Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Jan 1.
Published in final edited form as: Ticks Tick Borne Dis. 2022 Nov 9;14(1):102080. doi: 10.1016/j.ttbdis.2022.102080

Prevalence of Bourbon and Heartland viruses in field collected ticks at an environmental field station in St. Louis County, Missouri, USA

Ishmael D Aziati a, Derek McFarland Jnr b, Avan Antia c, Astha Joshi a, Anahi Aviles-Gamboa b, Preston Lee a, Houda Harastani a, David Wang c,d, Solny A Adalsteinsson b, Adrianus C M Boon a,c,d,*
PMCID: PMC9729426  NIHMSID: NIHMS1849829  PMID: 36375268

Abstract

Heartland and Bourbon viruses are pathogenic tick-borne viruses putatively transmitted by Amblyomma americanum, an abundant tick species in Missouri. To assess the prevalence of these viruses in ticks, we collected 2778 ticks from eight sampling sites at Tyson Research Center, an environmental field station within St. Louis County and close to the City of St. Louis, from May - July in 2019 and 2021. Ticks were pooled according to life stage and sex, grouped by year and sampling site to create 355 pools and screened by RT-qPCR for Bourbon and Heartland viruses. Overall, 14 (3.9%) and 27 (7.6%) of the pools were positive for Bourbon virus and Heartland virus respectively. In 2019, 11 and 23 pools were positive for Bourbon and Heartland viruses respectively. These positives pools were of males, females and nymphs. In 2021, there were 4 virus positive pools out of which 3 were positive for both viruses and were comprised of females and nymphs. Five out of the 8 sampling sites were positive for at least one virus. This included a site that was positive for both viruses in both years. Detection of these viruses in an area close to a relatively large metropolis presents a greater public health threat than previously thought.

Keywords: Bourbon virus, Heartland virus, Amblyomma americanum, emerging tick-borne diseases, RT-qPCR

INTRODUCTION

Emerging infectious diseases (EIDs) have become an increasing global concern in the twenty-first century; their emergence and spread pose a significant threat to global health and economies (Sabin et al. 2020). From an extensive review of the literature for EID events between 1940 and 2004, the majority (60.3%) were caused by zoonotic pathogens. Remarkably, the second (22.8%) most important category was infections caused by vector-borne diseases (Jones et al. 2008). Vector-borne infections are an important cause of morbidity and mortality with mosquitoes being responsible for most of the cases worldwide. In the United States (US) however, ticks are the leading disease vector accounting for over 90% of the annual vector-borne cases with Lyme disease being the most commonly reported (Eisen et al. 2017; Rodino, Theel, and Pritt 2020b; Rosenberg et al. 2018). Ticks are blood-sucking arthropods that are competent vectors of a wide range of vertebrate pathogens including viruses (Rodino, Theel, and Pritt 2020a; Tokarz and Lipkin 2020). Substantial geographic expansions of tick populations have been revealed by tick surveys throughout the US, and tick species like the lone star tick (Amblyomma americanum) have expanded their range in the US in recent decades (Sonenshine 2018; Molaei et al. 2019). This three-host tick is predominantly found in wooded areas especially in the presence of dense underbrush (Hair and Howell 1970). We and others have also shown that habitats with high abundances of exotic invasive species such as bush honeysuckle (L. maacki) have a positive correlation to tick abundance (Adalsteinsson et al. 2016; Van Horn et al. 2018). A. americanum is distributed from west-central Texas to the Atlantic Coast and northward all the way to Maine, a boundary that was first reported only a decade ago, indicating an expansion of what was previously documented. Adult A. americanum ticks feed on medium and large-sized mammals, and the larvae and nymphs parasitize on a wide variety of small to large mammals and ground-feeding birds (Cooley and Kohls 1944). All three motile life stages bite humans. They are not evenly distributed in nature, with high numbers occurring in relatively small geographic areas. These high population densities coupled with its aggressive and mostly non-specific feeding habitats makes A. americanum ticks one of the most economically important ticks in the United States (Goddard and Varela-Stokes 2009). A. americanum is responsible for the continuous emergence and spread of tick-borne diseases like ehrlichiosis, tularemia and STARI (Rodino, Theel, and Pritt 2020b). Aside from these, field isolations and laboratory studies have implicated the A. americanum tick as the putative vector of Heartland virus (HRTV) and Bourbon virus (BRBV), two tick-borne viruses discovered in the US in the last decade (Bosco-Lauth et al. 2016; Brault et al. 2018; Lambert et al. 2015; Newman et al. 2020; Savage, Godsey, Panella, et al. 2018; Savage, Godsey, Tatman, et al. 2018). HRTV and BRBV were first isolated from febrile patients in Missouri (MO) and Kansas (KS) respectively, who reported histories of tick bites (Kosoy et al. 2015; McMullan et al. 2012). Since the discovery of these new tick-borne viruses, about 50 HRTV and 5 BRBV infections have been confirmed in human cases of febrile illness with sometimes fatal outcome across the US (Savage et al. 2017; Bricker et al. 2019; Brault et al. 2018). Similarly, these viruses have been detected in field collected A. americanum ticks, along with serological evidence of infection in wildlife in the Midwest and Eastern US states (Newman et al. 2020; Dupuis et al. 2021; Tuten et al. 2020; Jackson et al. 2019a; Savage et al. 2017; Savage, Godsey, Panella, et al. 2018; Savage, Godsey, Tatman, et al. 2018).

