Assessment of mastitis in camel using high-throughput sequencing

Rita Rahmeh; Abrar Akbar; Husam Alomirah; Mohamed Kishk; Abdulaziz Al-Ateeqi; Anisha Shajan; Thnayan Alonaizi; Alfonso Esposito

doi:10.1371/journal.pone.0278456

. 2022 Dec 7;17(12):e0278456. doi: 10.1371/journal.pone.0278456

Assessment of mastitis in camel using high-throughput sequencing

Rita Rahmeh ^1,^*, Abrar Akbar ¹, Husam Alomirah ¹, Mohamed Kishk ¹, Abdulaziz Al-Ateeqi ¹, Anisha Shajan ¹, Thnayan Alonaizi ¹, Alfonso Esposito ²

Editor: Pierre Germon³

PMCID: PMC9728900 PMID: 36476716

Abstract

Camel milk is recognized as a functional food with significant economic value. Mastitis is one of the most common and costly diseases in the dairy industry. Mastitis, which is caused by pathogens such as bacteria, viruses, fungi, and algae, has an impact on the quality and quantity of milk produced as well as animal health and welfare. There is a paucity of data on the etiological factors that cause camel mastitis. This study reports the bacterial and fungal community involved in clinical camel mastitis using Illumina amplicon sequencing. A total of 25 milk samples were analyzed, including 9 samples with mastitis and 16 healthy samples. The bacterial community in healthy samples was significantly more diverse and abundant than in mastitis samples. The fungal population in mastitis samples, on the other hand, was more diverse and abundant. As compared to healthy samples, the genera Staphylococcus, Streptococcus, Schlegelella, unclassified Enterobacteriaceae, Lactococcus, Jeotgalicoccus. and Klebsiella were found to be abundant in mastitic milk. However, the genera Corynebacterium, Enteractinococcus, unclassified Sphingomonadaceae, Atopostipes, Paenibacillus, Pseudomonas, Lactobacillus, Sphingomonas, Pediococcus and Moraxella were reduced. In the fungal community, mastitis caused a significant increase in the relative abundance of the majority of taxa, including Candida, Phanerochaete, Aspergillus, Cladosporium and unclassified Pyronemataceae, while Penicillium and Alternaria showed a decline in relative abundance. In the bacterial and fungal communities, the discriminant analysis showed 19 and 5 differently abundant genera in healthy milk and mastitic milk, respectively. In conclusion, this study showed a microbiome dysbiosis linked to clinical camel mastitis, with opportunistic pathogens outgrowing commensal bacteria that were reduced. These findings are essential in designing an appropriate control program in the camel dairy herd, as well as in preventing and treating camel mastitis.

Introduction

Dromedary camels are multipurpose animals having the ability to survive the harsh climate desert conditions. They represent about 95% of the camelid population [1]. Camels constitute an important source of milk in the world especially in Asian and African regions. The production of camel milk for human consumption was estimated to be 3.5 million tons. Camel milk is highly nutritional and deemed better than bovine milk. It is considered as functional food optimal for infant formula and for elderly. Beside its nutritional value, camel milk has therapeutic value against diabetes, asthma and jaundice [2, 3]. These traits increase the value of this milk and the local and international demand for it. As a result, camel dairy farms have been established worldwide with a steady integration into national and global economies [4, 5].

Mastitis is defined as the inflammation of the mammary gland and is considered the most critical disease in the dairy industry worldwide [6]. Mastitis can cause economic loss due to reducing milk production, deteriorated milk quality, lower probability of conception, higher treatment cost, and transmission of the disease to other species of animals [7]. Mastitis is usually epidemiologically categorized on the basis of source of infection into environmental mastitis caused by bacteria residing in the surrounding environment and contagious mastitis where the udders of the infected animal serve as a major reservoir of the pathogens which can spread from one animal to another during the milking process [8, 9].

Camels, like other dairy animals, can be affected by mastitis. This disease causes suffering for camels and poses a public health risk. According to the symptoms, mastitis in camels can also be classified as clinical or subclinical mastitis. Clinical mastitis is characterized by redness, heat and swelling of the mammary gland. However, subclinical mastitis is characterized by a lack of visible typical mastitis symptoms signs in the milk or in the udder [10, 11]. The major problems overwhelming the status of udder health in camels are tick infestation of the udder and thorny bushes, unhygienic practices, and cauterizations of the udder skin [12]. The occurrence of mastitis among lactating camels is being reported in some countries, including Somalia [13], Sudan [14], Kenya [15], and different parts of Ethiopia [16–18]. According to various studies, 45.66% of the world’s camel population suffers from mastitis, with an average prevalence of 43% in Saudi Arabia and 24% in the United Arab Emirates [19]. However, the prevalence of camel mastitis in Kuwait is not reported despite the existence of contributing risk factors of mastitis that have a strong correlation with mastitis occurrence. These factors include nomadic housing of camel and improper hygienic measures during the milking process [20].

Mastitis is a complex disease caused by infections of a variety of microorganisms. Bacterial infections are considered the primary cause of mastitis in domestic animals. However, mycotic mastitis has long been known to be caused by fungi such as Candida genus infecting the mammary gland. [21]. Mastitis-causing pathogens in dairy animals and humans were determined in several studies using culture-independent approaches. The major causes of bovine mastitis have been well-studied [6]. Furthermore, human milk microbial community in lactational mastitis has been reported [22]. However, little is known about pathogens involved in mastitis occurrence in camels using culture-independent approaches. The available information on clinical and subclinical mastitis-causing microorganisms was exclusively reported based on conventional bacteriological (culture-dependent) methods, mainly from Ethiopia [11, 16, 23–25]. Staphylococcus and Streptococcus species were shown to be the most common causes of mastitis in Ethiopia [16, 23] while Streptococcus agalactiae was the only bacterium isolated from gangrenous mastitis in dromedary camels in the United Arab Emirates [11]. Furthermore, a high prevalence of fungi was reported in camel mastitis in Saudi Arabia representing 10% of the microbial isolates including Candida, Cryptococcus, Trichosporon and Aspergillus [26]. Mycotic mastitis caused by Candida albicans has been reported in a she-camel in Ethiopia [27].

Currently, it is well-known that milk harbors a wide range of bacteria including many which cannot be identified by culturing, leaving those microorganisms undetectable [28]. Thus, metagenomics approaches have been applied to investigate the microbiome of healthy milk samples, as well as clinical and subclinical mastitis in human, bovine, and buffalo [22, 28, 29]. The application of a next-generation sequencing approach for profiling the bacterial community responsible for camel mastitis has an important impact on the clinical resolution of this disease and is essential for formulating strategies for controlling and preventing the development of this disease. Thus, the aim of this study was to identify the bacterial and fungal population involved in camel mastitis using Illumina amplicon sequencing.

Materials and methods

All experimental protocols were approved by the Center Proposal Evaluation Committee (PEC) of Kuwait Institute for scientific research. The project was approved by Kuwait Foundation for the Advancement of Sciences (KFAS) under the project code PR18-12SL-16. All methods were performed in accordance with relevant institutional guidelines and regulations in compliance with the standards of animal rights and with camel owners’ permission. Information about camels age, parity, and management are presented in S1 Table in S1 Appendix.

Sample collection

Camel milk samples were collected by manual milking of individual dromedary camels belonging to camel owners in Kuwait desert. After visual and manual examination of the camels by a certified veterinarian, based on local signs and symptoms of mastitis, sixteen samples were collected from healthy animals with no clinical signs of mastitis. Nine samples were collected from camels showing signs of mastitis (abnormal udder such as redness, heat, swelling and reduced milk yield with blood in some samples). After owner permission was given, disinfection with 70% ethylic alcohol of the udder and the teats was performed by physical scrubbing and the first drops of milk were discarded. The samples were collected into sterile containers, labeled and delivered in an icebox to the laboratory for Somatic Cell Count (SCC) and DNA extraction. The SCC for all milk samples was performed immediately upon arrival at the laboratory using a direct cell counter (DCC, DeLaval International AB). The optimum SCC threshold for healthy milk is estimated to be around 200,000 cells/ml [30, 31]. The milk samples with SCC less than 200,000 cells/ml were considered healthy milk samples.

DNA extraction

DNA extraction was performed at the same day of collection using GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich) following the manufacturer’s recommendations. Before extraction, 2 ml of milk was mixed and centrifuged at 10,000 × g for 10 min. Then, genomic DNA was extracted from the pellet. The quantity of the extracted DNA was measured using a Qubit 3.0 Fluorometer (Invitrogen).

Amplification of the 16S V3‒V4 and ITS2 regions and sequencing

Custom fusion primers were used to prepare the 16S V3‒V4 and ITS2 libraries. The custom primers included the appropriate P5/P7 Illumina adapter sequence, an 8-nt index sequence, and the gene-specific primer sequence for bacteria 341F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) or the gene-specific primer sequence for fungi ITS3 (GCATCGATGAAGAACGCAGC) and ITS4 (TCCTCCGCTTATTGATATGC). Agencourt AMPure XP beads (Beckman Coulter) were used to purify the libraries, which were validated with an Agilent Technologies 2100 bioanalyzer. Sequencing was carried out on Illumina HiSeq 2500 in 2 × 300 bp mode. The high-throughput sequencing data are available at the NCBI database under the Bioproject PRJNA814002.

Bioinformatics processing

Raw sequencing data were demultiplexed and amplicon sequence variants (ASVs) were determined with the DADA2 pipeline [32] implemented in R package dada2 v1.20.0. The BBTools package version 38.45 was used to identify and eliminate primer sequences from the 5’ and 3’ ends of input read pairs [33]. Forward and reverse reads with ≤ 2 and 4 expected errors, respectively, were retained. Contiguous sequences (contigs) were created by joining error-corrected reads with a minimum overlap of 20 base pairs. The "consensus" procedure used in DADA2 was employed to eliminate chimeric contigs that were consisted of two partial sequences of different origins. The IDTAXA approach [34] implemented in the R package DECIPHER v2.18.1 [35] was used to taxonomically classify the remaining contigs (ASVs) using the SILVA database SSU release 138 [36, 37]. ASVs with a classification confidence value ≥ 51% were retained. The R package DECIPHER was used to construct a neighbor-joining phylogenetic tree from aligned ASVs [38]. ASV copy numbers were inferred by hidden-state prediction in order to provide a better estimate of true ASV abundances, [39, 40]. Copy numbers were set to 1 for ASVs with a Nearest Sequenced Taxon Index (NSTI) > 2. ASV counts were normalized by dividing them by their respective copy numbers. To maintain the total count per sample, the result was multiplied by a sample-specific factor. Then, singletons were maintained while the counts were rounded to make them integers.

Statistical analysis

The effect of treatment on individual ASVs was tested for statistical significance by R package metagenome Seq v1.31.0 (Paulson et al., 2019) using a zero-inflated Gaussian mixture model (Paulson et al., 2013). ASVs with at least ten counts in two or more samples were considered. The effect size was expressed as log2(fold-change) of size-factor-normalized ASV counts. Log Odds Differential Abundance (log(ODA)) gives the log-odds that the abundance of the ASV differs according to the considered condition. P-values for tests within the same comparison level were adjusted using Benjamini-Hochberg correction (false discovery rate) [41].

The indices calculated with R package vegan v2.6.0 were used to measure alpha diversity as follows: Observed ASVs; Chao1 richness; ACE (Abundance-based Coverage Estimator) richness, Shannon diversity; Simpson diversity; Inverse Simpson diversity; and Effective richness ¹D [42]. Descriptive variables were used for sample grouping. Rarefaction curves were produced based on observed ASVs.

Beta diversity was evaluated. R package phyloSeq v1.37.0 was used to determine the extent of change in ASV abundances across samples. A Principal Component Analysis (PCoA) was performed on both unweighted and weighted UniFrac dissimilarities [43] derived from ASV counts and phylogenetic information. R package DESeq2 v1.30.1 was used to determine the extent of change in ASV abundances across samples explained by grouping variables [44]. ASV counts were normalized by library size and transformed using the variance-stabilizing transformation (VST) [45]. Redundancy Analysis implemented in R package vegan v2.6.0 was performed on VST-transformed normalized ASV counts (ASV_trans) [42].

Using R package microbiome Marker v0.0.1.9000 [46], ASVs counts aggregated at different taxonomic ranks were subjected to linear discriminant analysis Effect Size (LEfSe) [47]. ASVs with at least ten counts in two or more samples were considered.

