Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Dec 8.
Published in final edited form as: Stem Cell Res. 2022 Oct 13;65:102944. doi: 10.1016/j.scr.2022.102944

Generation of an iPSC line from a Pontocerebellar Hypoplasia 1B patient harboring a homozygous c.395 A > C mutation in EXOSC3 along with a family matched control

Ben N Stansfield a,b,c, Sampath Rangasamy d, Keri Ramsey d, May Khanna e,f, Jared M Churko a,b,c,f,*
PMCID: PMC9729447  NIHMSID: NIHMS1846233  PMID: 36257093

Abstract

Pontocerebellar Hypoplasia 1B (PCH1B) is a severe autosomal recessive neurological disorder that is associated with mutations in the exosome complex component RRP40 (EXOSC3) gene. We generated and characterized an iPSC line from an individual with PCH1B that harbors a recessive homozygous c.395 A > C mutation in EXOSC3 and a family matched control from the probands unaffected mother. Each iPSC line presents with normal morphology and karyotype and express high levels of pluripotent markers. UAZTi009-A and UAZTi011-A are capable of directed differentiation and can be used as a vital experimental tool to study the development of PCH1B.

1. Resource utility

Two iPSC lines generated allow for the generation of various cell types implemented in Pontocerebellar Hypoplasia 1B which will enable researchers to study the c.395 A > C mutation in EXOSC3 and the mechanisms by which it contributes to the disease phenotype (Table 1).

Table 1.

Characterization and validation.

Classification Test Result Data

Morphology Bright field Normal Fig. 1Panel B
Phenotype Qualitative analysis. Immunocytochemistry Assess staining of pluripotency markers; OCT4, SSEA-4 Fig. 1Panel D
Quantitative analysis; RT-qPCR Assessed the Pluripotency markers OCT4, NANOG, SOX2 Fig. 1Panel C
Genotype Karyotype (KaryoStat) 150 k SNPs analysed>2 Mb (Chromosomal gains) >1 Mb (Chromosomal losses) Normal Fig. 1 Panel F
Identity Microsatellite PCR (mPCR) OR STR analysis Not performed Normal NA
Mutation analysis (IF APPLICABLE) Sanger Sequencing UAZTi009-A; Heterozygous Mutation UAZTi011-A; Homozygous Mutation Fig. 1 Panel A
Southern Blot OR WGS NA NA
Microbiology and virology Mycoplasma Mycoplasma Negative; Tested by PCR Supplementary Fig. 1A
Differentiation potential Directed differentiation Directed Differentiation into Ectoderm, Endoderm and Mesoderm germ layers Fig. 1 Panel E
List of recommended germ layer markers RT-qPCR Markers Assessed via RT-qPCR
Ectoderm: PAX6, SOX1
Endoderm: SOX17, FOXA2
Mesoderm: TBXT, TBX6
Fig. 1 Panel E
Donor screening (OPTIONAL) HIV 1 + 2 Hepatitis B, Hepatitis C N/A N/A
Genotype additional info (OPTIONAL) Blood group genotyping N/A N/A
HLA tissue typing N/A N/A

2. Resource details

Pontocerebellar Hypoplasia 1B is a severe autosomal recessive neurological disorder and is clinically characterized by large neuronal loss in the ventral pons and inferior olive, motor neuron degeneration in the spinal cord, and underdevelopment of the neocerebellum (Rudnik-Schoneborn et al., 2013). Exosome complex component RRP40 (EXOSC3) is a subunit of the RNA exosome complex and mutations in EXOSC3 are associated with Pontocerebellar Hypoplasia 1B and neuro degeneration (François-Moutal et al., 2018). Using Sendai virus reprogramming (Churko et al., 2013) we have generated one iPSC line from fibroblasts of a Pontocerebellar Hypoplasia 1B patient harboring the homozygous c.395 A > C, mutation in EXOSC3 (Fig. 1A), and an iPSC line from their unaffected mother. All cell lines possess normal morphology (Fig. 1B) and were negative for mycoplasma (Supplementary Fig. 1A) and Sendai virus (Supplementary Fig. 1B). All iPSC lines expressed the iPSC markers SOX2, NANOG and OCT4 at the mRNA level and OCT4, and SSEA4 at the protein level assessed by reverse transcription quantitative polymerase chain reaction (RT-qPCR) (Fig. 1C) and immunocytochemistry (Fig. 1D) respectively. iPSC lines were able to undergo directed differentiation into the three germ layers and were positive for mRNA markers of Endoderm, Ectoderm and Mesoderm when differentiated (Fig. 1E). Furthermore, no karyotypic abnormalities were observed (Fig. 1F).