BRBV is a segmented RNA virus that belongs to the family Orthomyxoviridae and the genus Thogotovirus. Members of this genus have been shown to be distributed worldwide but not until recently in the US (Savage et al. 2017; Kosoy et al. 2015; Lambert et al. 2015; Savage, Godsey, Panella, et al. 2018). BRBV is the first Thogotovirus discovered in North America that is known to infect humans. Three other members of this genus, Thogotovirus, Oz virus and Dhori virus, which have not been found in the US, have been associated with human disease (Butenko et al. 1987; Frese et al. 1995; Tran et al. 2022). HRTV is also a segmented RNA virus that belongs to the family Phenuiviridae: genus Bandavirus (Savage et al. 2016; Sun et al. 2022). It is genetically closely related to Dabie bandavirus, a virus that was first identified in China in 2009 and later reported in Japan and South Korea (Brault et al. 2018; Liu et al. 2014).

The prevalence of BRBV and HRTV in field collected ticks has only been reported in the rural northwestern part of Missouri, with no peer-reviewed published reports from the other parts of the state. As part of a broader study aimed at an integrated vector-animal-human surveillance for known and novel tick-borne viruses, we tested the prevalence of BRBV and HRTV in field collected ticks from Tyson Research Center in Missouri, which is an environmental field station that is known to have abundant host-seeking A. americanum ticks as well as co-mingling of vectors and different animal hosts (Van Horn et al. 2018). We determined the prevalence of HRTV and BRBV by RT-qPCR in A. americanum sampled in 2019 and 2021 and report for the first time the surveillance and detection of these viruses in an area close to a relatively large metropolitan area.

MATERIALS AND METHODS

Study Area.

Tyson Research Center (TRC) is the ~800-ha environmental field station of Washington University in St. Louis, situated ~20 km southwest of the city of St. Louis, Missouri, US within the adjacent St. Louis County (38°31′N, 90°33′W). With the exception of an interstate to its southern edge, TRC is surrounded by protected lands that are popular with outdoor recreationists. TRC is located in the northeastern edge of the Ozark ecoregion and is ~85% forested, consisting of mainly deciduous oak-hickory forest on steep slopes and ridges. South-facing slopes tend to be dominated by chinquapin oak (Quercus muehlenbergii) and eastern red cedar (Juniperus virginiana); protected slopes by flowering dogwood (Cornus florida), white oak (Q. alba), and black oak (Q. velutina); and bottomlands by slippery elm (Ulmus rubra) and American sycamore (Plantanus occidentalis) (Kensinger and Allan 2011). Forest understory contains areas of woody shrubs including spicebush (Lindera benzoin), common buckthorn (Frangula caroliniana), and pawpaw (Asimina triloba). In all habitat types there are significant and patchy areas of Amur honeysuckle (Lonicera maackii) invasion, some of which are under ongoing management. TRC also maintains open old field habitat in its central valley and has ~24 ha of limestone/dolomite glades that are heavily invaded by red cedar. Prior to its acquisition by Washington University in St. Louis, TRC land has been used for: mining (at Mincke Quarry), logging, grazing livestock, habitation of a small village (now only ruins/building foundations remain in Mincke Valley), and construction of dozens of bunkers (which remain along the central valley) for munitions storage by the US Military. Amblyomma americanum is the most commonly-encountered tick species at TRC; Dermacentor variabilis and Ixodes scapularis are also present (Van Horn et al. 2018)

Tick Collection and Identification.

Ticks were collected between May and July in 2019 and 2021 from eight different locations within TRC. These included Bunker 51, Bunker 37, Bat Road, Library Road, North Gate, Mincke Quarry, Mincke Valley and Plot 7/8 (Figure 2b). The first five sampling locations are in the central valley and are characterized by vegetation typical of TRC protected slopes and/or bottomland forest, as described above. North Gate has extensive L. maackii invasion and is distinct from the other valley locations for its close proximity to the Meramec River. Mincke Quarry has been modified by mining activities and has mostly shallow soils, exposed slopes, J. virginiana and L. maackii invasion. Mincke Valley contains remnants of old building foundations but is otherwise closed-canopy oak-hickory forest with understory dominated by A. triloba and L. maackii. Plot 7/8 is on a steep west-facing slope dominated by oak-hickory forest. Ticks were captured using a combination of standard drag sampling, flagging, and dry ice trapping methods, as previously described (Savage et al. 2013).

Figure 2: Number of ticks collected in study, grouped according life stage and sex.