Results

Sequencing summary

This study included 25 milk samples collected from dromedary camels in Kuwait desert, with 16 healthy with SCC less than 200,000 cells/ml and 9 mastitis samples. The samples were sequenced in the V3-V4 region of 16S rRNA gene, resulting in 2.35 million total read pairs. A total of 1.75 million high-quality 16S rRNA gene sequences (ASVs) were retained for the samples. Of the 1.75 million ASVs with taxonomy, 63.27% were attributed to the healthy samples and 36.73% for mastitis samples. Samples exhibited a median of 167 ASVs (inter-quartile range (IQR) = 107–243). The per-sample numbers of read pairs remaining after each pipeline step are summarized in S2 Table in S1 Appendix.

The sequencing of the ITS region of eighteen samples generated 2.31 million total read pairs. A total of 1.97 million high-quality sequences were retained for the samples. Samples exhibited a median of 32 ASVs (IQR = 22–59). Of the 1.97 million ASVs with taxonomy, 80.9% were attributed to the healthy samples and 19.1% for mastitis samples. The per-sample numbers of read pairs remaining after each pipeline step are summarized in S3 Table in S1 Appendix.

Camel milk microbiota in healthy and mastitis milk samples

The bacterial community in healthy camel milk samples were classified into 26 phyla while mastitis samples comprised 16 phyla. The healthy camel milk microbiota was dominated by the phyla Proteobacteria and Firmicutes accounting for 38.14% and 34.06% of the bacterial population, respectively, followed by Actinobacteria (20.54%) and Bacteroidota (5.71%) (Table 1). Although Fusobacteriota, Patescibacteria and Deinococcota were minor phyla, they accounted for more than 0.1% of the overall bacterial population. Mastitis milk samples were dominated by the phyla proteobacteria (37.97%) and Firmicutes (40.29%). As compared to healthy milk samples, mastitis samples showed an increase in Firmicutes (40.29% vs. 34.06%) and a decrease in Actinobacteria (17.46% vs. 20.54%) and Bacteroidota (3.69% vs. 5.71%). Uncultured bacteria (bacteria that cannot be cultured using standard methods) accounted for 0.2% and 0.01% of the total bacteria in healthy and mastitis milk samples, respectively. Rare taxa, which were defined as having a mean abundance of <1% across all samples, were summarized as “others” (Fig 1).

Table 1. Relative abundance of bacterial population in healthy and mastitis camel milk at phylum level for 16S rRNA.

	Mean Relative abundance 16S
Phylum	Healthy	Mastitis
Proteobacteria	38.14	37.98
Firmicutes	34.07	40.29
Actinobacteriota	20.54	17.46
Bacteroidota	5.71	3.69
Others	1.54	0.58

Open in a new tab

Fig 1 — Rare taxa with a mean abundance of <1% across all samples are summarized as “Others”. M corresponds to the mastitis samples.

At the genus level, the microbiota of healthy camel milk was dominated by Glutamicibacter (6.98%) and Schlegelella (6.74%), followed by the genera Acinetobacter (6.48%), Pseudomonas (5.9%), Lactobacillus (5.29%), Staphylococcus (5.27%), Paenibacillus (4.53%), Corynebacterium (4.02%) and Streptococcus (3.21%) (Table 2). The microbiota of mastitis camel milk was dominated by the genera Streptococcus (12.21%) and Schlegelella (11.79%) followed by the genera Staphylococcus (9.97%), uncl. Enterobacteriaceae (8.18%), Glutamicibacter (7.75%), Acinetobacter (6.06%), Pseudomonas (3.51%) and Paenibacillus (3.83%). As compared to healthy milk samples, mastitis milk microbiota was enriched in Staphylococcus (9.97% vs. 5.27%), Streptococcus (12.21% vs. 3.21%), Schlegelella (11.79% vs. 6.74%), unclassified Enterobacteriaceae (8.18% vs. 0.75%), Lactococcus (3.24% vs. 0.01), and Jeotgalicoccus (2.33% vs. 1.48%). Mastitis -was also associated with the appearance of Klebsiella genus that was not detected in the healthy milk samples. Other genera, such as Brachybacterium and Glutamicibacter also increased slightly with mastitis. However, the genera Corynebacterium, Enteractinococcus, unclassified Sphingomonadaceae, Atopostipes, Paenibacillus and Pseudomonas decreased in the mastitis milk samples. As compared to healthy milk samples, some genera were present in low abundance in the mastitis samples; these genera included Lactobacillus (0.24% vs. 5.29%) Sphingomonas (0.16% vs. 2.16%), Pediococcus and Moraxella (0.4% vs. 2.6%) (Fig 2). Taxon frequencies of the most dominant bacterial population in healthy and mastitis camel milk samples at the phylum and genus level are presented in S4 and S5 Tables in S1 Appendix, respectively. Statistical differences of the effect of mastitis on individual ASVs are presented in S6 Table in S1 Appendix.

Table 2. Relative abundance of bacterial population in healthy and mastitis camel milk at genus level for 16S rRNA.

	Mean Relative abundance 16S (%)
Genus	Healthy	Mastitis
Schlegelella	6.74	11.79
Streptococcus	3.21	12.21
Staphylococcus	5.27	9.97
Glutamicibacter	6.98	7.75
Acinetobacter	6.48	6.06
Pseudomonas	5.90	3.51
unclassified Enterobacteriaceae	0.75	8.18
Paenibacillus	4.53	3.83
Corynebacterium	4.02	1.85
Lactobacillus	5.29	0.24
Jeotgalicoccus	1.48	2.33
unclassified Sphingomonadaceae	2.60	0.85
Brachybacterium	1.41	1.91
Lactococcus	0.01	3.24
Pediococcus	2.61	0.44
unclassified Comamonadaceae	1.81	1.19
Moraxella	2.57	0.42
Klebsiella	0.00	2.84
Enteractinococcus	1.56	0.98
Sphingomonas	2.16	0.16
Atopostipes	1.52	0.72
Others	33.10	19.51

Open in a new tab

Fig 2 — Rare taxa with a mean abundance of <1% across all samples are summarized as “Others”. M corresponds to the mastitis samples.

LefSe was next used to explain differences between classes in healthy and mastitis groups. LEfSe analysis identified 19 differentially abundant genera in healthy and mastitis. The genera Lactobacillus, Moraxella, Pediococcus, Sphingomonas, Cutibacterium, Novosphingobium, Cnuella, unclassified Burkholderiales, Methylobacterium-Methylorubrum, Tepidimonas, Bacillus, Enterococcus, unclassified Streptococcaceae, Bergeyella, Lysobacter, TM7a, Dolosigranulum, and Clostridium sensu stricto 9 were significantly more enriched in the healthy group (P< 0.05). Alternatively, the genus Exiguobacterium was significantly more enriched in mastitis (Table 3). The effect size and statistical significance of the top ten marker taxa per sample group between healthy and mastitis groups is shown in Fig 3 and a Cladogram that represents differentially abundant microbiota at the class, order, family, and genus level between healthy and mastitis groups is shown in Fig 4.

Table 3. Lefse marker table at taxonomic level for healthy and mastitis samples for 16S rRNA.

Feature	Enriched Group	log10(LDA Score)	Adjusted P-value
f__Lactobacillaceae	Healthy	4.9	0.0039
c__Alphaproteobacteria	Healthy	4.8	0.017
g__Lactobacillus	Healthy	4.8	0.027
o__Sphingomonadales	Healthy	4.7	0.036
f__Sphingomonadaceae	Healthy	4.7	0.036
o__Paenibacillales	Healthy	4.4	0.037
f__Paenibacillaceae	Healthy	4.4	0.037
g__Moraxella	Healthy	4.4	0.012
g__Pediococcus	Healthy	4.4	0.0068
g__Sphingomonas	Healthy	4.4	0.008
o__Propionibacteriales	Healthy	4.1	0.0063
f__Propionibacteriaceae	Healthy	4	0.015
g__Cutibacterium	Healthy	4	0.0033
o__Rhizobiales	Healthy	3.8	0.023
g__Novosphingobium	Healthy	3.8	0.018
g__Cnuella	Healthy	3.8	0.014
f__uncl. Burkholderiales	Healthy	3.7	0.024
g__uncl. Burkholderiales	Healthy	3.7	0.024
f__Beijerinckiaceae	Healthy	3.7	0.015
g__Methylobacterium-Methylorubrum	Healthy	3.7	0.02
g__Tepidimonas	Healthy	3.6	0.024
f__Oxalobacteraceae	Healthy	3.3	0.025
g__Bacillus	Healthy	3.2	0.0076
g__Enterococcus	Healthy	3.2	0.0014
f__Enterococcaceae	Healthy	3.2	0.0014
o__Saccharimonadales	Healthy	3.2	0.044
f__Saccharimonadaceae	Healthy	3.2	0.044
c__Saccharimonadia	Healthy	3.2	0.044
g__uncl. Streptococcaceae	Healthy	3.1	0.038
g__Bergeyella	Healthy	3	0.041
g__Lysobacter	Healthy	3	0.035
g__TM7a	Healthy	3	0.041
o__Frankiales	Healthy	2.9	0.014
f__Geodermatophilaceae	Healthy	2.8	0.041
g__Dolosigranulum	Healthy	2.6	0.041
g__Clostridium sensu stricto 9	Healthy	2.4	0.041
f__Exiguobacteraceae	Mastitis	3.2	0.016
g__Exiguobacterium	Mastitis	3.2	0.016
o__Exiguobacterales	Mastitis	3.2	0.016

Open in a new tab

The fungal community in healthy and mastitis camel milk samples was classified into 3 phyla, Ascomycota, Basidiomycota and Mucoromycota (Fig 5). As compared to healthy milk samples, mastitis milk microbiota was enriched in Basidiomycota (16.48% vs. 2.35%) while a decrease in the relative abundance of Ascomycota (83.44% vs. 97.3%) was observed (Table 4). At the genus level, the fungal population of healthy camel milk was dominated by the genus Penicillium (76.93%), followed by Cladosporium (4.05%) and Candida (3.89%) (Table 5). The fungal population of mastitis camel milk was dominated by the genera Penicillium (36.82%), followed by Candida (13.6%), Phanerochaete (13.32%), Cladosporium (5.15%), and Aspergillus (5.33%). In mastitic milk, a remarkable increase in the relative abundance of the majority of the genera including Candida, Phanerochaete, Aspergillus, Cladosporium and unclassified Pyronemataceae was shown. However, a decrease in the relative abundance of Penicillium and Alternaria was observed (Fig 6).

Table 4. Relative abundance of fungal population in healthy and mastitis camel milk at phylum level for ITS.

	Mean Relative abundance ITS
Phylum	Healthy	Mastitis
Ascomycota	97.31	83.44
Basidiomycota	2.35	16.48
uncl. Fungi	0.24	0.01
Mucoromycota	0.09	0.08

Open in a new tab

Table 5. Relative abundance of fungal population in healthy and mastitis camel milk at genus level for ITS.

	Mean Relative abundance ITS
Genus	Healthy	Mastitis
Penicillium	76.93	36.82
Candida	3.89	13.60
Phanerochaete	0.00	13.32
Cladosporium	4.05	5.15
Aspergillus	3.28	5.33
unclassified Pyronemataceae	0.81	2.38
Fusarium	1.21	1.65
Alternaria	1.62	0.76
Others	8.21	20.99

Open in a new tab

Fig 6 — Rare taxa with a mean abundance of <1% across all samples are summarized as “Others”. M corresponds to the mastitis samples.

LEfSe analysis identified one differentially abundant genera in healthy samples while four were identified in mastitis. The genera Acremonium, Chaetomium, Wallemia, and unclassified Pleosporaceae were significantly more enriched in the mastitis group (P< 0.05). Alternatively, the genus Tylospora was significantly more enriched in the healthy group Table 6. The effect size and statistical significance of the top ten marker taxa per sample group between healthy and mastitis groups is shown in Fig 7 and a Cladogram that represents differentially abundant microbiota at the class, order, family, and genus level between healthy and mastitis groups is shown in Fig 8.

Table 6. Lefse marker table at taxonomic level for healthy and mastitis samples for ITS.