Fig. 1.

Fig. 1.

Characterization of UAZTi009-A and UAZTi011-A iPSC lines.

3. Materials and methods

3.1. Reprogramming

Reprogramming of patient fibroblasts was performed at the University of Arizona iPSC core under IRB approval. Fibroblasts were isolated from skin puncture biopsies and 250,000 cells were incubated with Sendai virus to express Sox2, Oct3/4, klf4 and cMyc using the Cyto-Tune®-iPS v2.0 Reprogramming Kit (Thermo Fisher Scientific; A16517). After ∼ 20 days, single iPSC colonies were picked and expanded in Essential 8 (E8) medium (Thermo Fisher Scientific).

3.2. Cell Culture

iPSC lines were cultured in E8 media on 6 well plates coated with growth factor reduced Matrigel (Corning™; Cat #CB356238) until 70 % confluency under normoxic conditions (37°C, 5 % CO2, 20 % O2). iPSC lines were passaged in E8 and 10 μM ROCK inhibitor (Y27632, Tocris; #Cat1254) at a 1:6 ratio every 4–5 days.

3.3. Mutation analysis

DNA was extracted and purified from each iPSC line before PCR amplification using PrimeStar GXL polymerase (Takara; R050B) according to manufacturer’s instructions. Amplicons were sequenced for the c.395 A > C mutation in EXOSC3 (Eton Biosciences) to confirm the genotype of each individual cell line by sanger sequencing.

3.4. Immunocytochemistry

iPSC lines were seeded onto Matrigel coated coverslips and cultured in E8 medium until fixation. Cells were fixed in 3.7 % formalin for 60 min at room temperature. Fixed cells were permeabilized with 0.15 % Triton X-100 in PBS prior to blocking in 1 % BSA, 22.52 mg/ml glycine and 0.1 % Tween 20 in PBS (PBST). Cells were incubated with primary antibodies (Table 2) in blocking solution (minus glycine) overnight in a humidified chamber at 4 °C. Following the primary antibody incubation, secondary antibodies (Table 2) were incubated at room temperature in the dark for 60 min. Following secondary antibody incubations, cells were washed 3 × 5 min in PBST prior to nuclear counter staining using DAPI (ThermoFisher; D1306).

Table 2.

Reagents details.

Antibodies used for immunocytochemistry/flow-cytometry
Antibody Dilution Company Cat # RRID

Pluripotency Markers (ICC) Mouse anti-OCT4 1:100 #60093 AB_2801346
Mouse Anti SSEA4 1:100 #560308 AB_1645371
Secondary antibodies F(ab’)2-Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 1:1000 #A11017 AB_2534084
Primers Target Size of Band Forward/Reverse primer (5′–3′)
Pluripotency Markers (qPCR) NANOG 116 TTTGTGGGCCTGAAGAAAACT/AGGGCTGTCCTGAATAAGCAG
OCT4 106 CCTGAAGCAGAAGAGGATCACC/AAAGCGGCAGATGGTCGTTTGG
SOX2 150 AGAAGAGGAGAGAGAAAGAAAGGGAGAGA/GAGAGAGGCAAACTGGAATCAGGATCAAA
Differentiation Markers; Ectoderm (qPCR) PAX6 131 CTGAGGAATCAGAGAAGACAGGC/ATGGAGCCAGATGTGAAGGAGG
SOX1 136 GAGTGGAAGGTCATGTCCGAGG/CCTTCTTGAGCAGCGTCTTGGT
Differentiation Markers; Endoderm (qPCR) SOX17 112 ACGCTTTCATGGTGTGGGCTAAG/GTCAGCGCCTTCCACGACTTG
FOXA2 134 GGAACACCACTACGCCTTCAAC/AGTGCATCACCTGTTCGTAGGC
Differentiation Markers; Mesoderm (qPCR) TBXT 153 CCTTCAGCAAAGTCAAGCTCACC/TGAACTGGGTCTCAGGGAAGCA
TBX6 136 TCATCTCCGTGACAGCCTACCA/CCGCAGTTTCCTCTTCACACGG
House Keeping Gene(s) 18 s rRNA 159 ACCCGTTGAACCCCATTCGTGA/GCCTCACTAAACCATCCAATCGG
Targeted mutation EXOSC3 941 CCTGTCCCTCCTCTAAGCCT/ACGTTTGGAGACCGTGAGTC
Sendai Virus Clearance SeV CAGAGGAGCACAGTCTCAGTGTTC/TCTCTGAGAGTGGTGCTTATCTCTGT

RRID Requirement for antibodies: use https://antibodyregistry.org/ to retrieve RRID for antibodies and include ID in table as shown in examples.

3.5. Trilineage Differentiation

All iPSC lines were differentiated into Endoderm, Ectoderm and Mesoderm using the StemMACS™ Trilineage Differentiation Kit (Miltenyi Biotech; 130-115-660) according to manufacturer instructions.

3.6. RT-qPCR

RNA was extracted and isolated from iPSCs at passage 15–18 using the Direct-zol RNA Miniprep kit (Zymo Research; R2052). Isolated RNA was reverse transcribed into cDNA using the SuperScript VILO master mix (ThermoFisher; 11755050). qPCR was performed using the power track SYBR Green Master Mix (ThermoFisher; A46012). Samples were normalized to the H7 hESC line (WiCell).

3.7. Mycoplasma testing

Mycoplasma analysis was conducted using the PCR Mycoplasma Test Kit I/C (PromoKine, PK-CA91-1024) using the high sensitivity method, according to manufacturer instructions.

3.8. Karyotyping and STR analysis

2 × 106 cells were collected from each line at passage 15–17 and karyotyping analysis was conducted by Life Technologies using the KaryoStat+™ assay (ThermoFisher). Primary human fibroblast samples were used for STR analysis to confirm genetic similarity between patient fibroblasts and iPSC lines.

3.9. Sendai virus Clearance

RNA was collected from cells at passage 15–16 using the the Directzol RNA Miniprep kit (Zymo Research; R2052). RNA was amplified by PCR using Taq DNA polymerase (GoldBio, T-514). Cells at passage 1 were used as a positive control.

Supplementary Material

Supplementary Figure

Resource Table:

Unique stem cell lines identifier 1) UAZTi009-A
2) UAZTi011-A
Alternative name(s) of stem cell lines UAZTi009-A; MKAZ1
UAZTi011-A; MKAZ3
Institution University of Arizona
Contact information of distributor Dr Jared Churko PhD
jchurko@arizona.edu
Type of cell lines iPSC
Origin Human
Additional origin info required for human ESC or iPSC UAZTi009-A; Female
UAZTi011-A; Male
Cell Source Fibroblast
Clonality Clonal
Method of Reprogramming Sendai Virus
Sendai Virus Clearance PCR
Type of Genetic Modification NA
Cell Culture System Matrigel
Associated disease Pontocerebellar Hypoplasia 1B
Gene/locus EXOSC3 c.395 A > C
Date archived/stock date May 31, 2022
Cell line repository/bank https://hpscreg.eu/cell-line/UAZTi009-A
https://hpscreg.eu/cell-line/UAZTi011-A
Ethical approval WIRB® Protocol #20120789, and University of Arizona #1808846797

Abbreviations:

EXOSC3

Exosome Component 3

Footnotes

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.scr.2022.102944.

References

  1. Churko JM, Burridge PW, Wu JC, 2013. Generation of human iPSCs from human peripheral blood mononuclear cells using non-integrative Sendai virus in chemically defined conditions. Methods Mol. Biol. 1036, 81–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. François-Moutal L, Jahanbakhsh S, Nelson ADL, Ray D, Scott DD, Hennefarth MR, Moutal A, Perez-Miller S, Ambrose AJ, Al-Shamari A, Coursodon P, Meechoovet B, Reiman R, Lyons E, Beilstein M, Chapman E, Morris QD, Van Keuren-Jensen K, Hughes TR, Khanna R, Koehler C, Jen J, Gokhale V, Khanna M, 2018. A chemical biology approach to model pontocerebellar hypoplasia type 1B PCH1B. ACS Chem. Biol. 13, 3000–3010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Rudnik-Schoneborn S, Senderek J, Jen JC, Houge G, Seeman P, Puchmajerova A, Graul-Neumann L, Seidel U, Korinthenberg R, Kirschner J, Seeger J, Ryan MM, Muntoni F, Steinlin M, Sztriha L, Colomer J, Hubner C, Brockmann K, Van Maldergem L, Schiff M, Holzinger A, Barth P, Reardon W, Yourshaw M, Nelson SF, Eggermann T, Zerres K, 2013. Pontocerebellar hypoplasia type 1: clinical spectrum and relevance of EXOSC3 mutations. Neurology 80, 438–446. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figure

RESOURCES