Figure 2:

Open in a new tab

Number of ticks collected in study, grouped according life stage and sex in 2019) Figure 2a (left panel) and 2021 (right panel). Figure 2b Positivity of BRBV and HRTV by location during 2019 and 2021 collections. Map of TRC showing 8 approximate tick sampling locations during 2019 and 2021 sampling seasons. In 2019, the locations sampled were Bunker 51, Bat Road, Bunker 37, North Gate, Mincke Quarry and Library Road. In 2021, we sampled all 2019 locations except Bunker 37, and two new locations – Mincke Valley and Plot 7/8. The pie charts represent the number of pools positive for BRBV (blue), HRTV (red), BRBV & HRTV (purple), or negative (grey), and the geographical location of these virus positive pools. The tick pool number is shown inside the pie charts. The black outline shows the TRC property boundary and gray lines depict paved and gravel roads within TRC property. The insert map is that of US State of Missouri with the location of TRC (black dot) relative to Kansas City, and St. Louis city. Maps were created using ArcGIS Pro v2.8 (‘Citation: ESRI 2021. ArcGIS Pro version 2.8. Redlands, CA: Environmental Systems Research Institute’) with included area basemap and spatial data collected at TRC.

Field collected ticks were transported alive to the TRC laboratory and frozen at −80°C. There, ticks were identified and sorted according to species, sex, and life stage on a cold tray under a dissecting microscope using taxonomic keys (Keirans and Durden 1998; Keirans and Litwak 1989). Ticks were then grouped into pools (up to n = 5 for adult ticks and n = 25 for nymphs) by location, sampling date, species, sex and life stage. The pools were stored at −80°C and transported on dry ice to Washington University School of Medicine for further processing.

RNA Extraction and Virus Detection.

1.0 mL of cold Trizol reagent was added (Invitrogen, cat # 15596018) to a 2 mL homogenization tube containing three stainless steel beads and the pooled ticks. For every five pools, we added a negative control tube (without ticks) as a control for cross contamination. The six tubes were then placed in the TissueLyser II (Qiagen Cat. No. / ID: 85300) and run at 30 Hz (1800 oscillations/minute) at 30 secs interval until ticks were well homogenized. The homogenates were then subjected to RNA extraction using the manufacturer’s protocol. The extracted RNA was stored at −80°C until ready to be used. The samples were screened separately in a one-step RT-qPCR for the presence of BRBV and HRTV viral RNA. We used published primers and probes targeting BRBV nucleoprotein (BRBV NP) (Lambert et al. 2015) and HRTV small non-structural protein (HRTV NSs) (Savage et al. 2013) as screening primers (Table 1). Confirmatory primer probe sets targeting different genes (BRBV PB1 and HRTV NP) (Table 1) of the viruses were used to re-test the positive pools. A de novo A. americanum tick 16S mitochondrial rRNA (Tick 16S) primer/probe was used as internal control which served as an indicator for successful tick homogenization and RNA extraction. An experiment (sets of 5 samples plus 1 negative control) was considered valid if the negative control (samples extracted without ticks) had a Ct value of undetermined, and pools were scored as positive if it had a Ct value equal to or less than 35 (Ct ≤ 35) for both 16S and virus-specific primers.

Table 1:

Real-time PCR primer/probes for the detection of BRBV, HRTV and tick 16S rRNA

Gene Fwd Primer Sequence Probe Sequence Rev. Primer Sequence Reference
BRBV NP GCAAGAAGAGGCCAGATTTC CCTCACACCACGGAAGCTGGG TCGAATTCGGCATTCAGAGC Lambert et. al. 2015
HRTV NSs TGCAGGCTGCTCATTTATTC CCTGACCTGTCTCGACTGCCCA CCTGTGGAAGAAACCTCTCC Savage et. al. 2013
Tick 16S ACTCTAGGGATAACAGCGTAATAA TGCGACCTCGATGTTGGATTAGGA CTGAACTCAGATCAAGTAGGACA This study
Confirmatory Primer/Probes
BRBV PB1 AACCGAAGGACCATTGCTAC ACCCTTGCTGCATCTTCCACCA ACAGGGACTCCAGAACTTGG Lambert et. al. 2015
HRTV NP CCTTTGGTCCACATTGATTG TGGATGCCTATTCCCTTTGGCAA CACTGATTCCACAGGCAGAT Savage et. al. 2013
Open in a new tab

Quantification by real-time RT-qPCR.

In vitro transcribed RNAs encompassing the BRBV NP, HRTV NSs, and Tick 16S target sequences were used to define the efficiency and limit of detection of the assay and quantify the number of genome copies per sample. Standards were diluted to obtain 2.5 × 107 RNA copies/μL and this was 10-fold serially diluted to 0.025 copies/μL. 4 μL of the diluted standards was used to generate standard curves in a quantitative RT-PCR (RT-qPCR) employing the following conditions; 48 °C for 15 min, 95 °C for 10 min, (95 °C for 15 s, 60 °C for 1 min) X 50 cycles on the QuantStudio 6 flex Real-time PCR system (Applied Biosystems), using the TaqMan RNA-to-CT 1-step kit (Applied Biosystems).

Maximum likelihood Estimate (MLE) of Infection Rate (IR).

Maximum likelihood estimate (MLE) of the infection prevalence per 1,000 ticks at 95% confidence intervals (CIs) for the infection rate were computed using the Excel Add-In (Biggerstaff 2006).

RESULTS

Evaluation of RT-qPCR primers and probes for BRBV and HRTV.