Feature	Enriched Group	log10(LDA Score)	Adjusted P-value
g__Tylospora	Healthy	4.1	0.026
o__Atheliales	Healthy	4.1	0.026
f__Atheliaceae	Healthy	4.1	0.026
g__unclassified Pleosporaceae	Mastitis	4.2	0.034
f__Hypocreales fam Incertae sedis	Mastitis	3.6	0.022
g__Acremonium	Mastitis	3.6	0.034
g__Chaetomium	Mastitis	3.3	0.05
g__Wallemia	Mastitis	3.1	0.0065
o__Wallemiales	Mastitis	3.1	0.0065
f__Wallemiaceae	Mastitis	3	0.0065
c__Wallemiomycetes	Mastitis	3	0.0065

Open in a new tab

Microbial richness and diversity in healthy and mastitis milk samples

The median values of the alpha diversity indices for healthy and mastitis samples are presented in Table 7. For the bacterial population, the median values of the six indices were higher in healthy samples than in mastitis samples. Shannon and Simpson diversity indices were higher in healthy samples, indicating that the healthy samples had higher bacterial diversity compared to mastitis samples. The bacterial richness was also compared by sample group, as estimated by the Chao1 richness index. Compared to mastitis milk samples, the healthy milk samples showed greater bacterial richness. The distribution of alpha diversity measures in relation to sample groups are shown in Fig 9. However, for the fungal population, the median values of the alpha diversity indices were higher in mastitis samples indicating a high diversity and richness in mastitis samples (Fig 10). Bacterial and fungal richness were also evaluated by rarefaction curves in sample groups. For healthy and mastitis groups, the rarefaction curves for all samples were saturated and reached a plateau, suggesting that the sequencing depth was enough to capture the majority of the bacteria and fungus present in healthy and mastitis camel milk samples. Furthermore, the bacterial richness in healthy milk samples was higher compared to mastitis milk samples (Fig 11A), in contrast to the fungal population (Fig 11B).

Table 7. Median alpha diversity measures by sample group for healthy and mastitis milk samples for 16S rRNA.

Treatment	Observed ASVs	Chao1 Richness	ACE Richness	Shannon Diversity	Simpson Diversity	Inverse Simpson Diversity	Effective Richness
Healthy (16S)	204.5	204.5	204.5	3.71	0.94	16.62	41.08
Mastitis (16S)	107	107	108.58	2.27	0.78	4.5	9.64
Healthy (ITS)	29	29	33	1.04	0.37	1.62	2.91
Mastitis (ITS)	46	46	30	2.02	0.72	3.55	7.79

Open in a new tab

Fig 11 — Rarefaction curves (median values) with interquartile ranges according to sample groups for the 16S rRNA (A) and for the ITS (B).

The beta diversity analysis was then conducted to compare healthy and mastitis milk samples. The extent of change in ASVs abundances across samples was determined using unweighted and weighted UniFrac distance metrics. For the bacterial population, PCoA for unweighted UniFrac bundled 30.9% of the total variance in the first three principal coordinates. The first principal coordinate (axis 1) explained the 15.2% of the variability and the second principal coordinate (axis 2) explained the 9.2% (Fig 12A). For weighted UniFrac, PCoA bundled 63.1% of the total variance in the first three principal coordinates. Axis 1 explained the 30.7% of the variability and axis 2 explained the 15.9% (Fig 12B). For unweighted and weighted UniFrac, axis 1 and 2 separated healthy from mastitis milk samples, although with some overlaps. For the fungal population, PCoA for unweighted UniFrac bundled 47.8% of the total variance in the first three principal coordinates (Fig 12C). For weighted UniFrac, PCoA bundled 86.1% of the total variance in the first three principal coordinates (Fig 12D).

Fig 12 — A: unweighted UniFrac for the 16S rRNA, B: weighted UniFrac the 16S rRNA. C: unweighted UniFrac for the ITS, D: weighted UniFrac the ITS.

To study the statistical effect of mastitis on the milk microbial community, a Redundancy Analysis (RDA) was performed on VST-transformed normalized ASV counts. The resulting RDA model explained 2.7% of the total variance in ASVtrans. Given the study’s small sample size, a 90% confidence interval was considered; milk bacterial community was significantly different in mastitis (RDA test; P = 0.056).

Discussion

Camel milk has nutritional value and medicinal properties against a range of diseases; hence it is gaining international recognition. Camel mastitis is a complex disease that affects the amount and quality of milk produced. Bacterial and/or fungal infections are among the etiological agents of camel mastitis. Metagenomics approaches have been applied to investigate the microbiome of healthy milk samples, as well as clinical and subclinical mastitis in human, bovine, and buffalo [22, 28, 29]. However, knowledge regarding the pathogens responsible for camel milk mastitis is limited and exclusively based on conventional bacteriological methods. Till date there are no studies reporting the microbial population associated with camel mastitis through culture-independent approaches. This study reports the first detailed characterization of milk microbiota in camel milk with mastitis as determined by 16S rRNA gene sequencing.

Many pathogens live in large communities alongside other microbes, all of which participate in intricate interactions that might influence or drive disease processes [48–50]. Some commensal bacteria might become pathogenic under the impact of several conditions, such as the actions of other microorganisms or antibiotics that cause shifts in microbiome composition [51]. As exemplified by several metagenomics studies, the microbiome of healthy individuals includes pathogenic bacteria, and a relationship was found between resident microbes and the development of disease [28, 50]. As our results indicated, the genera Staphylococcus and Streptococcus, alongside other opportunistic bacteria were also found in healthy camel milk, suggesting that the development of mastitis in camels is mainly due to an imbalance or shift in the microbial population, rather than a primary infection. We observed an increase in the abundance of Staphylococcus, Streptococcus, Schlegelella, and unclassified Enterobacteriaceae, Klebsiella, and Jeotgalicoccus associated with mastitis. These results are consistent with previous culture-based studies on camel milk microbiota where Staphylococcus and Streptococcus were shown to be the most common causes of mastitis in Ethiopia [16, 23]. Streptococcus agalactiae was the only bacterium isolated from gangrenous mastitis in dromedary camels in the United Arab Emirates [11]. Staphylococcus and Streptococcus have been also known to be the main cause of human and bovine mastitis. Staphylococcus aureus has long been thought to be the main causative agent of mastitis; nevertheless, Staphylococcus epidermidis is becoming a leading cause of subacute and acute mastitis in both humans and animals [52]. In accordance to our study, an assessment of the microbial community in human milk showed that genera including Staphylococcus and Klebsiella were significantly enriched in mastitis samples. As opposed to mastitis human milk, the genus Pseudomonas decreased in camel mastitis with no change in the Acinetobacter relative abundance [22]. Pseudomonas genus present in healthy camel milk with a relative abundance (5.9%) was also found in the core microbiota of healthy bovine and buffalo milk, with a lower relative abundance than in bovine milk (18.75%) and a higher relative abundance than in buffalo milk (1.5%) [28, 53]. The genera Jeotgalicoccus was present in the majority of the mastitis samples, this genus along with Schlegelella were found for the first time in mastitis camel milk. The genus Exiguobacterium was identified as differentially abundant genera in mastitis samples by LefSe analysis. The enriched genus Exiguobacterium was found in a previous study among the bacteria identified from subclinical mastitis milk samples of Kankrej cows in India using pyrosequencing [54]. In addition, the presence of this halophilic bacteria was previously associated with goat and sheep milk [55, 56]. It is noteworthy that this study demonstrates a diversity in camel mastitis etiology. The increase in the abundance of Staphylococcus and Streptococcus is mainly associated to two samples CM-69M and CM-70M originating from camels suffering from severe clinical mastitis. To fully understand the mastitis-causing pathogens in camels, additional investigations are required, including a large number of mastitic milk samples along with bacterial culturing.

In parallel to an increase in the opportunistic bacteria, a significant decrease in the commensal beneficial bacteria such as lactic acid bacteria (Lactobacillus, Pediococcus, Enterococcus) was observed in mastitis. These lactic acid bacteria were identified as differentially abundant genera in healthy samples by LefSe analysis. However, an increase in the Lactococcus genus was observed. Similarly, an increase in this genus was observed in water buffalo milk during mastitis [28]. Lactic acid bacteria have therapeutic properties, making them potential candidates for inclusion in a probiotic cocktail to prevent and/or treat infectious mastitis in camels [57]. The use of probiotics has piqued the curiosity of veterinarians. To treat cow mastitis, a bacteriocin-producing Lactococcus lactis was proven equally effective in vivo as a standard antibiotic treatment [58].

Fungal-related mastitis was reported previously in several studies. The incidence of this type of mastitis is usually low in dairy herds, but it has significantly increased during the last decade. Teat injuries may predispose to establishment of a fungal infection [21]. The fungal genera identified in this study, Candida, Aspergillus and Cladosporium have also been described in a previous study conducted on cows suffering from mastitis in Poland. Among fungi, Candida is the predominant cause of mycotic mastitis. Seven species of Candida were suggested as etiological agents of bovine mastitis in Poland [21]. Candida species played a pathogenic role in mycotic mastitis of cows in China [59]. Pal et al., 2015 suggested a role of Candida in mastitis of one humped camel in Ethiopia by applying standard mycological techniques [27]. The genus Aspergillus was the most predominant fungi followed by Candida in she camel mastitis in Egypt in a culture-dependent study [60]. These two genera were also isolated from goat subclinical and clinical mastitis [61–63]. Cladosporium was detected among the mycotic causes of subclinical bovine mastitis in Egypt, ovine and caprine mastitis in Nigeria, and goat mastitis in Iraq [61, 64, 65]. However, Phanerochaete genus was not previously reported in dairy animal mastitis.

The diversity and richness of the bacterial community in healthy milk samples was considerably greater than that of mastitis milk samples, according to rarefaction curves and alpha diversity indices. Our findings are consistent with previous studies that showed that the microbiome of bovine and buffalo milk in healthy samples is more diverse than that reported in mastitis [6, 28, 29]. However, we observed increased diversity and richness of the fungal population of milk from mastitis samples in comparison to healthy samples. According to the literature, in comparison to bacterial biodiversity, knowledge of fungal diversity in raw milk is limited. The beta diversity analysis showed that the percentage of variance in the first three principal coordinate for the weighted Unifrac was greater than unweighted UniFrac, suggesting that the diversity could have probably resulted from the abundance, rather than the presence/absence of ASVs.

Regarding the potential origin of the microbiota detected in camel milk of healthy and mastitis groups, the majority of the detected genera are most probably originating from the dairy environment. An extensive study was conducted to link the bacteria discovered in cow milk to their locations on the farm [66]. The genera Streptococcus, Acinetobacter, Pseudomonas, Staphylococcus, Sphingomonas, Enterobacter, Brachybacterium, Corynebacterium detected in milk, were also found in various locations throughout the farm, including teat surfaces, milking parlors, hay, air, and dust. These findings showed that intramammary infection with these bacteria is mostly induced by crossing the teat canal from extramammary sites. However, Lactococcus and Lactobacillus, two technologically important bacteria, were found in cow milk but not in the dairy environment. Other factors such as improper hygiene practices and tick infestation may predispose camels to mastitis. Tick infestation is considered one of the primary causes of bacterial pathogenicity. The genera Pseudomonas, Staphylococcus, and Jeotgalicoccus were among the wide diversity of microorganisms residing within ticks associated with camels in Saudi Arabia, highlighting the medical importance of ticks (H. dromedarii) as reservoir of pathogenic, opportunistic and symbiotic microorganisms [67].

In conclusion, this study provided an insight into the bacterial and fungal communities associated with camel mastitis. The results indicate that an imbalance or shift in the microbial population, as evidenced by an increase in the opportunistic bacteria and a considerable decrease in the commensal bacteria, is the primary cause of the development of camel mastitis. Additionally, higher bacterial diversity and richness and lower fungal diversity and richness are linked to camel mastitis. Future studies are needed to determine the fungal and bacterial pathogenesis in camel mastitis as well as the relationship between the microbiota and the factors predisposing camels to mastitis. Furthermore,

Supporting information

S1 Appendix

(PDF)

Click here for additional data file.^{(471.1KB, pdf)}

Acknowledgments

The technical assistance of omics2view in sequencing and bioinformatics analysis is gratefully acknowledged.

Data Availability

The high-throughput sequencing data have been deposited in the NCBI database under the Bioproject PRJNA814002.

