PGD) in screening for beta thalassemiaPLOS ONE

Dear Dr. Tran,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Jul 23 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

J Francis Borgio, Ph.D.,

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and 

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

2. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.

Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

For additional information about PLOS ONE ethical requirements for human subjects research, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-human-subjects-research.

3. We note you have included a table to which you do not refer in the text of your manuscript. Please ensure that you refer to Table 4 in your text; if accepted, production will need this reference to link the reader to the Table.

Additional Editor Comments:

Authors shall consider all the suggestions carefully from the reviewers

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: • The topic of this article lacks new ideas: PGD is a mature technology in the current field of reproductive medicine, and it is also a conventional indication for beta thalassemia. What is the novelty of this paper?

• Two STR markers named HBB5178, and D11S1760 have approximately close size range which can make misdiagnosis. It would be better to tag them with different fluorescent labels

• There are some grammatical. For instance:

o Line119: " …family members were still used for to increase the…" should change into "to increase"

o Line 151: "…3 over 88 failed…" should change into 3 out of 88 failed

o Line 195: "…11 over 15 couples" should change into 11 out of 15 couples

• The discussion part lack the description of the experience from other research.

• The figures are blurred, it must be changed into a clear one.

Reviewer #2: Over all it is good written article. I have some suggestions to improve it a little bit before publication.

1- If you are using some abbreviations, please give the complete name or description at the first place it is used in the article. Like use of HBB, HCG etc.

2- The line 166-168 sentence is confusing. How the movement of different ethnicities to metropolises does increase beta thalassemia in the population?

3- In line 210 add "is" after "thus, if it"

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Muhammad Farooq Sabar

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: Comments.docx

Click here for additional data file. (13.3KB, docx)
PLoS One. 2022 Dec 7;17(12):e0278539. doi: 10.1371/journal.pone.0278539.r002

Author response to Decision Letter 0

10 Oct 2022

RESPOND TO REVIEWER

Submission Title: Feasibility of combining short tandem repeats (STRs) haplotyping with preimplantation genetic diagnosis (PGD) in screening for beta thalassemia

Dear Editors and Reviewers,

We are grateful for your time reading and considering our work. Your feedbacks have helped us improved our manuscript substantially. We have thoroughly revised our work and, to the best of our ability as non-native speaker correct the grammar and syntax to meet with the publication standard. We hereby submit our revised manuscript together with detailed respond to each of the queries raised by the reviewer.

Respond to the Reviewer 1’s queries

Q: The topic of this article lacks new ideas: PGD is a mature technology in the current field of reproductive medicine, and it is also a conventional indication for beta thalassemia. What is the novelty of this paper?

Answer:

It is true that PGD is a mature technology in the current field of reproductive medicine and a conventional indication for beta thalassemia. Although PGD was first reported in the world in 1988, not until 2015, in a technology transfer project by Military Medical University, PGD was first introduced in Vietnam. Hence, with only 7 years of technological adaptation and optimization for Vietnamese population, there were many aspects that we can adjust and research on. Furthermore, not many hospitals in Vietnam have the adequate technological requirements as well as received the procedure of PGD for beta thalassemia. In this research, we would like to introduce the feasibility and reliability of this PGD strategy for beta thalassemia to other facilities in Vietnam and other developing countries with later obtention of the technology, thus, to reduce the rate of thalassemia carriers.

Q: Two STR markers named HBB5178, and D11S1760 have approximately close size range which can make misdiagnosis. It would be better to tag them with different fluorescent labels

Answer:

We will definitely change the fluorescence colour for the markers HBB5178, and D11S1760 in the next experiments. In this research, due to data in previous research, as well as our experience, the two markers are distinguishable with no overlaps. Furthermore, we used other markers to cross-check the results as at least three markers would confirm the presence of the allele.

Q: There are some grammatical errors

Answer: We have made appropriate corrections of the errors.

Q: The discussion part lacks the description of the experience from other research.

Answer: We have added some description of experience from studies in the same field.

Q: The figures are blurred, it must be changed into a clear one.

Answer: We have changed the figure and increase the resolution to 300 dpi.

Respond to the Reviewer 2’s queries

Q: If you are using some abbreviations, please give the complete name or description at the first place it is used in the article.

Answer: We have added the complete name/description before used abbreviations.

Q: How the movement of different ethnicities to metropolises does increase beta thalassemia in the population?

Answer: We have rephrased the sentence for better understanding. Some ethnicities in Vietnam were found with high frequency of beta-thalassemia mutated allele, therefore, as they moved and settled in metropolises, the rate of carriers and mutated allele frequency in the new population would increase.

Q: Some grammatical errors

Answer: We have made appropriate corrections of the errors.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file. (17.9KB, docx)

Decision Letter 1

J Francis Borgio

18 Nov 2022

Feasibility of combining short tandem repeats (STRs) haplotyping with preimplantation genetic diagnosis (PGD) in screening for beta thalassemia

PONE-D-22-11235R1

Dear Dr. Tran,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

J Francis Borgio, Ph.D.,

Academic Editor

PLOS ONE

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: (No Response)

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: (No Response)

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: (No Response)

Reviewer #3: (No Response)

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: (No Response)

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: (No Response)

Reviewer #3: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: Yes: Muhammad Farooq Sabar

Reviewer #3: No

**********

Acceptance letter

J Francis Borgio

29 Nov 2022

PONE-D-22-11235R1

Feasibility of combining short tandem repeats (STRs) haplotyping with preimplantation genetic diagnosis (PGD) in screening for beta thalassemia

Dear Dr. Tran:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. J Francis Borgio

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Sequencing data of couple 15 and the transferable embryos: C15.P1 & C15.P2 were the parents, and the others were the embryos (HN1 to HN6), indicating similar results to ones using STR haplotyping.

    (TIFF)

    Click here for additional data file. (2.5MB, tiff)
    Attachment

    Submitted filename: Comments.docx

    Click here for additional data file. (13.3KB, docx)
    Attachment

    Submitted filename: Response to Reviewers.docx

    Click here for additional data file. (17.9KB, docx)

    Data Availability Statement

    All relevant data are within the paper and its Supporting information files.

    Articles from PLOS ONE are provided here courtesy of PLOS

    RESOURCES