To define the sensitivity of these primers, we used serial dilutions of the in vitro transcribed target RNA sequences standard as template and reliably detected 10 RNA copies in the reaction at an average Ct value of 36 for BRBV NP and 16S primer/probe sets, and 35 for HRTV S (Figure 1a). In order to mimic physiological conditions and to determine the presence of RT-qPCR inhibitors in the tick homogenates, we spiked RNA extracted from a BRBV/HRTV-negative tick pool with our RNA standard and generated a standard curve as above and still detected 10 RNA copies at an average Ct value of 36 for BRBV NP and 16S and 35 for HRTV S (Figure 1b), suggesting that RNA from homogenized ticks does not inhibit the RT-qPCR reaction. Based on this data, we set the cut off Ct value for a positive sample at ≤ 35.

Figure 1: Sensitivity of Primer/Probes in detecting in vitro transcribed RNA Standard.

Figure 1:

Open in a new tab

The primer/probe sets 16S (Left), BRBV NP (Middle) and HRTV NSs (Right) were used to generate a standard curve in RT-qPCR using a 10 fold serially diluted in vitro transcribed RNA as template (a) or tick RNA spiked with in vitro transcribed RNA (b).

Tick collection.

Ticks were collected in 2019 (n = 1556) and in 2021 (n = 1222) from eight different locations at TRC. A. americanum accounted for nearly 99.4% of the collected ticks at TRC in both 2019 and 2021 collections. The remaining 0.6% were Dermacentor variabilis. In the 2019 collection, 29% of A. americanum ticks were adult males, 33% were adult females, and 38% were nymphs. In the 2021 collection, 11% were adult males, 16% were adult females, 13% larva, and 60% were nymphs (Figure 2a).

Detection of BRBV and HRTV in Ticks.

In 2019, 11 and 23 pools out of the 193 tested were BRBV and HRTV positive respectively. Seven of the BRBV positive pools were from Bunker 51 and ticks were collected on the 23rd of May, and the remaining 4 BRBV positive pools were made up of ticks collected on the 10th of June at North Gate. Of the 11 BRBV positive pools, 8 were pools of adult males, 2 of adult females and 1 of nymphs. Of the 23 HRTV positive pools, 21 were from North Gate and one each from Library Road and Bat Road collected on the 10th, 3rd and 4th of June respectively. The HRTV positive pools included 20 pools of adult males, 1 of adult females and 2 of nymphs (Figure 2b, Table 2). The infection rates (IRs) for A. americanum among the virus positive locations for BRBV were 7.0 (CI = 2.3 - 16.7) for North Gate and 80.6 (CI = 36.5 – 155.4) for Bunker 51. The HRTV IRs were, 39.5 (CI = 26.6 – 57.2) for North Gate, 8.1 (CI = 0.47 – 38.6) for Bat Road, and 2.8 (CI = 0.16 – 13.7) for Library Road. We also calculated IRs of BRBV and HRTV in the ticks by life stage and sex. The BRBV and HRTV IRs for all adults (male and female) A. americanum were 10.5 (5.4 – 18.5) and 22.6 (14.6 – 33.6) respectively. The BRBV IRs for A. americanum adult male, adult female and nymph in the entire 2019 collection were 18.3 (8.6 – 34.5), 3.8 (0.70 – 12.5) and 1.7 (0.10 – 8.3) respectively. HRTV IRs were 48.8 (31.0 – 73.4), 1.9 (0.1 – 9.2) and 3.4 (0.6 – 11.4) for male, female and nymph respectively.

Table 2:

Information on the virus positive pools in the 2019 collection

Male Female Nymph Total
Location HRTV + BRBV + # pools HRTV + BRBV + # pools HRTV + BRBV + # pools # + pools # pools
Bunker 51 0 6 11 0 1 9 0 0 0 7 20
Bat Road 1 0 13 0 0 13 0 0 0 1 26
Bunker 37 0 0 7 0 0 5 0 0 3 0 15
North Gate 19 2 27 1 1 25 1 1 12 *21 64
Mincke Quarry 0 0 6 0 0 1 0 0 4 0 11
Library Road 0 0 27 0 0 26 1 0 4 1 57
Total pools 20 8 91 1 2 79 2 1 23 30 193
Indv. Ticks 450 516 590 1556
Open in a new tab
*

4 pools were positive for both Bourbon and Heartland viruses

In 2021, there were four virus positive pools out of a total of 162 tested. One pool was HRTV positive and the remaining three were positive for both viruses. The virus positive pools were from three locations: Bunker 51 (1/4); North Gate (2/4); and Mincke Quarry (1/4) (Figure 2b & Table 3). The ticks were collected on 4th of June and 9th of July. The IRs of BRBV in ticks by life stage and sex were 10.3 (1.85 – 33.2) for adult female, 1.3 (0.008 – 6.5) for nymph, and zero for adult male and larvae. The IRs for HRTV in all adults (male and female) A. americanum were 6.0 (1.0 – 19.6) and 2.7 (0.5 – 8.9) for nymphs.

Table 3:

Information on the virus positive pools in the 2021 collection

Male Female Nymph Larva Total
Location HRTV + BRBV + # pools HRTV + BRBV + # pools HRTV + BRBV + # pools HRTV + BRBV + # pools # + pools # pools
Bunker 51 0 0 12 0 0 21 1 0 19 0 0 0 1 52
Bat Road 0 0 5 0 0 7 0 0 4 0 0 0 0 16
North Gate 0 0 2 1 1 2 1 1 3 0 0 0 *2 7
Mincke Quarry 0 0 6 1 1 4 0 0 8 0 0 9 *1 27
Library Road 0 0 6 0 0 5 0 0 1 0 0 0 0 12
Plot 7/8 0 0 4 0 0 10 0 0 13 0 0 0 0 27
Mincke Valley 0 0 5 0 0 6 0 0 10 0 0 0 0 21
Total pools 0 0 40 2 2 55 2 1 58 0 0 9 4 162
Indv. Ticks 135 196 729 162 1222
Open in a new tab
*

3 pools were positive for both Bourbon and Heartland viruses

The BRBV IRs for A. americanum adult male, adult female and nymph in the entire study (2019 & 2021) were 14.0 (6.6 – 26.4), 5.6 (1.8 – 13.4) and 1.5 (0.2 – 4.9) respectively and for HRTV for the same period were 36.7 (23.2 – 55.3), 4.2 (1.1 – 11.3) and 3.1 (1.0 – 7.4).

The Ct value for the positive pools ranged from 24.58 – 34.65 corresponding to 6.6 × 104 – 67 RNA copies for BRBV and 23.05 – 35.04 corresponding to 2.0 × 104 – 5.6 RNA copies for HRTV.

To validate and confirm our results, twelve BRBV positive pools were re-tested with a primer probe set specific for a different gene of BRBV (PB1). All 12 samples also tested positive for BRBV PB1 with similar Ct values compared to the BRBV NP RT-qPCR. We also re-tested 20 HRTV-positive pools with a primer probe set that targets the NP gene of HRTV. Over 75% (16/20) of the positive pools were also HRTV positive with the second primer probe set.

DISCUSSION

In this study, we report a high prevalence of BRBV and HRTV viruses in field collected ticks at an environmental field station in the eastern-central part of MO at the edge of the St. Louis metropolitan area. A total of 2778 ticks were collected between May - July of 2019 and 2021, and we detected BRBV and HRTV viral RNA in tick homogenates by RT-qPCR. Thirty-four RT-qPCR virus-positive pools were obtained from five of the eight sampled locations (Figure 2b) and were composed of adult (male and female) and nymphal A. americanum ticks.

Detection of HRTV and BRBV in adult and nymphal A. americanum ticks in our study is consistent with prior studies (Savage et al. 2017; Savage et al. 2013; Savage et al. 2016; Savage, Godsey, Panella, et al. 2018; Savage, Godsey, Tatman, et al. 2018) and support the notion that A. americanum is a vector for HRTV and BRBV to humans. The fact that viruses were detected in both nymphal and adult stages exhibiting host-seeking behavior suggest that both life stages could potentially transmit the virus to humans. Host-seeking nymph and adult A. americanum ticks, likely acquire the virus during co-feeding with other infected ticks or by feeding on viremic vertebrate hosts. Transmission could be transstadial, from infected nymphs to adults or from larvae to nymphs, although screening 162 larvae (the life stage with the smallest sample size in our study), did not result in the detection of virus (Godsey et al. 2021; Godsey et al. 2016).

BRBV and HRTV were detected at North Gate in adult and nymphal A. americanum for both years in our study (Figure 2b, Tables 2 & 3) suggesting that these viruses are maintained in the tick and/or host populations in this area of TRC and that an overlap in BRBV and HRTV transmission cycles exist at this location.

Increase in HRTV incidence compared to BRBV in our study is similar to previous studies performed in Northwestern Missouri (Savage et al. 2017; Savage et al. 2013; Savage et al. 2016) and Kansas (Savage, Godsey, Panella, et al. 2018; Savage, Godsey, Tatman, et al. 2018). Differences in transstadial, co-feeding, and transovarial transmission rates between HRTV and BRBV may contribute to this. Studies by Godsey (Godsey et al. 2021; Godsey et al. 2016) and colleagues showed that transstadial and co-feeding are the main routes of transmissions for BRBV with infection rates between 50-100%. Transovarial transmission of BRBV was observed in 5-12% of the ticks. In contrast, transovarial and transstadial transmissions of HRTV were 22-40% while co-feeding transmission was 0.2%. These results indicate that transovarial transmission of HRTV is more efficient and less dependent on co-feeding on a virus-infected host compared to BRBV, which could favor a higher prevalence of HRTV in ticks. Alternatively, differences in seroprevalence and host species between BRBV and HRTV (Riemersma and Komar 2015; Jackson et al. 2019b) may contribute to a higher incidence of HRTV in ticks.

We observed a higher prevalence of BRBV and HRTV in ticks in our study compared to previous studies performed in and around Missouri (Savage et al. 2017; Savage et al. 2013; Savage et al. 2016; Savage, Godsey, Panella, et al. 2018; Savage, Godsey, Tatman, et al. 2018; Tuten et al. 2020; Dupuis et al. 2021; Newman et al. 2020). We believe that this high incidence is valid and not caused by methodological biases. First, we included one negative control sample for every five tick pools and all of the negative controls had Ct values that were undetermined (Ct > 50). Second, the presence of HRTV or BRBV RNA in virus-positive pools were confirmed by another investigator in the lab and by a second primer probe set against a different viral gene. Third, HRTV and BRBV positive samples were processed and tested on different days and years of the study, further reducing the possibility that these samples were contaminated. That said, we were also surprised by the high infection rates in our study. One possible explanation is that we sampled fewer ticks in a relative small area compared to other studies, and that we were fortunate to sample a site (North Gate) with very high incidence of HRTV and BRBV, increasing the overall infection rate of the study. Varied infection rates among collection sites and between collection years has been reported by others (Savage et al. 2017; Savage et al. 2013; Savage et al. 2016; Savage, Godsey, Panella, et al. 2018; Savage, Godsey, Tatman, et al. 2018).

A limitation of our study is the heterogeneity in sampling depth per location. In addition, because the whole tick was homogenized in Trizol for RNA purification, we could not culture live virus from these homogenates.

In conclusion, the infection rates per 1000 ticks varied among collection sites, life stages, sex, and between collection years. Additional tick collection efforts combined with animal and human sero-surveillance is important in gaining a deeper understanding of the environmental determinants of vector positivity and risk of exposure of these emerging viruses to humans in the US.

ACKNOWLEDGEMENTS

We thank the following TRC technicians and undergraduate and high school research fellows for their assistance with tick collection and identification: Althea Bartz, Eleanor Hohenberg, Elise Nishikawa, Rachel Novick, Elora Robeck, Rossana Romo, Laura Tayon, Christopher Tomera, Will Slatin, Angela Yokley. We thank TRC for support and Susan Flowers for running the research fellowship programs. This study was supported with U01-AI151810 and R21-AI151170 grants to ACMB and a Living Earth Collaborative seed grant to SAA, ACMB, and DW.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

CREDIT AUTHOR STATEMENT

Ishmael D Aziati: Conceptualization, Methodology, Validation, Formal analysis, Investigation, Data curation and Writing-original draft

Derek McFarland: Investigation, Methodology

Avan Antia: Investigation, Writing-review & editing

Astha Joshi: Investigation,

Anahi Aviles Gamboa: Investigation

Preston Lee: Investigation,

Houda Harastani: Methodology

David Wang: Supervision, Conceptualization, Resources, Funding acquisition, Project administration, Writing-review & editing

Solny Adalsteinsson: Supervision, Conceptualization, Formal analysis, Funding acquisition, Project administration, Writing-review & editing

Adrianus C. M. Boon: Conceptualization, Data curation, Supervision, Formal analysis, Funding acquisition, Project administration, Writing-review & editing

REFERENCES

  1. Adalsteinsson SA, D’Amico V, Shriver WG, Brisson D, and Buler JJ. 2016. ‘Scale-dependent effects of nonnative plant invasion on host-seeking tick abundance’, Ecosphere, 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Biggerstaff BJ. 2006. ‘PooledInfRate, Version 3.0: a Microsoft Excel Add-In to compute prevalence estimates from pooled samples’, Centers for Disease Control and Prevention, Fort Collins, CO. [Google Scholar]
  3. Bosco-Lauth AM, Calvert AE, Root JJ, Gidlewski T, Bird BH, Bowen RA, Muehlenbachs A, Zaki SR, and Brault AC. 2016. ‘Vertebrate Host Susceptibility to Heartland Virus’, Emerg Infect Dis, 22: 2070–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Brault AC, Savage HM, Duggal NK, Eisen RJ, and Staples JE. 2018. ‘Heartland Virus Epidemiology, Vector Association, and Disease Potential’, Viruses, 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bricker TL, Shafiuddin M, Gounder AP, Janowski AB, Zhao G, Williams GD, Jagger BW, Diamond MS, Bailey T, Kwon JH, Wang D, and Boon ACM. 2019. ‘Therapeutic efficacy of favipiravir against Bourbon virus in mice’, PLoS Pathog, 15: e1007790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Butenko AM, Leshchinskaia EV, Semashko IV, Donets MA, and Mart’ianova LI 1987. ‘[Dhori virus--a causative agent of human disease. 5 cases of laboratory infection]’, Vopr Virusol, 32: 724–9. [PubMed] [Google Scholar]
  7. ‘Citation: ESRI 2021. ArcGIS Pro version 2.8 Redlands, CA: Environmental Systems Research Institute; ’. [Google Scholar]
  8. Cooley Robert Allen, and Kohls Glen M. 1944. ‘The genus Amblyomma (ixodidae) in the United States’, The Journal of Parasitology, 30: 77–111. [Google Scholar]
  9. Dupuis AP 2nd, Prusinski MA, O’Connor C, Maffei JG, Ngo KA, Koetzner CA, Santoriello MP, Romano CL, Xu G, Ribbe F, Campbell SR, Rich SM, Backenson PB, Kramer LD, and Ciota AT. 2021. ‘Heartland Virus Transmission, Suffolk County, New York, USA’, Emerg Infect Dis, 27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Eisen Rebecca J, Kugeler Kiersten J, Eisen Lars, Beard Charles B, and Paddock Christopher D. 2017. ‘Tick-borne zoonoses in the United States: persistent and emerging threats to human health’, ILAR journal, 58: 319–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Frese M, Kochs G, Meier-Dieter U, Siebler J, and Haller O. 1995. ‘Human MxA protein inhibits tick-borne Thogoto virus but not Dhori virus’, J Virol, 69: 3904–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Goddard J, and Varela-Stokes AS. 2009. ‘Role of the lone star tick, Amblyomma americanum (L.), in human and animal diseases’, Vet Parasitol, 160: 1–12. [DOI] [PubMed] [Google Scholar]
  13. Godsey MS, Rose D, Burkhalter KL, Breuner N, Bosco-Lauth AM, Kosoy OI, and Savage HM. 2021. ‘Experimental Infection of Amblyomma americanum (Acari: Ixodidae) With Bourbon Virus (Orthomyxoviridae: Thogotovirus)’, J Med Entomol, 58: 873–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Godsey MS, Savage HM, Burkhalter KL, Bosco-Lauth AM, and Delorey MJ. 2016. ‘Transmission of Heartland Virus (Bunyaviridae: Phlebovirus) by Experimentally Infected Amblyomma americanum (Acari: Ixodidae)’, J Med Entomol, 53: 1226–33. [DOI] [PubMed] [Google Scholar]
  15. Hair Jakie A, and Howell Dariel Elza. 1970. ‘Oklahoma Agricultural Experiment Station, Bulletin no. 679, July 1970: Lone star ticks; Their biology and control in Ozark recreation areas’. [Google Scholar]
  16. Jackson KC, Gidlewski T, Root JJ, Bosco-Lauth AM, Lash RR, Harmon JR, Brault AC, Panella NA, Nicholson WL, and Komar N. 2019a. ‘Bourbon Virus in Wild and Domestic Animals, Missouri, USA, 2012-2013’, Emerg Infect Dis, 25: 1752–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jackson Katelin C, Gidlewski Thomas, Root J Jeffrey, Bosco-Lauth Angela M, Lash R Ryan, Harmon Jessica R, Brault Aaron C, Panella Nicholas A, Nicholson William L, and Komar Nicholas. 2019b. ‘Bourbon virus in wild and domestic animals, Missouri, USA, 2012–2013’, Emerging infectious diseases, 25: 1752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jones KE, Patel NG, Levy MA, Storeygard A, Balk D, Gittleman JL, and Daszak P. 2008. ‘Global trends in emerging infectious diseases’, Nature, 451: 990–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Keirans JE, and Durden LA. 1998. ‘Illustrated key to nymphs of the tick genus Amblyomma (Acari: Ixodidae) found in the United States’, J Med Entomol, 35: 489–95. [DOI] [PubMed] [Google Scholar]
  20. Keirans JE, and Litwak TR. 1989. ‘Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River’, J Med Entomol, 26: 435–48. [DOI] [PubMed] [Google Scholar]
  21. Kensinger BJ, and Allan BF. 2011. ‘Efficacy of dry ice-baited traps for sampling Amblyomma americanum (Acari: Ixodidae) varies with life stage but not habitat’, J Med Entomol, 48: 708–11. [DOI] [PubMed] [Google Scholar]
  22. Kosoy OI, Lambert AJ, Hawkinson DJ, Pastula DM, Goldsmith CS, Hunt DC, and Staples JE. 2015. ‘Novel thogotovirus associated with febrile illness and death, United States, 2014’, Emerg Infect Dis, 21: 760–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lambert AJ, Velez JO, Brault AC, Calvert AE, Bell-Sakyi L, Bosco-Lauth AM, Staples JE, and Kosoy OI. 2015. ‘Molecular, serological and in vitro culture-based characterization of Bourbon virus, a newly described human pathogen of the genus Thogotovirus’, J Clin Virol, 73: 127–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Liu Q, He B, Huang SY, Wei F, and Zhu XQ. 2014. ‘Severe fever with thrombocytopenia syndrome, an emerging tick-borne zoonosis’, Lancet Infect Dis, 14: 763–72. [DOI] [PubMed] [Google Scholar]
  25. McMullan Laura K, Folk Scott M, Kelly Aubree J, MacNeil Adam, Goldsmith Cynthia S, Metcalfe Maureen G, Batten Brigid C, Albariño César G, Zaki Sherif R, and Rollin Pierre E. 2012. ‘A new phlebovirus associated with severe febrile illness in Missouri’, New England Journal of Medicine, 367: 834–41. [DOI] [PubMed] [Google Scholar]
  26. Molaei Goudarz, Little Eliza A.H., Williams Scott C., and Stafford Kirby C.. 2019. ‘Bracing for the Worst — Range Expansion of the Lone Star Tick in the Northeastern United States’, New England Journal of Medicine, 381: 2189–92. [DOI] [PubMed] [Google Scholar]
  27. Newman BC, Sutton WB, Moncayo AC, Hughes HR, Taheri A, Moore TC, Schweitzer CJ, and Wang Y. 2020. ‘Heartland Virus in Lone Star Ticks, Alabama, USA’, Emerg Infect Dis, 26: 1954–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Riemersma KK, and Komar N. 2015. ‘Heartland Virus Neutralizing Antibodies in Vertebrate Wildlife, United States, 2009-2014’, Emerg Infect Dis, 21:1830–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Rodino KG, Theel ES, and Pritt BS. 2020a. ‘Tick-Borne Diseases in the United States’, Clin Chem, 66: 537–48. [DOI] [PubMed] [Google Scholar]
  30. Rodino Kyle G, Theel Elitza S, and Pritt Bobbi S. 2020b. ‘Tick-Borne Diseases in the United States’, Clinical Chemistry, 66: 537–48. [DOI] [PubMed] [Google Scholar]
  31. Rosenberg Ronald, Lindsey Nicole P, Fischer Marc, Gregory Christopher J, Hinckley Alison F, Mead Paul S, Paz-Bailey Gabriela, Waterman Stephen H, Drexler Naomi A, and Kersh Gilbert J. 2018. ‘Vital signs: trends in reported vectorborne disease cases—United States and Territories, 2004–2016’, Morbidity and Mortality Weekly Report, 67: 496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sabin NS, Calliope AS, Simpson SV, Arima H, Ito H, Nishimura T, and Yamamoto T. 2020. ‘Implications of human activities for (re)emerging infectious diseases, including COVID-19’, J Physiol Anthropol, 39: 29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Savage HM, Burkhalter KL, Godsey MS Jr., Panella NA, Ashley DC, Nicholson WL, and Lambert AJ. 2017. ‘Bourbon Virus in Field-Collected Ticks, Missouri, USA’, Emerg Infect Dis, 23: 2017–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Savage HM, Godsey MS Jr., Panella NA, Burkhalter KL, Ashley DC, Lash RR, Ramsay B, Patterson T, and Nicholson WL. 2016. ‘Surveillance for Heartland Virus (Bunyaviridae: Phlebovirus) in Missouri During 2013: First Detection of Virus in Adults of Amblyomma americanum (Acari: Ixodidae)’, J Med Entomol, 53: 607–12. [DOI] [PubMed] [Google Scholar]
  35. Savage HM, Godsey MS Jr., Panella NA, Burkhalter KL, Manford J, Trevino-Garrison IC, Straily A, Wilson S, Bowen J, and Raghavan RK. 2018. ‘Surveillance for Tick-Borne Viruses Near the Location of a Fatal Human Case of Bourbon Virus (Family Orthomyxoviridae: Genus Thogotovirus) in Eastern Kansas, 2015’, J Med Entomol, 55: 701–05. [DOI] [PubMed] [Google Scholar]
  36. Savage HM, Godsey MS Jr., Tatman J, Burkhalter KL, Hamm A, Panella NA, Ghosh A, and Raghavan RK. 2018. ‘Surveillance for Heartland and Bourbon Viruses in Eastern Kansas, June 2016’, J Med Entomol, 55: 1613–16. [DOI] [PubMed] [Google Scholar]
  37. Savage HM, Godsey MS, Lambert A, Panella NA, Burkhalter KL, Harmon JR, Lash RR, Ashley DC, and Nicholson WL. 2013. ‘First detection of heartland virus (Bunyaviridae: Phlebovirus) from field collected arthropods’, Am J Trop Med Hyg, 89: 445–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Sonenshine DE 2018. ‘Range Expansion of Tick Disease Vectors in North America: Implications for Spread of Tick-Borne Disease’, Int J Environ Res Public Health, 15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Sun MH, Ji YF, Li GH, Shao JW, Chen RX, Gong HY, Chen SY, and Chen JM. 2022. ‘Highly adaptive Phenuiviridae with biomedical importance in multiple fields’, J Med Virol, 94: 2388–401. [DOI] [PubMed] [Google Scholar]
  40. Tokarz Rafal, and Lipkin W Ian. 2020. ‘Discovery and Surveillance of Tick-Borne Pathogens’, Journal of Medical Entomology, 58: 1525–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tran NTB, Shimoda H, Ishijima K, Yonemitsu K, Minami S, Kuroda Y, Tatemoto K, Mendoza MV, Kuwata R, Takano A, Muto M, Sawabe K, Isawa H, Hayasaka D, and Maeda K. 2022. ‘Zoonotic Infection with Oz Virus, a Novel Thogotovirus’, Emerg Infect Dis, 28: 436–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tuten HC, Burkhalter KL, Noel KR, Hernandez EJ, Yates S, Wojnowski K, Hartleb J, Debosik S, Holmes A, and Stone CM. 2020. ‘Heartland Virus in Humans and Ticks, Illinois, USA, 2018-2019’, Emerg Infect Dis, 26: 1548–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Van Horn Thomas R, Adalsteinsson Solny A, Westby Katie M, Biro Elizabeth, Myers Jonathan A, Spasojevic Marko J, Walton Maranda, and Medley Kim A. 2018. ‘Landscape Physiognomy Influences Abundance of the Lone Star Tick, Amblyomma americanum (Ixodida: Ixodidae), in Ozark Forests’, Journal of Medical Entomology, 55: 982–88. [DOI] [PubMed] [Google Scholar]

RESOURCES