Funding Statement

This project was funded by Kuwait Foundation for the Advancement of Sciences (KFAS) under the project code PR18-12SL-16. This project was also funded by Kuwait Institute for Scientific Research (KISR) under the project code FB137C. RR received the funding for this work. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Bornstein S, Younan M. Significant veterinary research on the dromedary camels of Kenya: Past and present. J.Camelid Sci. 2013;6: 1–48. [Google Scholar]
2.Kumar D, Verma AK, Chatli MK, Singh R, Kumar P, Mehta N, et al. Camel milk: alternative milk for human consumption and its health benefits. Nutr Food Sci. 2016. [Google Scholar]
3.Swelum AA, El-Saadony MT, Abdo M, Ombarak RA, Hussein EOS, Suliman G, et al. Nutritional, antimicrobial and medicinal properties of Camel’s milk: A review. Saudi Journal of Biological Sciences. 2021;28: 3126–3136. doi: 10.1016/j.sjbs.2021.02.057 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Gossner C, Danielson N, Gervelmeyer A, Berthe F, Faye B, Kaasik Aaslav K, et al. Human–dromedary camel interactions and the risk of acquiring zoonotic Middle East respiratory syndrome coronavirus infection. Zoonoses and public health. 2016;63: 1–9. doi: 10.1111/zph.12171 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Faye B. The enthusiasm for camel production. Emirates Journal of Food and Agriculture. 2018: 249–250. [Google Scholar]
6.Oikonomou G, Bicalho ML, Meira E, Rossi RE, Foditsch C, Machado VS, et al. Microbiota of cow’s milk; distinguishing healthy, sub-clinically and clinically diseased quarters. PLoS One. 2014;9: e85904. doi: 10.1371/journal.pone.0085904 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Hertl JA, Grohn YT, Leach JD, Bar D, Bennett GJ, Gonzalez RN, et al. Effects of clinical mastitis caused by gram-positive and gram-negative bacteria and other organisms on the probability of conception in New York State Holstein dairy cows. J Dairy Sci. 2010;93: 1551–1560. doi: 10.3168/jds.2009-2599 [DOI] [PubMed] [Google Scholar]
8.Cervinkova D, Vlkova H, Borodacova I, Makovcova J, Babak V, Lorencova A, et al. Prevalence of mastitis pathogens in milk from clinically healthy cows. Vet Med. 2013;58: 567–575. [Google Scholar]
9.Klaas IC, Zadoks RN. An update on environmental mastitis: Challenging perceptions. Transboundary and emerging diseases. 2018;65: 166–185. doi: 10.1111/tbed.12704 [DOI] [PubMed] [Google Scholar]
10.Barbour EK, Nabbut NH, Frerichs WM, Al-Nakhli HM, Al-Mukayel AA. Mastitis in Camelus dromedarius in Saudi Arabia. Trop Anim Health Prod. 1985;17: 173–179. doi: 10.1007/BF02356968 [DOI] [PubMed] [Google Scholar]
11.El Tigani-Asil, E T A, Abdelwahab GE, Veedu J T V P, Khalafalla AI, Mohamed ZSA, Ishag HZA, et al. Gangrenous mastitis in dromedary camels in UAE caused by Streptococcus agalactiae. BMC Vet Res. 2020;16: 174–8. doi: 10.1186/s12917-020-02382-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Abdurahman O. Udder health and milk quality among camels in the Errer valley of eastern Ethiopia. Livestock Res Rural Dev. 2006;18: 32–38. [Google Scholar]
13.Abdurahman OA, Agab H, Abbas B, Astrom G. Relations between udder infection and somatic cells in camel (camelus dromedarius) milk. Acta Vet Scand. 1995;36: 423–431. doi: 10.1186/BF03547657 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Obied AI, Bagadi HO, Mukhtar MM. Mastitis in Camelus dromedarius and the somatic cell content of camels’ milk. Res Vet Sci. 1996;61: 55–58. doi: 10.1016/s0034-5288(96)90111-3 [DOI] [PubMed] [Google Scholar]
15.Younan M, Ali Z, Bornstein S, Muller W. Application of the California mastitis test in intramammary Streptococcus agalactiae and Staphylococcus aureus infections of camels (Camelus dromedarius) in Kenya. Prev Vet Med. 2001;51: 307–316. doi: 10.1016/s0167-5877(01)00228-8 [DOI] [PubMed] [Google Scholar]
16.Abera M, Abdi O, Abunna F, Megersa B. Udder health problems and major bacterial causes of camel mastitis in Jijiga, Eastern Ethiopia: implication for impacting food security. Trop Anim Health Prod. 2010;42: 341–347. doi: 10.1007/s11250-009-9424-6 [DOI] [PubMed] [Google Scholar]
17.Bekele T, Molla B. Mastitis in lactating camels (Camelus dromedarius) in Afar Region, north-eastern Ethiopia. Berl Munch Tierarztl Wochenschr. 2001;114: 169–172. [PubMed] [Google Scholar]
18.Abdel Gadir Atif E, Hildebrandt G, Kleer JN, Molla B, Kyule MN, Baumann MP. Comparison of California Mastitis Test (CMT), Somatic Cell Counts (SCC) and bacteriological examinations for detection of camel (Camelus dromedarius) mastitis in Ethiopia. Berl Munch Tierarztl Wochenschr. 2006;119: 45–49. [PubMed] [Google Scholar]
19.Aqib AI, Muzammil I, Naseer MA, Shoaib M, Bakht P, Zaheer T, et al. Pathological insights into camel mastitis. Acta Trop. 2022: 106415. doi: 10.1016/j.actatropica.2022.106415 [DOI] [PubMed] [Google Scholar]
20.Ahmad S, Yaqoob M, Bilal MQ, Khan MK, Muhammad G, Yang LG, et al. Factors affecting yield and composition of camel milk kept under desert conditions of central Punjab, Pakistan. Trop Anim Health Prod. 2012;44: 1403–1410. doi: 10.1007/s11250-012-0079-3 [DOI] [PubMed] [Google Scholar]
21.Dworecka-Kaszak B, Krutkiewicz A, Szopa D, Kleczkowski M, Biegańska M. High prevalence of Candida yeast in milk samples from cows suffering from mastitis in poland. The Scientific World Journal. 2012;2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Patel SH, Vaidya YH, Patel RJ, Pandit RJ, Joshi CG, Kunjadiya AP. Culture independent assessment of human milk microbial community in lactational mastitis. Sci Rep. 2017;7: 7804–7. doi: 10.1038/s41598-017-08451-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Alebie A, Molla A, Adugna W, Tesfaye A, Ejo M. Prevalence, Isolation, Identification, and Risk Factors of Major Bacterial Cause of Camel Subclinical Mastitis. Biomed Res Int. 2021;2021: 5522331. doi: 10.1155/2021/5522331 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Seligsohn D, Nyman AK, Younan M, Sake W, Persson Y, Bornstein S, et al. Subclinical mastitis in pastoralist dairy camel herds in Isiolo, Kenya: Prevalence, risk factors, and antimicrobial susceptibility. J Dairy Sci. 2020;103: 4717–4731. doi: 10.3168/jds.2019-17701 [DOI] [PubMed] [Google Scholar]
25.Geresu MA, Abera Leliso S, Liben GW. Camel Mastitis: Prevalence, Risk Factors, and Isolation of Major Bacterial Pathogens in Gomole District of Borena Zone, Southern Ethiopia. Vet Med Int. 2021;2021: 9993571. doi: 10.1155/2021/9993571 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Al-Dughaym AM, Fadlelmula A. Prevalence, etiology and its seasonal prevalence of clinical and subclinical camel mastitis in Saudi Arabia. British Journal of Applied Science & Technology. 2015;9: 441–449. [Google Scholar]
27.Pal Mahendra. First Record of Camel Mastitis due to Candida albicans in Ethiopia. Indian Journal of Comparative Microbiology, Immunology and Infectious Diseases. 2015;36: 32–34. [Google Scholar]
28.Catozzi C, Sanchez Bonastre A, Francino O, Lecchi C, De Carlo E, Vecchio D, et al. The microbiota of water buffalo milk during mastitis. PLoS One. 2017;12: e0184710. doi: 10.1371/journal.pone.0184710 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Taponen S, McGuinness D, Hiitio H, Simojoki H, Zadoks R, Pyorala S. Bovine milk microbiome: a more complex issue than expected. Vet Res. 2019;50: 44-y. doi: 10.1186/s13567-019-0662-y [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Karzis J, Donkin EF, Webb EC, Etter EM, Petzer I. Somatic cell count thresholds in composite and quarter milk samples as indicator of bovine intramammary infection status. Onderstepoort J Vet Res. 2017;84: 1–10. doi: 10.4102/ojvr.v84i1.1269 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Schepers AJ, Lam T, Schukken YH, Wilmink J, Hanekamp W. Estimation of variance components for somatic cell counts to determine thresholds for uninfected quarters. J Dairy Sci. 1997;80: 1833–1840. doi: 10.3168/jds.S0022-0302(97)76118-6 [DOI] [PubMed] [Google Scholar]
32.Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJ, Holmes SP. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods. 2016;13: 581–583. doi: 10.1038/nmeth.3869 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Bushnell B. BBTools. 2019. Available: https://jgi.doe.gov/data-and-tools/bbtools/. [Google Scholar]
34.Murali A, Bhargava A, Wright ES. IDTAXA: a novel approach for accurate taxonomic classification of microbiome sequences. Microbiome. 2018;6: 140–5. doi: 10.1186/s40168-018-0521-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Wright ES. Using DECIPHER v2.0 to Analyze Big Biological Sequence Data in R. The R Journal. 2016;8: 352–359. [Google Scholar]
36.Parks DH, Chuvochina M, Waite DW, Rinke C, Skarshewski A, Chaumeil PA, et al. A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life. Nat Biotechnol. 2018;36: 996–1004. doi: 10.1038/nbt.4229 [DOI] [PubMed] [Google Scholar]
37.Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 2013;41: 590. doi: 10.1093/nar/gks1219 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution. 1987;4: 406–425. doi: 10.1093/oxfordjournals.molbev.a040454 [DOI] [PubMed] [Google Scholar]
39.Douglas GM, Maffei VJ, Zaneveld JR, Yurgel SN, Brown JR, Taylor CM, et al. PICRUSt2 for prediction of metagenome functions. Nat Biotechnol. 2020;38: 685–688. doi: 10.1038/s41587-020-0548-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Louca S, Doebeli M. Efficient comparative phylogenetics on large trees. Bioinformatics. 2018;34: 1053–1055. doi: 10.1093/bioinformatics/btx701 [DOI] [PubMed] [Google Scholar]
41.Benjamini Y, Hochberg Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal statistical society: series B (Methodological). 1995;57: 289–300. [Google Scholar]
42.Oksanen J F. Blanchet Guillaume, Friendly Michael, Kindt Roeland, Legendre Pierre, McGlinn Dan, et al. vegan: Community Ecology Package. 2018. Available: https://github.com/vegandevs/vegan. [Google Scholar]
43.Lozupone CA, Hamady M, Kelley ST, Knight R. Quantitative and qualitative beta diversity measures lead to different insights into factors that structure microbial communities. Appl Environ Microbiol. 2007;73: 1576–1585. doi: 10.1128/AEM.01996-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15: 550–8. doi: 10.1186/s13059-014-0550-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Anders S, Huber W. Differential expression analysis for sequence count data. Nature Precedings. 2010: 1. doi: 10.1186/gb-2010-11-10-r106 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Cao Y. microbiomeMarker: Microbiome biomarker analysis. 2020. Available: https://github.com/yiluheihei/microbiomeMarker. [Google Scholar]
47.Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, et al. Metagenomic biomarker discovery and explanation. Genome Biol. 2011;12: R60–r60. doi: 10.1186/gb-2011-12-6-r60 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Chow J, Mazmanian SK. A pathobiont of the microbiota balances host colonization and intestinal inflammation. Cell Host Microbe. 2010;7: 265–276. doi: 10.1016/j.chom.2010.03.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Chow J, Tang H, Mazmanian SK. Pathobionts of the gastrointestinal microbiota and inflammatory disease. Curr Opin Immunol. 2011;23: 473–480. doi: 10.1016/j.coi.2011.07.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Vayssier-Taussat M, Albina E, Citti C, Cosson JF, Jacques MA, Lebrun MH, et al. Shifting the paradigm from pathogens to pathobiome: new concepts in the light of meta-omics. Front Cell Infect Microbiol. 2014;4: 29. doi: 10.3389/fcimb.2014.00029 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Stecher B, Denzler R, Maier L, Bernet F, Sanders MJ, Pickard DJ, et al. Gut inflammation can boost horizontal gene transfer between pathogenic and commensal Enterobacteriaceae. Proc Natl Acad Sci U S A. 2012;109: 1269–1274. doi: 10.1073/pnas.1113246109 [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Delgado S, Arroyo R, Jimenez E, Marin ML, del Campo R, Fernandez L, et al. Staphylococcus epidermidis strains isolated from breast milk of women suffering infectious mastitis: potential virulence traits and resistance to antibiotics. BMC Microbiol. 2009;9: 82–82. doi: 10.1186/1471-2180-9-82 [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Kuehn JS, Gorden PJ, Munro D, Rong R, Dong Q, Plummer PJ, et al. Bacterial community profiling of milk samples as a means to understand culture-negative bovine clinical mastitis. PLoS One. 2013;8: e61959. doi: 10.1371/journal.pone.0061959 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Bhanderi BB, Jhala MK, Ahir VB, Bhatt VD, Joshi CG. Cultural and metagenomic based identification of a microbiome from subclinical mastitis in cows. Veterinarski arhiv. 2014;84: 215–228. [Google Scholar]
55.Alegria A, Szczesny P, Mayo B, Bardowski J, Kowalczyk M. Biodiversity in Oscypek, a traditional Polish cheese, determined by culture-dependent and -independent approaches. Appl Environ Microbiol. 2012;78: 1890–1898. doi: 10.1128/AEM.06081-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Callon C, Duthoit F, Delbes C, Ferrand M, Le Frileux Y, De Cremoux R, et al. Stability of microbial communities in goat milk during a lactation year: molecular approaches. Syst Appl Microbiol. 2007;30: 547–560. doi: 10.1016/j.syapm.2007.05.004 [DOI] [PubMed] [Google Scholar]
57.Bouchard DS, Seridan B, Saraoui T, Rault L, Germon P, Gonzalez-Moreno C, et al. Lactic Acid Bacteria Isolated from Bovine Mammary Microbiota: Potential Allies against Bovine Mastitis. PLoS One. 2015;10: e0144831. doi: 10.1371/journal.pone.0144831 [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Klostermann K, Crispie F, Flynn J, Ross RP, Hill C, Meaney W. Intramammary infusion of a live culture of Lactococcus lactis for treatment of bovine mastitis: comparison with antibiotic treatment in field trials. J Dairy Res. 2008;75: 365–373. doi: 10.1017/S0022029908003373 [DOI] [PubMed] [Google Scholar]
59.Du J, Wang X, Luo H, Wang Y, Liu X, Zhou X. Epidemiological investigation of non-albicans Candida species recovered from mycotic mastitis of cows in Yinchuan, Ningxia of China. BMC veterinary research. 2018;14: 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Abo Hashem M, Ibrahim S, Goda AS, Enany M. Diversity of Microorganisms Associated to She Camels’ Subclinical and Clinical Mastitis in South Sinai, Egypt. Suez Canal Veterinary Medical Journal.SCVMJ. 2020;25: 307–319. [Google Scholar]
61.Hasan KAM, Yassein SN. Prevalence and type of fungi in milk from goats with sub clinical mastitis. Online Journal of Veterinary Research. 2018;22: 669–674. [Google Scholar]
62.Carmo Priscila Maria Silva do, Uzal FA, Pedroso PM, Riet-Correa F. Conidiobolomycosis, cryptococcosis, and aspergillosis in sheep and goats: a review. Journal of Veterinary Diagnostic Investigation. 2020;32: 826–834. doi: 10.1177/1040638720958338 [DOI] [PMC free article] [PubMed] [Google Scholar]
63.Jensen HE, De Los Monteros, Espinosa A, Carrasco L. Caprine mastitis due to aspergillosis and zygomycosis: a pathological and immunohistochemical study. J Comp Pathol. 1996;114: 183–191. doi: 10.1016/s0021-9975(96)80007-7 [DOI] [PubMed] [Google Scholar]
64.Enany ME, EL-Attar AA, Khafagy A, EL-Gammal AM. Bacterial and mycotic causes of subclinical bovine mastitis. Suez Canal Veterinary Medicine Journal. 2007;12: 107–133. [Google Scholar]
65.Anueyiagu KN, Audu SK, Joshua BD, Pelumi OE, Haji SA. Prevalence and antibiogram of coliform bacteria, and occurrence of fungi in subclinical mastitis in small ruminants in Plateau State, Nigeria. Journal of Animal Science and Veterinary Medicine. 2020;5: 83–91. [Google Scholar]
66.Vacheyrou M, Normand AC, Guyot P, Cassagne C, Piarroux R, Bouton Y. Cultivable microbial communities in raw cow milk and potential transfers from stables of sixteen French farms. Int J Food Microbiol. 2011;146: 253–262. doi: 10.1016/j.ijfoodmicro.2011.02.033 [DOI] [PubMed] [Google Scholar]
67.Alreshidi MM, Veettil VN, Noumi E, Del Campo R, Snoussi M. Description of microbial diversity associated with ticks Hyalomma dromedarii (Acari: Ixodidae) isolated from camels in Hail region (Saudi Arabia) using massive sequencing of 16S rDNA. Bioinformation. 2020;16: 602. doi: 10.6026/97320630016602 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0278456.r001

Decision Letter 0

Pierre Germon

11 Oct 2022

PONE-D-22-24736Assessment of mastitis in camel using high-throughput sequencingPLOS ONE

Dear Dr. Rahmeh,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

In addition to the comments made by reviewers, I would like you to address the following questions and remarks. From the data presented, in the case of mastitis, it would have been interesting to compare the metagenomic data with more classical bacteriology methods. Can you infer the causative agent from the metagenomic analyses presented in Figure 2 ? One comment I have is that mastitis cases, although from different etiology as nicely shown in Figure 2, are pooled together in the results presented in Table 1, 2 and 3. Such a diversity in causes of mastitis is somehow hidden by the way data are presented.It might be worth specifying that the mastitis cases investigated in this report are clinical cases (based on symptoms and cell counts).I would also like you to explain the reason why no "no DNA control" was performed to characterize the ASVs that could originate from the processing of samples.L170: start sentence with capital "U".

Please submit your revised manuscript by Nov 25 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Pierre Germon

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following in the Acknowledgments Section of your manuscript:

“This project was funded by Kuwait Foundation for the Advancement of Sciences (KFAS) under the project code PR18-12SL-16. The authors thank KFAS (Kuwait City, Kuwait), and Kuwait Institute for Scientific Research (Kuwait City, Kuwait) for their financial support. The technical assistance of omics2view in sequencing and bioinformatics analysis is gratefully acknowledged.”

We note that you have provided funding information that is currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

“This project was funded by Kuwait Foundation for the Advancement of Sciences (KFAS) under the project code PR18-12SL-16”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

3. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: MAJOR COMMENTS

Camels are fundamental to food production in many arid regions in the world. Mastitis is a common and costly condition in camels, negatively affecting milk yield, quality and household income. Rahmeh et al have conducted a study, investigating the microbiome of milk from camels with healthy udders and milk from udders with clinical mastitis. This manuscript presents novel results regarding the microbial communities found in camel milk and specifically investigates the differences in microbiota in healthy and in mastitic milk.

The paper is scientifically sound, and methods are generally well described in sufficient detail. The sample size is quite modest which should be taken in consideration when interpreting the results. I do find it a bit of a concern that no milk samples were cultured, according to the manuscript, since this comparison would have provided very useful information about potential contamination at the time of sampling. This issue deserves to be addressed in the discussion.

The manuscript is overall well written but suffers from an abundance of minor linguistic errors which in some sections make the text difficult to interpret.

MINOR COMMENTS

Abstract

Lines 14-14: Mastitis could be caused by other pathogens as well, such as virus or algae.

Lines 18-19: Kindly specify what type of samples were taken.

Line 23: Maybe specify “in milk from inflamed udders” or something along those lines as it is not the milk that has mastitis.

Line 29-30: Same as above, this sentence needs to be clarified, maybe add “healthy milk and mastitic milk” to make it clearer?

Introduction

Line 39: Kindly remove the “s” from camelids.

Line 40: Change to “Asian and African regions” to be grammatically correct.

Line 40-41: These numbers are based on calculated estimates, especially in the major camel milk producing regions in East Africa, so I think this sentence should be phrased a bit more carefully.

Lines 41-44: What do the authors mean with “better than bovine milk”? Are these medicinal claims scientifically proven?

Line 44: Kindly change the tense of “increased” to be grammatically correct.

Line 53-54: I suggest the sentence is changed to “from one animal to another during the milking process” to be grammatically correct.

Line 55: Change to “The camel…” or “Camels…”

Line 56: Add a “the” before “symptoms”, change to “camels”

Lines 67-68: Remove “the” in front of "nomadic housing" and "improper hygienic measures".

Lines 70-72: Candida may be the leading cause of mycotic mastitis, but it is not the only fungus that could cause mastitis, please adjust this sentence.

Lines 75-76: Kindly change to “camels”. What do the authors mean by “little is known about pathogens involved in mastitis occurrence in camel” – that there is a small number of studies available? Because there is actually a rather large number of studies published investigating bacterial causes of both clinical and subclinical mastitis in dromedary camels. Or do the authors mean that there is limited knowledge available since most studies are based on conventional bacterial culture? Culturing is still the standard method for detection of intramammary infections in all dairy species. Kindly clarify to make to facilite for the readers.

Line 81: Please add “a” to “a high prevalence of fungi…”.

Line 87: Change to “have”.

Line 88: Please add “mastitis” after subclinical.

Line 89: Please add “a” in front of “next-generation…”.

Lines 95-97: These conclusive remarks should be saved for the Conclusions.

Materials and methods

Line 103: Kindly change to “camel owners’ “ as I assume there were more than one owner giving permission?

Sample collection

Line 105-106: I think “milking of individual dromedary camels…” would suffice as the sample selection is described more in detail further down.

Line 107: Kindly changed to “veterinarian”, and “localized” if that is what you mean.

Line 109: Was the SCC checked at the time of sampling? Kindly provide some more information about how the SCC procedure was carried out and why 200,000 cells/ml was chosen as a threshold for mastitis, as this is not mentioned anywhere in the introduction. Was SCC tested in all milk samples, also the ones taken from udders with clinical mastitis?

Line 111: Please add “was given” after “owner permission”. Please remove “the” in front of “disinfection”, change “were” to “was”.

Line 113-114: Was there any measures undertaken to keep the milk samples chilled?

DNA extraction

Line 117: A sentence should not begin with a number.

Statistical analysis

Line 156. Should be “P-values”, kindly check this throughout the manuscript.

Line 172: Please begin the sentence with a capital letter.

Results

Line 179-180: Kindly be consistent in how you write out numbers (like “twenty-five” or if you write them using digits like 16 and 9 in this sentence). Numbers smaller than twelve should be spelled out or else you should use digits, please check this throughout the manuscript. I think the origin of the samples could be more clearly stated. What is a “healthy sample”? Kindly check this throughout the manuscript (for ex. In the legends for figures 3&4).

Lines 182-183: Please clarify this sentence.

Lines 188-189: Please, clarify this sentence.

Camel milk microbiota in healthy and mastitis milk samples

Line 192: Kindly, add milk.

Line 200: What does “uncultured bacteria” refer to?

Line 222: “Condition” could be omitted. Please change “were” to “was” to improve the grammar.

Line 224: Substitute “in” with “with”.

Table 2: It would be helpful for interpretation if the unit was stated.

Line 234: Kindly replace percent with percentage.

Table 3&6. Both columns showing P-values (adjusted and unadjusted) contain identical values, maybe it would be sufficient with one column?

Line 258: Kindly substitute were for was.

Line 266: I think this sentence could be clarified, “In milk with mastitis…” or something like that as it doesn’t read right at present.

Lines 276 and 280: Should be percentage.

Line 281: Please, begin a sentence with a capital letter.

Figure 5&6: Why are only four samples shown in the mastitis category?

Line 286: Please clarify this sentence, the mastitis is still the inflammation of the mammary gland and the samples are not of the gland but of the milk.

Microbial Richness and Diversity in healthy and mastitis milk samples

Line 300: Change to lower case for all words in the heading to be consistent.

Lines 306 and 313-314: Please adjust these sentences so they are grammatically correct.

Line 310: Should be “were”.

Discussion

Line 354: Kindly, change had to have.

Line 356: Should there not be a “milk” at the end of this sentence?

Line 358: Change “is” to “are”.

Line 369: Should be “camels”.

Line 373: replace the “,” with “and” (Staphylococcus and Streptococcus…”)

Line 374: Both of the studies referred to are from Ethiopia, kindly remove Kenya or add a reference from Kenya.

Line 379: Should be “humans”.

Line 385: Add “in” before “bovine milk” and “buffalo milk”.

Line 389: Add “a” before “previous study”.

Lines 403-409: Maybe clarify this section so that the readers understand that these results are not originating from the camel dairy industry.

Line 410: Please, begin the sentence with a capital letter.

Line 413: Goat mastitis is the same as caprine mastitis.

Line 413: Mastitis is not produced?

Line 418-419: Kindly adjust this sentence to make it grammatically correct.

Line 437: Omit “the” in front of “improper milking…”.

Lines 438-439: The significance of tick infestation as the “major cause” of mastitis needs to be supported with adequate references.

Reviewer #2: Regarding manuscript entitled “Assessment of mastitis in camel using high-throughput sequencing”, the authors aimed to report the bacterial and fungal community involved in camel mastitis using Illumina amplicon sequencing.

The study is interesting and can be accepted after minor revision. Pleases add some details regarding camel age, parity and management.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Ayman A Swelum

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Dec 7;17(12):e0278456. doi: 10.1371/journal.pone.0278456.r002

Author response to Decision Letter 0

1 Nov 2022

Response to Academic Editor

• From the data presented, in the case of mastitis, it would have been interesting to compare the metagenomic data with more classical bacteriology methods. Can you infer the causative agent from the metagenomic analyses presented in Figure 2? One comment I have is that mastitis cases, although from different etiology as nicely shown in Figure 2, are pooled together in the results presented in Table 1, 2 and 3. Such a diversity in causes of mastitis is somehow hidden by the way data are presented.

AU: We thank the editor for his careful reading of the manuscript and for his constructive comments. Complementing culture-independent and culture-based approaches provide a complete understanding of the disease etiology. Culture-dependent approaches only target cultivable bacteria and in some cases, have insufficient discriminatory power. Isolates will strongly depend on the media used, sample storage, and growth conditions. Many microorganisms are averse to isolation using common culturing methods, thus potentially leading to a significant underestimation of the microbial communities. Considering this major bias, high-throughput sequencing approaches detect DNA from all the bacteria present in a sample, alive or not, allowing a much more in-depth and accurate estimation of microbial diversity. It is misleading to infer, from such kind of data (culture-based), if the causative agent is a single species just because its abundance is higher or because it has been found in previous analyses. There is increasing evidence that dysbiotic states are not only connected to a single species, rather to changes in the composition and function of the whole microbiome (i.e. conceptualized in the term “pathobiome” as defined in Bass et al 2019 (10.1016/j.tree.2019.07.012)). Our study points toward this approach, consider the microbiome as a whole and determine the difference between healthy and mastitis microbiome.

Figure 2 gives an insight into the mastitis-causing pathogens and demonstrates a diversity in camel mastitis etiology. As suggested, Tables S4 and S5 summarizing the taxon frequencies of the most dominant bacterial population in all the healthy and mastitis camel milk samples at the phylum and genus levels are now added to the supporting information.

We totally agree with the editor, further study is required to fully understand camel mastitis, which is now addressed in the discussion lines 404-408: “It is noteworthy that this study demonstrates a diversity in camel mastitis etiology. The increase in the abundance of Staphylococcus and Streptococcus is mainly associated to two samples CM-69M and CM-70M originating from camels suffering from severe clinical mastitis. To fully understand the mastitis-causing pathogens in camels, additional investigations are required, including a large number of mastitic milk samples along with bacterial culturing”.

• It might be worth specifying that the mastitis cases investigated in this report are clinical cases (based on symptoms and cell counts).

AU: We thank the editor for this comment. Indeed, it is clinical mastitis, we added this information in the abstract lines 18 and 32.

• I would also like you to explain the reason why no "no DNA control" was performed to characterize the ASVs that could originate from the processing of samples.

AU: All healthy and mastitis samples were processed in the same way at the same time during the entire workflow (DNA extraction, library preparation, sequencing, and bioinformatics analysis). Any background noise, if existing, may thus be present in both conditions (healthy and mastitis) which will not affect the results generated from their comparison.

L170: start sentence with capital "U".

AU: Corrected

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.

AU: The manuscript style requirements was verified

2. Thank you for stating the following in the Acknowledgments Section of your manuscript:

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

“This project was funded by Kuwait Foundation for the Advancement of Sciences (KFAS) under the project code PR18-12SL-16”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

AU: The funding-related text is now removed from the manuscript. The current funding statement is correct.

AU: The reference list was reviewed.

Response to Reviewers

Reviewer #1: MAJOR COMMENTS

The paper is scientifically sound, and methods are generally well described in sufficient detail.

• The sample size is quite modest which should be taken in consideration when interpreting the results. I do find it a bit of a concern that no milk samples were cultured, according to the manuscript, since this comparison would have provided very useful information about potential contamination at the time of sampling. This issue deserves to be addressed in the discussion.

AU: We thank the reviewer for the careful reading of the manuscript and for helpful and constructive suggestions that greatly improved the manuscript. We agree with the reviewer, the sample size was modest due to 1) the limited number of camels suffering from clinical mastitis and showing obvious signs of mastitis on their udder and milk, 2) the quantity of extracted DNA was very low for some samples, 3) the library preparation was not successful for some samples.

Compared to the culturing methods, culture-independent approaches are more adequate to identify the mastitis-causing pathogens. There is increasing evidence that dysbiotic states are not only connected to a single species, rather to changes in the composition and function of the whole microbiome (i.e. conceptualized in the term “pathobiome” as defined in Bass et al 2019 (10.1016/j.tree.2019.07.012)). Our study points toward this approach, consider the microbiome as a whole and determine the difference between healthy and mastitis microbiome. However, the reviewer is totally right; this study gave insights about the possible causative agents of mastitis in camel and further complementary study is required. This issue is now addressed in the discussion lines 404-408: “It is noteworthy that this study demonstrates a diversity in camel mastitis etiology. The increase in the abundance of Staphylococcus and Streptococcus is mainly associated to two samples CM-69M and CM-70M originating from camels suffering from severe clinical mastitis. To fully understand the mastitis-causing pathogens in camels, additional investigations are required, including a large number of mastitic milk samples along with bacterial culturing”.

Furthermore, in the discussion, a paragraph about the bacteria that were suggested as the main cause of camel mastitis identified by culture-based methods in other studies is mentioned on page 16 (lines 385-389).

• The manuscript is overall well written but suffers from an abundance of minor linguistic errors which in some sections make the text difficult to interpret.

AU: The manuscript has been edited and revised taking into consideration all the linguistic errors

MINOR COMMENTS

Abstract

Lines 14-14: Mastitis could be caused by other pathogens as well, such as virus or algae.

AU: The sentence was reformulated to mastitis in general because we are not sure if there is available information about the other pathogens such as virus and algae as causative agents of camel mastitis.

Lines 18-19: Kindly specify what type of samples were taken.

AU: Added.

Line 23: Maybe specify “in milk from inflamed udders” or something along those lines as it is not the milk that has mastitis.

AU: Added.

Line 29-30: Same as above, this sentence needs to be clarified, maybe add “healthy milk and mastitic milk” to make it clearer?

AU: As suggested, the sentence is now clarified

Introduction

Line 39: Kindly remove the “s” from camelids.

AU: Removed.

Line 40: Change to “Asian and African regions” to be grammatically correct.

AU: Changed.

Line 40-41: These numbers are based on calculated estimates, especially in the major camel milk producing regions in East Africa, so I think this sentence should be phrased a bit more carefully.

AU: As suggested, the sentence was rephrased.

Lines 41-44: What do the authors mean with “better than bovine milk”? Are these medicinal claims scientifically proven?

AU: Yes, compared to bovine milk, camel milk’s digestibility is higher. It has a higher nutritional value, and contains a higher amount of proteins that have a positive effect on the immune system. Camel milk possesses little or no allergy effects, and lactose-intolerant people have no difficulties in metabolizing its lactose. Reference: Khalesi, Mohammadreza, et al. "Biomolecular content of camel milk: A traditional superfood towards future healthcare industry." Trends in Food Science & Technology 62 (2017): 49-58.

Line 44: Kindly change the tense of “increased” to be grammatically correct.

AU: Changed.

Line 53-54: I suggest the sentence is changed to “from one animal to another during the milking process” to be grammatically correct.

AU: Changed.

Line 55: Change to “The camel…” or “Camels…”

AU: Changed.

Line 56: Add a “the” before “symptoms”, change to “camels”

AU: Changed.

Lines 67-68: Remove “the” in front of "nomadic housing" and "improper hygienic measures".

AU: Removed.

Lines 70-72: Candida may be the leading cause of mycotic mastitis, but it is not the only fungus that could cause mastitis, please adjust this sentence.

AU: we agree with the reviewer; the sentence is now adjusted.

AU: We thank the reviewer for this comment. Yes, we mean that there is limited knowledge available since most studies are based on conventional bacterial culture. It is now clarified.

Line 81: Please add “a” to “a high prevalence of fungi…”.

AU: Added.

Line 87: Change to “have”.

AU: Changed.

Line 88: Please add “mastitis” after subclinical.

AU: Added.

Line 89: Please add “a” in front of “next-generation…”.

AU: Added.

Lines 95-97: These conclusive remarks should be saved for the Conclusions.

AU: we agree with the reviewer; these conclusive remarks are now deleted.

Materials and methods

Line 103: Kindly change to “camel owners’ “ as I assume there were more than one owner giving permission?

AU: Changed.

Sample collection

Line 105-106: I think “milking of individual dromedary camels…” would suffice as the sample selection is described more in detail further down.

AU: Changed.

Line 107: Kindly changed to “veterinarian”, and “localized” if that is what you mean.

AU: Changed.

AU: We thank the reviewer for this comment. A paragraph was added in the methodology including the suggested information: The SCC count for all milk samples was performed immediately upon arrival at the laboratory using a direct cell counter (DCC, DeLaval International AB). The optimum SCC threshold for healthy milk is estimated to be around 200,000 cells/mL (Scheperz, 1997, Karzis et al., 2017). The milk samples with SCC less than 200,000 cells/ml were considered healthy milk samples.

National Mastitis Council Guidelines: Clinical mastitis is, by definition, abnormal milk, and no reference to SCC is required. However, clinical mammary quarters will almost always have SCC greater than 200,000 cells/ml (https://www.nmconline.org/wp content/uploads/2016/09/Guidelines-on-Normal-and-Abnormal-Raw-Milk.pdf).

Line 111: Please add “was given” after “owner permission”. Please remove “the” in front of “disinfection”, change “were” to “was”.

AU: Added.

Line 113-114: Was there any measures undertaken to keep the milk samples chilled?

AU: Yes, the samples were transported in an icebox.

DNA extraction

Line 117: A sentence should not begin with a number.

AU: Edited.

Statistical analysis

Line 156. Should be “P-values”, kindly check this throughout the manuscript.

AU: Corrected.

Line 172: Please begin the sentence with a capital letter.

AU: Edited.

Results

AU: The numbers are now checked in all the manuscript. As suggested, the origin of samples and the criteria for healthy samples is now added in the methods section (lines 121-123) and in the results section (188-189).

Lines 182-183: Please clarify this sentence.

AU: Clarified

Lines 188-189: Please, clarify this sentence.

AU: Clarified

Camel milk microbiota in healthy and mastitis milk samples

Line 192: Kindly, add milk.

AU: Added

Line 200: What does “uncultured bacteria” refer to?

AU: Definition is now added.

Line 222: “Condition” could be omitted. Please change “were” to “was” to improve the grammar.

AU: Changed

Line 224: Substitute “in” with “with”.

AU: Substituted

Table 2: It would be helpful for interpretation if the unit was stated.

AU: The unit (%) is now stated

Line 234: Kindly replace percent with percentage.

AU: Replaced

Table 3&6. Both columns showing P-values (adjusted and unadjusted) contain identical values, maybe it would be sufficient with one column?

AU: We agree with the reviewer; one column is now kept.

Line 258: Kindly substitute were for was.

AU: Substituted

Line 266: I think this sentence could be clarified, “In milk with mastitis…” or something like that as it doesn’t read right at present.

AU: As suggested, this sentence is now edited

Lines 276 and 280: Should be percentage.

AU: Changed

Line 281: Please, begin a sentence with a capital letter.

AU: Changed

Figure 5&6: Why are only four samples shown in the mastitis category?

AU: For the ITS analysis, the library preparation for sequencing was successful for four samples.

Line 286: Please clarify this sentence, the mastitis is still the inflammation of the mammary gland and the samples are not of the gland but of the milk.

AU: Clarified

Microbial Richness and Diversity in healthy and mastitis milk samples

Line 300: Change to lower case for all words in the heading to be consistent.

AU: Changed

Lines 306 and 313-314: Please adjust these sentences so they are grammatically correct.

AU: Adjusted

Line 310: Should be “were”.

AU: Changed

Discussion

Line 354: Kindly, change had to have.

AU: Changed

Line 356: Should there not be a “milk” at the end of this sentence?

AU: Added

Line 358: Change “is” to “are”.

AU: Changed

Line 369: Should be “camels”.

AU: s is added

Line 373: replace the “,” with “and” (Staphylococcus and Streptococcus…”)

AU: Replaced

Line 374: Both of the studies referred to are from Ethiopia, kindly remove Kenya or add a reference from Kenya.

AU: We agree with the reviewer, Kenya was removed

Line 379: Should be “humans”.

AU: “s” is added

Line 385: Add “in” before “bovine milk” and “buffalo milk”.

AU: Added

Line 389: Add “a” before “previous study”.

AU: Added

Lines 403-409: Maybe clarify this section so that the readers understand that these results are not originating from the camel dairy industry.

AU: As suggested, this section is now clarified

Line 410: Please, begin the sentence with a capital letter.

AU: Done

Line 413: Goat mastitis is the same as caprine mastitis.

AU: This sentence was reformulated to make it clearer

Line 413: Mastitis is not produced?

AU: This sentence was reformulated to make it clearer

Line 418-419: Kindly adjust this sentence to make it grammatically correct.

AU: Edited

Line 437: Omit “the” in front of “improper milking…”.

AU: Deleted

Lines 438-439: The significance of tick infestation as the “major cause” of mastitis needs to be supported with adequate references.

AU: Tick infestation is considered one of the primary causes of bacterial pathogenicity (not mastitis in particular), the reference is the same as the one for the following sentence (reference 67). Since the genera Pseudomonas, Staphylococcus, and Jeotgalicoccus were among the wide diversity of microorganisms residing within ticks associated with camels in Saudi Arabia, tick infestation may predispose camels to mastitis.

The study is interesting and can be accepted after minor revision. Pleases add some details regarding camel age, parity and management.

AU: We thank the reviewer for his time and interest in our study. A table is now added to the supporting information including the camel age, parity and management (S1 Table).

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(28.9KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0278456.r003

Decision Letter 1

Pierre Germon

17 Nov 2022

Assessment of mastitis in camel using high-throughput sequencing

PONE-D-22-24736R1

Dear Dr. Rahmeh,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Pierre Germon

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0278456.r004

Acceptance letter

Pierre Germon

28 Nov 2022

PONE-D-22-24736R1

Assessment of mastitis in camel using high-throughput sequencing

Dear Dr. Rahmeh:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Pierre Germon

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Appendix

(PDF)

Click here for additional data file.^{(471.1KB, pdf)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(28.9KB, docx)}

Data Availability Statement

The high-throughput sequencing data have been deposited in the NCBI database under the Bioproject PRJNA814002.

[pone.0278456.ref001] 1.Bornstein S, Younan M. Significant veterinary research on the dromedary camels of Kenya: Past and present. J.Camelid Sci. 2013;6: 1–48. [Google Scholar]

[pone.0278456.ref002] 2.Kumar D, Verma AK, Chatli MK, Singh R, Kumar P, Mehta N, et al. Camel milk: alternative milk for human consumption and its health benefits. Nutr Food Sci. 2016. [Google Scholar]

[pone.0278456.ref003] 3.Swelum AA, El-Saadony MT, Abdo M, Ombarak RA, Hussein EOS, Suliman G, et al. Nutritional, antimicrobial and medicinal properties of Camel’s milk: A review. Saudi Journal of Biological Sciences. 2021;28: 3126–3136. doi: 10.1016/j.sjbs.2021.02.057 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref004] 4.Gossner C, Danielson N, Gervelmeyer A, Berthe F, Faye B, Kaasik Aaslav K, et al. Human–dromedary camel interactions and the risk of acquiring zoonotic Middle East respiratory syndrome coronavirus infection. Zoonoses and public health. 2016;63: 1–9. doi: 10.1111/zph.12171 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref005] 5.Faye B. The enthusiasm for camel production. Emirates Journal of Food and Agriculture. 2018: 249–250. [Google Scholar]

[pone.0278456.ref006] 6.Oikonomou G, Bicalho ML, Meira E, Rossi RE, Foditsch C, Machado VS, et al. Microbiota of cow’s milk; distinguishing healthy, sub-clinically and clinically diseased quarters. PLoS One. 2014;9: e85904. doi: 10.1371/journal.pone.0085904 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref007] 7.Hertl JA, Grohn YT, Leach JD, Bar D, Bennett GJ, Gonzalez RN, et al. Effects of clinical mastitis caused by gram-positive and gram-negative bacteria and other organisms on the probability of conception in New York State Holstein dairy cows. J Dairy Sci. 2010;93: 1551–1560. doi: 10.3168/jds.2009-2599 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref008] 8.Cervinkova D, Vlkova H, Borodacova I, Makovcova J, Babak V, Lorencova A, et al. Prevalence of mastitis pathogens in milk from clinically healthy cows. Vet Med. 2013;58: 567–575. [Google Scholar]

[pone.0278456.ref009] 9.Klaas IC, Zadoks RN. An update on environmental mastitis: Challenging perceptions. Transboundary and emerging diseases. 2018;65: 166–185. doi: 10.1111/tbed.12704 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref010] 10.Barbour EK, Nabbut NH, Frerichs WM, Al-Nakhli HM, Al-Mukayel AA. Mastitis in Camelus dromedarius in Saudi Arabia. Trop Anim Health Prod. 1985;17: 173–179. doi: 10.1007/BF02356968 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref011] 11.El Tigani-Asil, E T A, Abdelwahab GE, Veedu J T V P, Khalafalla AI, Mohamed ZSA, Ishag HZA, et al. Gangrenous mastitis in dromedary camels in UAE caused by Streptococcus agalactiae. BMC Vet Res. 2020;16: 174–8. doi: 10.1186/s12917-020-02382-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref012] 12.Abdurahman O. Udder health and milk quality among camels in the Errer valley of eastern Ethiopia. Livestock Res Rural Dev. 2006;18: 32–38. [Google Scholar]

[pone.0278456.ref013] 13.Abdurahman OA, Agab H, Abbas B, Astrom G. Relations between udder infection and somatic cells in camel (camelus dromedarius) milk. Acta Vet Scand. 1995;36: 423–431. doi: 10.1186/BF03547657 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref014] 14.Obied AI, Bagadi HO, Mukhtar MM. Mastitis in Camelus dromedarius and the somatic cell content of camels’ milk. Res Vet Sci. 1996;61: 55–58. doi: 10.1016/s0034-5288(96)90111-3 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref015] 15.Younan M, Ali Z, Bornstein S, Muller W. Application of the California mastitis test in intramammary Streptococcus agalactiae and Staphylococcus aureus infections of camels (Camelus dromedarius) in Kenya. Prev Vet Med. 2001;51: 307–316. doi: 10.1016/s0167-5877(01)00228-8 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref016] 16.Abera M, Abdi O, Abunna F, Megersa B. Udder health problems and major bacterial causes of camel mastitis in Jijiga, Eastern Ethiopia: implication for impacting food security. Trop Anim Health Prod. 2010;42: 341–347. doi: 10.1007/s11250-009-9424-6 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref017] 17.Bekele T, Molla B. Mastitis in lactating camels (Camelus dromedarius) in Afar Region, north-eastern Ethiopia. Berl Munch Tierarztl Wochenschr. 2001;114: 169–172. [PubMed] [Google Scholar]

[pone.0278456.ref018] 18.Abdel Gadir Atif E, Hildebrandt G, Kleer JN, Molla B, Kyule MN, Baumann MP. Comparison of California Mastitis Test (CMT), Somatic Cell Counts (SCC) and bacteriological examinations for detection of camel (Camelus dromedarius) mastitis in Ethiopia. Berl Munch Tierarztl Wochenschr. 2006;119: 45–49. [PubMed] [Google Scholar]

[pone.0278456.ref019] 19.Aqib AI, Muzammil I, Naseer MA, Shoaib M, Bakht P, Zaheer T, et al. Pathological insights into camel mastitis. Acta Trop. 2022: 106415. doi: 10.1016/j.actatropica.2022.106415 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref020] 20.Ahmad S, Yaqoob M, Bilal MQ, Khan MK, Muhammad G, Yang LG, et al. Factors affecting yield and composition of camel milk kept under desert conditions of central Punjab, Pakistan. Trop Anim Health Prod. 2012;44: 1403–1410. doi: 10.1007/s11250-012-0079-3 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref021] 21.Dworecka-Kaszak B, Krutkiewicz A, Szopa D, Kleczkowski M, Biegańska M. High prevalence of Candida yeast in milk samples from cows suffering from mastitis in poland. The Scientific World Journal. 2012;2012. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref022] 22.Patel SH, Vaidya YH, Patel RJ, Pandit RJ, Joshi CG, Kunjadiya AP. Culture independent assessment of human milk microbial community in lactational mastitis. Sci Rep. 2017;7: 7804–7. doi: 10.1038/s41598-017-08451-7 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref023] 23.Alebie A, Molla A, Adugna W, Tesfaye A, Ejo M. Prevalence, Isolation, Identification, and Risk Factors of Major Bacterial Cause of Camel Subclinical Mastitis. Biomed Res Int. 2021;2021: 5522331. doi: 10.1155/2021/5522331 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref024] 24.Seligsohn D, Nyman AK, Younan M, Sake W, Persson Y, Bornstein S, et al. Subclinical mastitis in pastoralist dairy camel herds in Isiolo, Kenya: Prevalence, risk factors, and antimicrobial susceptibility. J Dairy Sci. 2020;103: 4717–4731. doi: 10.3168/jds.2019-17701 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref025] 25.Geresu MA, Abera Leliso S, Liben GW. Camel Mastitis: Prevalence, Risk Factors, and Isolation of Major Bacterial Pathogens in Gomole District of Borena Zone, Southern Ethiopia. Vet Med Int. 2021;2021: 9993571. doi: 10.1155/2021/9993571 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref026] 26.Al-Dughaym AM, Fadlelmula A. Prevalence, etiology and its seasonal prevalence of clinical and subclinical camel mastitis in Saudi Arabia. British Journal of Applied Science & Technology. 2015;9: 441–449. [Google Scholar]

[pone.0278456.ref027] 27.Pal Mahendra. First Record of Camel Mastitis due to Candida albicans in Ethiopia. Indian Journal of Comparative Microbiology, Immunology and Infectious Diseases. 2015;36: 32–34. [Google Scholar]

[pone.0278456.ref028] 28.Catozzi C, Sanchez Bonastre A, Francino O, Lecchi C, De Carlo E, Vecchio D, et al. The microbiota of water buffalo milk during mastitis. PLoS One. 2017;12: e0184710. doi: 10.1371/journal.pone.0184710 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref029] 29.Taponen S, McGuinness D, Hiitio H, Simojoki H, Zadoks R, Pyorala S. Bovine milk microbiome: a more complex issue than expected. Vet Res. 2019;50: 44-y. doi: 10.1186/s13567-019-0662-y [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref030] 30.Karzis J, Donkin EF, Webb EC, Etter EM, Petzer I. Somatic cell count thresholds in composite and quarter milk samples as indicator of bovine intramammary infection status. Onderstepoort J Vet Res. 2017;84: 1–10. doi: 10.4102/ojvr.v84i1.1269 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref031] 31.Schepers AJ, Lam T, Schukken YH, Wilmink J, Hanekamp W. Estimation of variance components for somatic cell counts to determine thresholds for uninfected quarters. J Dairy Sci. 1997;80: 1833–1840. doi: 10.3168/jds.S0022-0302(97)76118-6 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref032] 32.Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJ, Holmes SP. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods. 2016;13: 581–583. doi: 10.1038/nmeth.3869 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref033] 33.Bushnell B. BBTools. 2019. Available: https://jgi.doe.gov/data-and-tools/bbtools/. [Google Scholar]

[pone.0278456.ref034] 34.Murali A, Bhargava A, Wright ES. IDTAXA: a novel approach for accurate taxonomic classification of microbiome sequences. Microbiome. 2018;6: 140–5. doi: 10.1186/s40168-018-0521-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref035] 35.Wright ES. Using DECIPHER v2.0 to Analyze Big Biological Sequence Data in R. The R Journal. 2016;8: 352–359. [Google Scholar]

[pone.0278456.ref036] 36.Parks DH, Chuvochina M, Waite DW, Rinke C, Skarshewski A, Chaumeil PA, et al. A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life. Nat Biotechnol. 2018;36: 996–1004. doi: 10.1038/nbt.4229 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref037] 37.Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 2013;41: 590. doi: 10.1093/nar/gks1219 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref038] 38.Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution. 1987;4: 406–425. doi: 10.1093/oxfordjournals.molbev.a040454 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref039] 39.Douglas GM, Maffei VJ, Zaneveld JR, Yurgel SN, Brown JR, Taylor CM, et al. PICRUSt2 for prediction of metagenome functions. Nat Biotechnol. 2020;38: 685–688. doi: 10.1038/s41587-020-0548-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref040] 40.Louca S, Doebeli M. Efficient comparative phylogenetics on large trees. Bioinformatics. 2018;34: 1053–1055. doi: 10.1093/bioinformatics/btx701 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref041] 41.Benjamini Y, Hochberg Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal statistical society: series B (Methodological). 1995;57: 289–300. [Google Scholar]

[pone.0278456.ref042] 42.Oksanen J F. Blanchet Guillaume, Friendly Michael, Kindt Roeland, Legendre Pierre, McGlinn Dan, et al. vegan: Community Ecology Package. 2018. Available: https://github.com/vegandevs/vegan. [Google Scholar]

[pone.0278456.ref043] 43.Lozupone CA, Hamady M, Kelley ST, Knight R. Quantitative and qualitative beta diversity measures lead to different insights into factors that structure microbial communities. Appl Environ Microbiol. 2007;73: 1576–1585. doi: 10.1128/AEM.01996-06 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref044] 44.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15: 550–8. doi: 10.1186/s13059-014-0550-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref045] 45.Anders S, Huber W. Differential expression analysis for sequence count data. Nature Precedings. 2010: 1. doi: 10.1186/gb-2010-11-10-r106 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref046] 46.Cao Y. microbiomeMarker: Microbiome biomarker analysis. 2020. Available: https://github.com/yiluheihei/microbiomeMarker. [Google Scholar]

[pone.0278456.ref047] 47.Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, et al. Metagenomic biomarker discovery and explanation. Genome Biol. 2011;12: R60–r60. doi: 10.1186/gb-2011-12-6-r60 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref048] 48.Chow J, Mazmanian SK. A pathobiont of the microbiota balances host colonization and intestinal inflammation. Cell Host Microbe. 2010;7: 265–276. doi: 10.1016/j.chom.2010.03.004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref049] 49.Chow J, Tang H, Mazmanian SK. Pathobionts of the gastrointestinal microbiota and inflammatory disease. Curr Opin Immunol. 2011;23: 473–480. doi: 10.1016/j.coi.2011.07.010 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref050] 50.Vayssier-Taussat M, Albina E, Citti C, Cosson JF, Jacques MA, Lebrun MH, et al. Shifting the paradigm from pathogens to pathobiome: new concepts in the light of meta-omics. Front Cell Infect Microbiol. 2014;4: 29. doi: 10.3389/fcimb.2014.00029 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref051] 51.Stecher B, Denzler R, Maier L, Bernet F, Sanders MJ, Pickard DJ, et al. Gut inflammation can boost horizontal gene transfer between pathogenic and commensal Enterobacteriaceae. Proc Natl Acad Sci U S A. 2012;109: 1269–1274. doi: 10.1073/pnas.1113246109 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref052] 52.Delgado S, Arroyo R, Jimenez E, Marin ML, del Campo R, Fernandez L, et al. Staphylococcus epidermidis strains isolated from breast milk of women suffering infectious mastitis: potential virulence traits and resistance to antibiotics. BMC Microbiol. 2009;9: 82–82. doi: 10.1186/1471-2180-9-82 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref053] 53.Kuehn JS, Gorden PJ, Munro D, Rong R, Dong Q, Plummer PJ, et al. Bacterial community profiling of milk samples as a means to understand culture-negative bovine clinical mastitis. PLoS One. 2013;8: e61959. doi: 10.1371/journal.pone.0061959 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref054] 54.Bhanderi BB, Jhala MK, Ahir VB, Bhatt VD, Joshi CG. Cultural and metagenomic based identification of a microbiome from subclinical mastitis in cows. Veterinarski arhiv. 2014;84: 215–228. [Google Scholar]

[pone.0278456.ref055] 55.Alegria A, Szczesny P, Mayo B, Bardowski J, Kowalczyk M. Biodiversity in Oscypek, a traditional Polish cheese, determined by culture-dependent and -independent approaches. Appl Environ Microbiol. 2012;78: 1890–1898. doi: 10.1128/AEM.06081-11 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref056] 56.Callon C, Duthoit F, Delbes C, Ferrand M, Le Frileux Y, De Cremoux R, et al. Stability of microbial communities in goat milk during a lactation year: molecular approaches. Syst Appl Microbiol. 2007;30: 547–560. doi: 10.1016/j.syapm.2007.05.004 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref057] 57.Bouchard DS, Seridan B, Saraoui T, Rault L, Germon P, Gonzalez-Moreno C, et al. Lactic Acid Bacteria Isolated from Bovine Mammary Microbiota: Potential Allies against Bovine Mastitis. PLoS One. 2015;10: e0144831. doi: 10.1371/journal.pone.0144831 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref058] 58.Klostermann K, Crispie F, Flynn J, Ross RP, Hill C, Meaney W. Intramammary infusion of a live culture of Lactococcus lactis for treatment of bovine mastitis: comparison with antibiotic treatment in field trials. J Dairy Res. 2008;75: 365–373. doi: 10.1017/S0022029908003373 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref059] 59.Du J, Wang X, Luo H, Wang Y, Liu X, Zhou X. Epidemiological investigation of non-albicans Candida species recovered from mycotic mastitis of cows in Yinchuan, Ningxia of China. BMC veterinary research. 2018;14: 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref060] 60.Abo Hashem M, Ibrahim S, Goda AS, Enany M. Diversity of Microorganisms Associated to She Camels’ Subclinical and Clinical Mastitis in South Sinai, Egypt. Suez Canal Veterinary Medical Journal.SCVMJ. 2020;25: 307–319. [Google Scholar]

[pone.0278456.ref061] 61.Hasan KAM, Yassein SN. Prevalence and type of fungi in milk from goats with sub clinical mastitis. Online Journal of Veterinary Research. 2018;22: 669–674. [Google Scholar]

[pone.0278456.ref062] 62.Carmo Priscila Maria Silva do, Uzal FA, Pedroso PM, Riet-Correa F. Conidiobolomycosis, cryptococcosis, and aspergillosis in sheep and goats: a review. Journal of Veterinary Diagnostic Investigation. 2020;32: 826–834. doi: 10.1177/1040638720958338 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0278456.ref063] 63.Jensen HE, De Los Monteros, Espinosa A, Carrasco L. Caprine mastitis due to aspergillosis and zygomycosis: a pathological and immunohistochemical study. J Comp Pathol. 1996;114: 183–191. doi: 10.1016/s0021-9975(96)80007-7 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref064] 64.Enany ME, EL-Attar AA, Khafagy A, EL-Gammal AM. Bacterial and mycotic causes of subclinical bovine mastitis. Suez Canal Veterinary Medicine Journal. 2007;12: 107–133. [Google Scholar]

[pone.0278456.ref065] 65.Anueyiagu KN, Audu SK, Joshua BD, Pelumi OE, Haji SA. Prevalence and antibiogram of coliform bacteria, and occurrence of fungi in subclinical mastitis in small ruminants in Plateau State, Nigeria. Journal of Animal Science and Veterinary Medicine. 2020;5: 83–91. [Google Scholar]

[pone.0278456.ref066] 66.Vacheyrou M, Normand AC, Guyot P, Cassagne C, Piarroux R, Bouton Y. Cultivable microbial communities in raw cow milk and potential transfers from stables of sixteen French farms. Int J Food Microbiol. 2011;146: 253–262. doi: 10.1016/j.ijfoodmicro.2011.02.033 [DOI] [PubMed] [Google Scholar]

[pone.0278456.ref067] 67.Alreshidi MM, Veettil VN, Noumi E, Del Campo R, Snoussi M. Description of microbial diversity associated with ticks Hyalomma dromedarii (Acari: Ixodidae) isolated from camels in Hail region (Saudi Arabia) using massive sequencing of 16S rDNA. Bioinformation. 2020;16: 602. doi: 10.6026/97320630016602 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Assessment of mastitis in camel using high-throughput sequencing

Rita Rahmeh

Abrar Akbar

Husam Alomirah

Mohamed Kishk

Abdulaziz Al-Ateeqi

Anisha Shajan

Thnayan Alonaizi

Alfonso Esposito

Roles

Abstract

Introduction

Materials and methods

Sample collection

DNA extraction

Amplification of the 16S V3‒V4 and ITS2 regions and sequencing

Bioinformatics processing

Statistical analysis

Results

Sequencing summary

Camel milk microbiota in healthy and mastitis milk samples

Table 1. Relative abundance of bacterial population in healthy and mastitis camel milk at phylum level for 16S rRNA.

Fig 1. Taxon frequencies (percent of total sample counts) of the most dominant bacterial population in healthy and mastitis camel milk summarized at the phylum level for the 16S rRNA.

Table 2. Relative abundance of bacterial population in healthy and mastitis camel milk at genus level for 16S rRNA.

Fig 2. Taxon frequencies (percentage of total sample counts) of the most dominant bacterial population in healthy and mastitis camel milk summarized at the genus level for the 16S rRNA.

Table 3. Lefse marker table at taxonomic level for healthy and mastitis samples for 16S rRNA.

Fig 3. Effect size and statistical significance of the top ten marker per sample group corresponding to healthy and mastitis samples for the 16S rRNA.

Fig 4. Cladogram of the top ten marker taxa per sample group corresponding to healthy and mastitis samples for the 16S rRNA.

Fig 5. Taxon frequencies (percentage of total sample counts) of the most dominant bacterial population in healthy and mastitis camel milk summarized at the phylum level for the ITS.

Table 4. Relative abundance of fungal population in healthy and mastitis camel milk at phylum level for ITS.

Table 5. Relative abundance of fungal population in healthy and mastitis camel milk at genus level for ITS.

Fig 6. Taxon frequencies (percentage of total sample counts) of the most dominant bacterial population in healthy and mastitis camel milk summarized at the genus level for the ITS.

Table 6. Lefse marker table at taxonomic level for healthy and mastitis samples for ITS.

Fig 7. Effect size and statistical significance of the top ten marker per sample group corresponding to healthy and mastitis samples for the ITS.

Fig 8. Cladogram of the top ten marker taxa per sample group corresponding to healthy and mastitis samples for the ITS.

Microbial richness and diversity in healthy and mastitis milk samples

Table 7. Median alpha diversity measures by sample group for healthy and mastitis milk samples for 16S rRNA.

Fig 9. Distribution of alpha diversity measures in relation to sample groups for the 16S rRNA.

Fig 10. Distribution of alpha diversity measures in relation to sample groups for the ITS.

Fig 11.

Fig 12. PCoA visualizations on both unweighted and weighted UniFrac dissimilarities corresponding to healthy and mastitis samples.

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Pierre Germon

Roles

Author response to Decision Letter 0

Decision Letter 1

Pierre Germon

Roles

Acceptance letter

Pierre Germon

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases