SUMMARY
LIM domain-containing repeat (LCR) proteins are recruited to strained actin filaments within stress fibers in cultured cells 1–3, but their roles at cell-cell junctions in living organisms have not been extensively studied. Here, we show that the Caenorhabditis elegans LCR proteins TES-1/Tes and ZYX-1/Zyxin are recruited to apical junctions during embryonic elongation, when junctions are under tension; in genetic backgrounds in which embryonic elongation fails, junctional recruitment is severely compromised. The two proteins display complementary patterns of expression: TES-1 is expressed in lateral (seam) epidermal cells, whereas ZYX-1 is expressed in dorsal and ventral epidermal cells. tes-1 and zyx-1 mutant embryos display junctional F-actin defects; loss of either protein strongly enhances morphogenetic defects in hypomorphic mutant backgrounds for cadherin/catenin complex (CCC) components. The LCR regions of TES-1 and ZYX-1 are recruited to stress fiber strain sites (SFSSs) in cultured vertebrate cells. Together, these data establish TES-1 and ZYX-1 as components of a multicellular, tension-sensitive system that stabilizes the junctional actin cytoskeleton during embryonic morphogenesis.
RESULTS AND DISCUSSION
We previously conducted a genome-wide RNAi screen in a sensitized HMP-1/α-catenin background to identify genes that, when knocked down, enhanced the severity of the hmp-1(fe4) phenotype during morphogenesis in C. elegans embryos 4, including a gene on chromosome IV (Video S1). Previously named TAG-224 (Temporarily Assigned Gene 224), we renamed the protein TES-1 given its significant homology to vertebrate Tes. ClustalW analysis indicated that TES-1 is approximately 35% identical and 64% similar to human Tes. Pfam analysis showed that both proteins have an N-terminal PET domain followed by three C-terminal LIM domains (Figure 1A).
Figure 1. TES-1 loss enhances phenotypes in hypomorphic CCC backgrounds.
(A) Protein domain maps of C. elegans TES-1 and human Tes. TES-1 and Tes both contain N-terminal Prickle, Espinas, Testin (PET) domains and three C-terminal Lin-11, Isl-1, Mec-3 (LIM) domains. The tes-1(ok1036) allele removes LIM1-2 along with some intronic sequence and introduces a frameshift into the remainder of the coding region. (B-E) tes-1(RNAi) enhances the severity of morphogenetic defects in hmp-1(fe4) embryos. (B) Wild-type embryo imaged using Nomarski microscopy. (C) tes-1(RNAi) embryo. (D) hmp-1(fe4) embryo; bulges become apparent during embryonic elongation (t = 2 hr). (E) In hmp-1(fe4); tes-1(RNAi) embryos, cells leak out of the ventral midline (t = 1 hr), and all embryos die with severe elongation defects (t = 2 hr). Scale bar = 10 μm. (F-H) tes-1(RNAi) enhances the severity of actin defects in hmp-1(fe4) embryos. Phalloidin staining of wild-type (F), hmp-1(fe4) (G), and hmp-1(fe4); tes-1(RNAi) (H) embryos. Bright signal is muscle (yellow arrowheads). Wild-type embryos maintain a population of junctional proximal actin along cell borders and dorsal and ventral epidermal cells in elongated embryos contain circumferential actin filament bundles (CFBs) that are evenly spaced. hmp-1(fe4) embryos also typically maintain junctional proximal actin; however, their CFBs are less evenly spaced, and sometimes clump together (white arrowhead). hmp-1(fe4); tes-1(RNAi) embryos display clumping of CFBs (white arrowhead) and a complete lack of junctional proximal actin. CFBs appear to have been torn away from the junction, leaving bare zones devoid of F-actin (white arrow). Scale bar = 10 μm. (I) TES-1 binds to F-actin in an actin co-sedimentation assay. Full-length TES-1 remains in the supernatant fraction (S) when incubated without F-actin. However, TES-1 is detected in the pellet fraction (P) when incubated with 5 μM F-actin. (J) Quantification of TES-1 found in the pellet after incubation with F-actin. Bovine Serum Albumin (BSA) served as a negative control and SUMO::HMP-1 as a positive control. TES-1 bound to F-actin significantly more than BSA did (two replicates; ** = p < 0.01, unpaired Student’s T test). See also Figure S1 and Video S1.
TES-1 is an F-actin-binding protein that functionally interacts with hmp-1/α-catenin at the C. elegans apical junction
100% of hmp-1(fe4); tes-1(RNAi) embryos arrested during the elongation stage of morphogenesis with junctional actin defects (Figure 1B–E). tes-1(ok1036); hmp-1(fe4) double homozygotes similarly exhibit 93.8% lethality and elongation arrest (n = 516 embryos examined), and tes-1 RNAi enhanced lethality in a hmp-2/β-catenin hypomorph (hmp-2(qm39); Figure S1). tes-1 RNAi exacerbated junctional proximal actin defects in hmp-1(fe4) homozygotes (Figure 1F–H). In 26 % of hmp-1(fe4); tes-1(RNAi) embryos (6 of 23 embryos examined via 4d microscopy) cells leaked out of the ventral midline, compared with 0% of hmp-1(fe4) homozygotes (0 of 22 embryos examined; significantly different, Fisher’s exact test, p = 0.02). Ventral enclosure involves formation of CCC-dependent junctions at the ventral midline 5, suggesting that TES-1 is also involved in this process (Figure 1E, arrow). Like vertebrate Tes 6,7, recombinant TES-1 cosediments with F-actin (Figure 1I) to an extent statistically indistinguishable from HMP-1/α-catenin 8 (Figure 1J).
TES-1 localizes to apical junctions in the embryonic epidermis
We constructed an endogenously tagged version of tes-1; mNG::tes-1 embryos, larvae, and adults were phenotypically indistinguishable from wildtype (Figure 2A). In larvae, TES-1 was visible at alae, epidermal structures produced by seam cells; in adults, TES-1 was expressed in vulval tissues (data not shown). In early embryos, mNG::TES-1 was visible in the cytoplasm of epidermal cells; at the 2-fold stage of elongation, mNG::TES-1 puncta began to accumulate at sites of cell-cell contact, expanding and becoming more evenly distributed along cell borders as elongation continued. Strikingly, mNG::TES-1 was maintained at seam-dorsal and seam-ventral, but not seam-seam borders (Figure 2B, arrow).
Figure 2. TES-1 localizes to sites of cell-cell attachment during embryonic elongation.
(A) A schematic of the endogenous mNG::TES-1 knock-in strain used in this study. (B) mNG::TES-1 localizes strongly to seam-dorsal and seam-ventral boundaries (arrow). (C) hmr-1(RNAi) completely prevents mNG::TES-1 localization at junctions. (D) ajm-1(RNAi) does not influence the ability of mNG::TES-1 to localize to junctions (arrow). Scale bar = 10 μm. (E) mNG::TES-1 co-localizes with endogenous HMP-1::mScarletI. (F) mNG::TES-1 does not co-localize with DLG-1::dsRed. Insets in (E) and (F) show magnifications of boxed regions. Scale bar = 10 μm. (G-I) Fixed and phalloidin stained embryos. Bright staining is muscle (arrowhead). Scale bar = 10 μm. (G) Wild-type embryos exhibit parallel circumferential filament bundles (CFBs, blue box inset) and retain junctional-proximal actin (green box inset). (H) Approximately half the tes-1(ok1036) embryos exhibit reduced junctional-proximal actin although CFB organization looks normal. (I) tes-1(ok1036) embryos also exhibit more severe phenotypes including gaps and clumping of CFBs (blue box) and a complete loss of junctional-proximal actin (green box). (J) Width of junctional proximal actin at seam-non-seam boundaries measured from phalloidin stained specimens (wildtype: n = 14 junctions; tes-1(ok1036): n = 16 junctions; **** p < 0.0001, unpaired Student’s T-test). (K) Quantification of phalloidin staining phenotypes. Class 1 embryos have normal CFBs and junctional-proximal actin. Class 2 embryos have reduced junctional-proximal actin. Class 3 embryos have reduced junctional-proximal actin and CFB organization defects and Class 4 embryos have no retained junctional-proximal actin and CFB organization defects (wildtype: n = 16 embryos; tes-1(ok1036): n = 40 embryos; **** = p < 0.0001, Freeman-Halton extension to Fisher’s exact test). See also Figure S2.
We next performed knockdown of junctional components in mNG::tes-1 embryos. In hmr-1(RNAi) embryos TES-1::GFP failed to accumulate at junctions (Figure 2C). In contrast, ajm-1(RNAi) did not prevent junctional localization of mNG::TES-1 (Figure 2D); however, TES-1 foci did not spread to form a continuous, intense band as in wildtype, which may reflect the failure of ajm-1(RNAi) embryos to elongate fully.
Endogenously tagged HMP-1/α-catenin::mScarletI and mNG::TES-1 displayed substantial overlap in embryos (Figure 2E; Pearson’s R value above threshold = 0.58, n = 10 junctions), whereas there was little to no overlap with DLG-1/Discs large::dsRed, which localizes basal to the CCC (Figure 2F; R = 0.25, n = 10 junctions; significantly different, p < 0.0001, unpaired Student’s t-test). Partial localization of Tes with the CCC has similarly been reported in cultured vertebrate cells 9. Although one study reported that vertebrate α-catenin and Tes can be coimmunoprecipitated 10, we were unable to replicate this result with C. elegans CCC components in a generalized proteomics screen 11 or in directed coIP experiments (Figure S2A–B), suggesting that the interaction of TES-1 with the C. elegans CCC is indirect. Alternatively, force-dependent interactions between LCR proteins and cell-cell junctions may be transient and weak, as suggested by a recent BioID study of zyxin 12, and thus difficult to demonstrate using traditional biochemical approaches.
We reasoned that TES-1 could stabilize CCC-dependent junctional proximal actin networks during morphogenesis, and so we compared F-actin in tes-1(ok1036) homozygous embryos wild-type for hmp-1 with fully wild-type embryos (Figure 2G–I). Unlike wild-type embryos (Figure 2G), most tes-1(ok1036) embryos displayed significantly narrower zones of junctional proximal actin (Figure 2H; quantified in Figure 2J), as well as more severe phenotypes, including gaps between circumferential filament bundles (CFBs), CFB collapse, and complete loss of preserved junctional-proximal actin (Figure 2I; quantified in Figure 2K). We conclude that TES-1 stabilizes junctional-proximal actin during morphogenesis.
TES-1 requires its PET and LIM domains
To identify functionally important subdomains of TES-1 we analyzed endogenously tagged tes-1 deletions. Unlike full-length mNG::TES-1 (Figure 3A), mNG::TES-1ΔPET localized along all seam cell borders in the epidermis (Figure 3B). mNG::TES-1ΔLIM1-3 localized along structures that appear to be CFBs (Figure 3C). This result suggests that the latent ability of TES-1 to bind to CFBs is not normally manifest when the N terminus is present, and is similar to vertebrate Tes, which can co-immunoprecipitate actin 7 and localize via its N terminus in a non-mechanosensitive manner 10,13,14. Line scans indicated that when either the PET or LCR domains were deleted, TES-1 still localized to seam-dorsal and seam-ventral junctions (Figure 3D), but embryos showed ectopic TES-1 junctional localization at seam-seam junctions (Figure 3E). Deletion of the PET domain led to an increase in junctional vs. cytoplasmic signal compared to wildtype, while removal of all three LIM domains resulted in the opposite effect (Figure 3F). It is possible that the PET and LCR domains interact, restricting their domain-specific binding affinities, as has been proposed for vertebrate Tes based on biochemical assays7. These results indicate that both the LCR and PET domains are required for normal levels and sites of TES-1 junctional recruitment.
Figure 3. TES-1 localization requires its PET and LCR domains.
For relevant domains of TES-1, see Figure 1A. (A) Full-length endogenous mNG::TES-1 localizes to dorsal-seam and ventral-seam cell boundaries in the epidermis prominently by the two-fold stage. (B) Unlike full-length mNG::TES-1, mNG::TES-1ΔPET localizes along all seam cell borders in the epidermis, including seam-seam borders (arrows). There is also localization at what appear to be actin-containing structures in epidermal cells. (C) Deletion of LIM1-3 perturbs junctional localization: mNG::TES-1ΔLIM1-3 localizes sporadically to epidermal junctions, including seam-seam junctions (arrow). However, there is also localization to actin networks in seam cells and along structures that appear to be CFBs in non-seam cells. Scale bar = 10 μm. (D-E) Line scans of mNG::TES-1 signal across dorsal-seam and ventral-seam cell boundaries (D; position of scans indicated by white lines in A-C) and seam-seam boundaries (E; yellow lines in A-C) for full-length (WT) mNG::tes-1, mNG::tes-1ΔPET, and mNG:: ΔLIM1-3 embryos. (F) Junctional/cytoplasmic signal for mNG::TES-1 (n = 12 junctions), mNG::TES-1ΔPET (n = 10), and mNG::TES-1ΔLIM1-3 (n = 10). ** = p < 0.01, **** = p < 0.0001, unpaired Student’s T-test. (G-I) TES-1::GFP localization in elongation-defective transgenic embryos expressing TES-1::GFP. (G) In hmp-1(fe4) embryos that do not elongate past 1.5-fold before failing, TES-1::GFP does not localize to junctions, and instead remains entirely cytoplasmic (arrow). Yellow arrowhead indicates the characteristic Humpback phenotype. See Figure S3I for images of fe4 embryos that partially elongate. (H) In let-502(sb118ts); tes-1::gfp embryos reared at the restrictive temperature (“shifted”), the LET-502 protein is inactivated, embryos fail to elongate, and TES-1::GFP never accumulates along epidermal junctions. Unshifted embryos display normal development and TES-1::GFP localizes to junctions as in wildtype (Figure S3K). (I) In mel-11(RNAi); tes-1::gfp embryos, TES-1::GFP is pulled away from junctions in long extensions from epidermal cell borders. In embryos that elongate normally TES-1::GFP junctional localization is not affected (not shown). Scale bars = 10 μm. (J) Junctional/cytoplasmic ratio of TES-1::GFP in wild-type embryos at ≥ 2.5-fold stage of elongation (n = 17 junctions), hmp-1(fe4) embryos at 1.25-fold stage of elongation (n = 32) and let-502(RNAi) embryos at 1.25x (n = 23) and ≥ 1.5x (n = 33) stages of elongation. ** = p < 0.01, *** = p < 0.001, **** = p < 0.0001, unpaired Student’s T-test. See also Figure S3.
We also expressed various TES-1::GFP deletion constructs (Figure S3A) in transgenic embryos. Full-length TES-1∷GFP, TES-1ΔPET::GFP, and TES-1ΔLIM1-3 recapitulated the expression of endogenous knock-ins (Figure S3B–D). TES-1::GFP rescued lethality in tes-1(ok1036)/+; hmp-1(fe4) embryos. tes-1(ok1036)/+; hmp-1(fe4) worms exhibited 80% lethality (n = 20 embryos scored); the addition of extrachromosomal TES-1::GFP reduced lethality to 38% (n = 92 embryos scored). tes-1(ok1036); hmp-1(fe4) worms could develop to adulthood, but only if they expressed tes-1::gfp, indicating the TES-1::GFP is functional. Deletion of LIM1 (Figure S3E) or LIM2 (Figure S3F) both led to sporadic recruitment to epidermal junctions, including some seam-seam junctions, and what appear to be actin-containing structures in epidermal cells. Deletion of LIM3 rendered TES-1::GFP largely cytoplasmic (Figure S3G).
Due to maternal effects and gonadal defects, assessing synergistic lethality of tes-1::gfp deletion constructs in tes-1(ok1036); hmp-1(fe4) homozygous mothers proved challenging. Fertile tes-1(ok1036); hmp-1(fe4) worms harboring tes-1ΔLIM1::GFP could not be obtained; occasional tes-1(ok1036); hmp-1(fe4)/+; tes-1ΔLIM1::GFP embryos were able to grow to adulthood, but were sterile. We therefore tested for the ability of TES-1::GFP fragments to rescue synergistic lethality in tes-1(ok1036); hmp-1(fe4)/+ embryos (Figure S3H). TES-1ΔPET::GFP significantly rescued some embryonic lethality in this genetic background, but progeny displayed germline malformations, protruding vulvae, and sterility. TES-1ΔLIM1-3::GFP, TES-1ΔLIM2::GFP, and TES-1ΔLIM2::GFP were unable to rescue the 39% lethality observed among progeny of tes-1(ok1036); hmp-1(fe4)/+ mothers. Overall, these results indicate that the LIM domains of TES-1 are crucial for tes-1 function during morphogenesis.
The difference in localization pattern of TES-1ΔLIM3::GFP and TES-1ΔLIM1-3::GFP was curious, since the entire LCR region, with appropriate spacing between LIM domains, has been suggested to be crucial for F-actin binding 3,15. It has been suggested, however, that the LIM1-2 domain of vertebrate Tes can engage in both heterophilic binding to proteins such as zyxin and homodimerization via interaction with the PET domain of Tes 10. While it is not currently known if homodimeric Tes is sequestered away from cell-cell adhesion sites, deletion of LIM3 could favor such homodimerization. Alternatively, deletion of LIM3 may cause misfolding of the truncated protein.
TES-1 localizes to junctions in a tension-dependent manner
Tes is required for maintenance of stress fibers in cultured vertebrate cells 16, accumulates at “focal adherens junctions” (spot-like foci of cell-cell adhesion) in human vascular endothelial cells 9, and accumulates at stress fibers downstream of Rho signaling 14. These data suggest that Tes might play tension-dependent roles in stabilizing F-actin networks at adherens junctions during morphogenesis. A coordinated change in the shape of epidermal cells drives elongation of the C. elegans embryo to approximately 4-fold its original length 17, during which contractile forces result in elevated tension specifically at seam-ventral and seam-dorsal junctions 5,18–21. Given the localization of TES-1, we sought to test whether it is recruited to junctions in a tension-sensitive manner during embryonic elongation.
Because hmr-1/cadherin, hmp-1/α-catenin, and hmp-2/β-catenin homozygous null mutant embryos fail to progress past the two-fold stage of elongation, we could not assess whether disruption of TES-1::GFP recruitment to junctions is due primarily to physical absence of CCC components or to the pre-elongation death of the embryos. We therefore examined hmp-1(fe4) embryos expressing TES-1::GFP. While some hmp-1(fe4) embryos failed to elongate appreciably, other embryos extended to the 2-fold stage of elongation. TES-1::GFP did not localize to junctions in hmp-1(fe4) embryos that failed to elongate past 1.5-fold (10 of 10 embryos; Figure 3G,J), even in embryos that survived and hatched. However, TES-1::GFP did localize to junctions in the rare hmp-1(fe4) embryos that elongated to at least 2-fold their original length (5 of 5 embryos examined; significantly different; Fisher’s exact test, p = 0.0003; Figure S3I). The correlation between the extent of elongation of fe4 embryos and TES-1::GFP junctional recruitment suggests that TES-1 is recruited to junctions in cells that generate sufficient tension to elongate to the 2-fold stage.
We next introduced the full-length TES-1::GFP into let-502(sb118ts)/Rho kinase worms to reduce actomyosin contractility in the epidermis (Figure 3H; Figure S3K–L). When let-502(sb118ts); tes-1::gfp embryos were imaged at the permissive temperature, TES-1::GFP localized to junctions normally (Figure S3K; quantified in Figure 3J, let-502(sb118ts) ≥ 1.5x). At the restrictive temperature (25°C), however, TES-1::GFP remained entirely cytoplasmic in embryos that failed to elongate (Figure 3H; quantified in Figure 3J, let-502 (sb118) 1.25x). We also attempted the converse experiment by knocking down MEL-11/myosin phosphatase, which is known to result in excessive epidermal contractility 19,20. However, adhesion complexes underwent changes in morphology that made this experiment difficult to interpret: the initially continuous distribution of junctional TES-1::GFP was progressively lost, as TES-1∷GFP became fragmented and pulled into puncta (Figure 3I). One possibility consistent with this result is that excessive tension leads to collapse of junctional proximal actin around CFB insertion sites, including associated TES-1.
ZYX-1/zyxin localizes to junctions in a tension-dependent manner complementary to TES-1
Studies in vertebrate tissue culture cells indicate similar, but not entirely overlapping, localization of Tes and zyxin at spot adherens junctions 9,22. Moreover, targeted interaction studies 7 and proteomics screens 10 suggest that the two proteins may physically associate, either directly or as part of a complex. We used an endogenous mNG::ZYX-1a knock-in 23 (hereafter ZYX-1) to assess zyx-1 expression in C. elegans embryos. ZYX-1 had been reported to localize at muscle attachment sites 24,25 and sites of cell-cell contact in gastrulating embryos 23. However, its localization at adherens junctions in the embryonic epidermis had not been reported. ZYX-1 showed strong localization at seam-dorsal and seam-ventral junctions in the epidermis during mid-late elongation. Strikingly, however, ZYX-1 showed a pattern complementary to that of TES-1: whereas mNG::TES-1 showed strong expression in seam cells, ZYX-1 was expressed strongly within non-seam cells (Figure 4A).
Figure 4. ZYX-1 is also recruited to junctions during elongation and both ZYX-1 and TES-1 are recruited to strained actin filaments.
(A) mNG::ZYX-1 is recruited to both dorsal-seam and seam-ventral junctions (white arrow), and it also colocalizes with CFBs after the two-fold stage (yellow arrowhead). (B) In mNG::zyx-1ΔLIM1-3 embryos ZYX-1 is largely absent from junctions and is not recruited to CFBs. (C) let-502(RNAi) embryos partially lose junctional localization of mNG::ZYX-1. Scale bars = 10 μm. (D-I) Recruitment of TES-1 LCR::mCherry and ZYX-1 LCR::mCherry to stress fiber strain sites (SFSS) in transfected mouse embryonic fibroblasts. (D) Representative kymographs of laser-induced recruitment of the ZYX-1 LCRmCherry and mouse GFP::Zyxin to SFSS. For a timelapse sequence of the entire cell, see Video S2. White dashed and gray solid lines indicate where fluorescence and distance were measured. Dashed gray vertical line indicates t0, when strain is first observed. (E) Quantification of GFP and mCherry accumulation over time in the kymograph from (D). (F) Representative kymographs of laser-induced recruitment of TES-1 LCR mCherry and mouse GFP::Zyxin to SFSS. For a timelapse sequence of the entire cell, see Video S3. (G) Quantification of GFP and mCherry accumulation over time in the kymograph from (F). (H-I) Intensity of C. elegans ZYX-1 LCR::mCherry (H) and C. elegans TES-1 LCR::mCherry (I) relative to full-length mouse GFP::Zyxin present in the same cells. Blue dots in each graph represent mCherry alone relative to GFP::MmZyx. TES-1 LCR::mCherry accumulates markedly (p=0.023, n>10) but to a lesser extent than MmZyx, error bars indicate 95% confidence intervals. (J) mNG::ZYX-1 does not co-localize with mScarletI::TES-1. Inset shows magnification of boxed region. Scale bar = 10 μm. See also Figure S2, S4, and Video S2, S3.
Like mNG::ZYX-1, epidermally expressed transgenic ZYX-1::GFP colocalized with the CCC, and its localization was disrupted by HMP-1 depletion (Figure S4A–C). Since the LCR domain of zyxin is thought to be required for interaction with F-actin 3,15, we created an endogenously tagged ΔLIM1-3 strain. mNG::ZYX-1ΔLIM1-3 was much more weakly recruited to junctions (Figure 4B; for quantification, see Figure S4E). We found that loss of zyx-1 function enhanced lethality of hmp-1(fe4) homozygotes to 100%. This enhancement could be rescued with a ZYX-1::GFP expressed under the control of an epidermal-specific promotor, suggesting that its key role is in this tissue (Figure S4D). We next stably expressed GFP-tagged, truncated forms of ZYX-1 in epidermal cells. ZYX-1ΔLIM1-3::GFP was unable to rescue (Figure S4D). Intriguingly, however, a construct lacking LIM1 and LIM3 could very weakly rescue when overexpressed in the epidermis, suggesting a more stringent requirement for the middle of the LCR during morphogenesis. hmp-1(fe4); zyx-1(gk190) embryos could not be rescued by epidermal ZYX-1::GFP lacking the N terminus (Figure S4D), indicating a role for the N terminus that is yet to be elucidated. Like mNG::TES-1, mNG::ZYX-1 was much more weakly recruited to seam/non-seam junctions in let-502(RNAi) embryos (Figure 4C; for quantification, see Figure S4E). Junctional F-actin defects in zyx-1(gk190) homozygotes were more subtle than those in tes-1(ok1036) homozygotes (see Figure 2G–K): we did not detect effects on CFBs, but did observe small ruptures in the junctional proximal actin network at seam-dorsal and seam-ventral boundaries in the embryonic epidermis not observable in controls (Figure S4F–H).
Both TES-1 and ZYX-1 can be recruited to strained actin fibers
Mammalian LIM domain proteins are recruited to strained actin fibers via their LIM domain-containing region 2,3,26. Recruitment of the LCRs of such proteins to stress fiber strain sites (SFSSs) can be induced by laser irradiation in cultured mammalian cells 15. We tested whether the LCRs of TES-1 and ZYX-1 behave similarly. When transfected into mouse embryonic fibroblasts, ZYX-1(LIM1-3)::mCherry was recruited to SFSSs with kinetics similar to the LCR of full-length, eGFP-tagged M. musculus zyxin (Figure 4D; quantified in Figure 4E,H; for a movie of the entire cell, see Video S2). Compared with full-length M. musculus GFP-zyxin, recruitment of the TES-1 LCR was less pronounced, but significant compared to the mCherry negative control (Figure 4F; quantified in Figure 4G,I; also see Video S3).
ZYX-1/zyxin and TES-1/Tes act largely independently during elongation
We next assessed the interdependence of TES-1 and ZYX-1 in the epidermis during embryonic elongation. Endogenously tagged TES-1 and ZYX-1 appeared to abut one another across cell-cell junctions (Figure 4J); they did not colocalize quantitatively at junctions (Pearson’s R above threshold = 0.0, 13 junctions measured). We saw no change in localization of mNG::TES-1 to specific boundaries at the 3–4-fold stage in zyx-1(gk190) or zyx-1 null (cp419) 23 homozygotes (Figure S4I–K), nor did we see mislocalization of mNG::ZYX-1 in tes-1(ok1036) homozygotes (Figure S4L–M). We did not see any obvious enhancement of lethality in tes-1; zyx-1 double loss-of-function embryos, but occasional tes-1(syb5622); zyx-1(cp419) animals showed minor body morphology defects that became less severe during larval molts (3 out of 30 embryos). Finally, based on previous studies of vertebrate homologues 7,27, we assessed the physical interaction of TES-1 and ZYX-1. While we were able to coIP TES-1 and ZYX-1 (Figure S2C–D), we were only able to detect a very weak, substoichiometric interaction between TES-1 and ZYX-1 via pulldown of bacterially expressed proteins (Figure S2D).
In summary, our results suggest that two LCR proteins – ZYX-1 in non-seam cells and TES-1 in seam cells – act largely independently to bolster cadherin-dependent connections to the junctional-proximal F-actin network during embryonic elongation. A similar division of labor between these two cell types has been elegantly demonstrated previously in the case of non-muscle myosin and other proteins in a series of investigations 21,28–30. Our results are consistent with experiments in vertebrates, which show that while depletion of zyxin can reduce the amount of Tes at focal adhesions 7, Tes can still localize independently of zyxin 27. Our results further suggest that loss of one of these LCR proteins in an otherwise wild-type background in C. elegans is insufficient to decrease tension below the threshold required for recruitment of the other in the complementary group of epidermal cells.
The TES-1 LCR showed less avid recruitment to SFSSs than the ZYX-1 LCR when expressed heterologously. A previous study in tissue culture cells suggested that a crucial phenylalanine (F66) is found in the LIM domains of proteins that show mechanosensitive recruitment to SFSSs 3. Notably, zyxin has the F66 feature, but Tes does not 3,15. There may be assay dependence regarding this requirement, however, as F66 is not required for recruitment of isolated LCR domains to SFSSs 15. Moreover, Tes has recently been shown to be activated by Rho signaling 14; since Rho activity is upregulated in seam cells during embryonic elongation in C. elegans 28,31, activation of TES-1 in these cells could result in less functional difference in activity of TES-1 and ZYX-1 in vivo. Whether ZYX-1 and TES-1 play subtly different roles at the subcellular level is an interesting avenue for future investigation.
Elongating epidermal cells in the C. elegans embryo are likely to be subject to “self-injury”, as they must remodel their junctional-proximal actin networks to undergo dramatic changes in shape. Our previous experiments indicated that UNC-94/tropomodulin is recruited to junctions under tension, where it presumably protects minus ends of F-actin filaments from subunit loss32. Our current results are consistent with a model in which actomyosin-mediated tension generated in elongating embryos leads to strain-dependent recruitment of TES-1 and ZYX-1 to these same junctions during elongation, stabilizing strained junctional actin filaments against the rigors of mechanical stress during morphogenesis.
STAR METHODS
RESOURCE AVAILABILITY
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Dr. Jeff Hardin (jdhardin@wisc.edu).
Materials availability
All unique/stable reagents generated in this study are available from the lead contact upon request.
Data and code availability
All data reported in this paper will be shared by the lead contact upon request.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
EXPERIMENTAL MODEL AND SUBJECT DETAILS
C. elegans strains were maintained on standard nematode growth medium plates seeded with OP50 E. coli 33 at either 15°C (temperature sensitive strains) or 20°C (all other strains). Bristol N2 was used as wildtype. Details of strains used in this study can be found in the key resources table.
Key Resource Table.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse anti-GFP | Invitrogen | Cat#A11120 |
| Rabbit anti-GFP | Invitrogen | Cat#A11122 |
| Rabbit polycolonal anti-HMP-1 | Callaci et al.11 | N/A |
| Rabbit polycolonal anti-HMR-1 | Callaci et al.11 | N/A |
| Mouse monoclonal anti-ZYX-1 | Lecroisey et al.54 | N/A |
| Mouse monoclonal anti-AJM-1, MH27 | Hardin lab ascites | N/A |
| Goat anti-rabbit IgG Texas Red | Invitrogen | Cat#T-2767 |
| Goat anti-rabbit IgG FITC | Invitrogen | Cat#31635 |
| Goat anti-mouse IgG Texas Red | Abcam | Cat#ab6787 |
| anti-mouse FITC | Sigma-Aldrich | Lot#SLBZ0072 |
| IRDye® 680RD Goat anti-Rabbit IgG Secondary Antibody | Li-COR | Cat#926-68071 |
| IRDye® 680RD Donkey anti-Mouse IgG Secondary Antibody | Li-COR | Cat#926-68072 |
| IRDye® 800CW Goat anti-Rabbit IgG Secondary Antibody | Li-COR | Cat#926-32211 |
| IRDye® 800CW Donkey anti-Mouse IgG Secondary Antibody | Li-COR | Cat#926-32212 |
| Bacterial and virus strains | ||
| Escherichia coli OP50 | CGC | N/A |
| Escherichia coli BL21-Gold (DE3) | Sigma-Aldrich | Cat#69450-M |
| Escherichia coli clone for C. elegans CDS B0496.8 (tes-1) | Ahringer library; Kamath et al.41 | N/A |
| Escherichia coli clone for C. elegans CDS C10H11.9 (let-502) | Ahringer library; Kamath et al.41 | N/A |
| Escherichia coli clone for C. elegans CDS C06C3.1 (mel-11) | Ahringer library; Kamath et al.41 | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| Alexa Fluor 488 Phalloidin | Invitrogen | Cat#A12379 |
| Alexa Fluor 660 Phalloidin | Invitrogen | Cat#A22285 |
| ProTEV Plus | Promega | Cat#V6102 |
| polymerized chicken F-actin | Cytoskeleton, Inc | Cat#AS99-B |
| T7 Megascript kit | ThermoFisher | Cat#AM1334 |
| T3 Megascript kit | ThermoFisher | Cat#AM1338 |
| Phusion DNA polymerase | ThermoFisher | Cat#F630S |
| Experimental models: Cell lines | ||
| NIH 3T3 fibroblasts | American Type Culture Collection | CRL-1658 |
| Mouse: Embryonic fibroblasts (MEFs) | Gibco | Cat#A34181 |
| Experimental models: Organisms/strains | ||
| C. elegans N2: wildtype | CGC | N2 |
| C. elegans HR1157: let-502(sb118ts)I | Mains Lab | HR1157 |
| C. elegans LP810: zyx-1(cp415[mNG::zyx-1a])II | Goldstein Lab | LP810 |
| C. elegans LP831: zyx-1Δ(cp419[Pmyo-2>GFP])II | Goldstein Lab | LP831 |
| C. elegans ML1651: mcIs46 [dlg-1::RFP + unc-119(+)] | Labouesse Lab | ML1651 |
| C. elegans MQ468: hmp-2(qm39)I | Hekimi Lab | MQ468 |
| C. elegans PE532: xnIs96[pJN455(hmr-1p::hmr-1::GFP::unc-54 3’UTR) + unc-119(+)] | Pettitt Lab | PE532 |
| C. elegans PE633: feEx324[zyx-1::mCherry rol-6(su1006)] | Pettitt Lab | PE633 |
| C. elegans PE636: feEx327[zyx-1::gfp Pmyo-2::dTomato] | Pettitt Lab | PE636 |
| C. elegans PE644: zyx-1(gk190)II; feEx327[zyx-1::gfp myo-2p::dTomato] | Pettitt Lab | PE644 |
| C. elegans PE647: zyx-1(gk190)II; hmp-1(fe4)/nT1V, feEx328[zyx-1D376-603::gfp myo-2p::dTomato] | Pettitt Lab | PE647 |
| C. elegans PE649: zyx-1(gk190)II; hmp-1(fe4)/nT1V; feEx329[zyx-1D479-603::gfp myo-2p::dTomato] | Pettitt Lab | PE649 |
| C. elegans PE650: zyx-1(gk190)II; hmp-1(fe4)/nT1V; feEx330[zyx-1D526-603::gfp myo-2p::dTomato] | Pettitt Lab | PE650 |
| C. elegans PE651: zyx-1(gk190)II; hmp-1(fe4)/nT1V; feEx331[zyx-1D166-200::gfp myo-2p::dTomato] | Pettitt Lab | PE651 |
| C. elegans PE671: mcIs46[dlg-1::RFP + unc-119(+)]; feEx327[zyx-1::gfp myo-2p::dTomato] | Pettitt Lab | PE671 |
| C. elegans PE97: hmp-1(fe4)V | Pettitt Lab | PE97 |
| C. elegans PHX5560: zyx-1(syb5560[mNG::zyx-1a, deltaLIM1-3])II | This paper | PHX5560 |
| C. elegans PHX5622: tes-1(syb5622[mNG::FLAG::tes-1, deltaLIM1-3])IV | This paper | PHX5622 |
| C. elegans PHX5627: tes-1(syb5622[mNG::FLAG::tes-1, deltaPET])IV | This paper | PHX5627 |
| C. elegans SU1042: tes-1(jc71[mNeonGreen::tes-1])IV; zyx-1(gk190)II | This paper | SU1042 |
| C. elegans SU1043: tes-1(jc71[mNeonGreen::tes-1])IV; mcEX40[plin-26::vab-10::mcherry; myo-2::gfp])IV | This paper | SU1043 |
| C. elegans SU1044: tes-1(jc71[mNeonGreen::tes-1])IV; curIs[plin-26::lifeact::mcherry::unc-54 3'UTR; unc-119(+)] | This paper | SU1044 |
| C. elegans SU1058: tes-1(jc71[mNG::tes-1])IV; zyx-1Δ(cp419[Pmyo-2>GFP])II | This paper | SU1058 |
| C. elegans SU1072: tes-1(jc71[mNG::FLAG::tes-1])IV; hmp-1(jc58[hmp-1::mScarlet-I+LoxP511])V | This paper | SU1072 |
| C. elegans SU1073: zyx-1Δ(cp419[Pmyo-2>GFP])II; tes-1(ok1036)IV | This paper | SU1073 |
| C. elegans SU1085: tes-1(jc110[mScarlet-I::FLAG::tes-1+LoxP511])IV | This paper | SU1085 |
| C. elegans SU1087: zyx-1(cp415[mNG::zyx-1a])II; curIs[plin-26::lifeact::mcherry::unc-54 3'UTR; unc-119(+)] | This paper | SU1087 |
| C. elegans SU1088: zyx-1(syb5560[mNG::zyx-1a, deltaLIM1-3])II; curIs[plin-26::lifeact::mcherry::unc-54 3'UTR; unc-119(+)] | This paper | SU1088 |
| C. elegans SU1090: tes-1(jc110[mScarlet-I::FLAG::tes-1+LoxP511])IV; zyx-1(syb5560[mNG::zyx-1a, deltaLIM1-3])II | This paper | SU1090 |
| C. elegans SU1091: tes-1(jc110[mScarlet-I::FLAG::tes-1+LoxP511])IV; zyx-1(cp415[mNG::zyx-1a])II | This paper | SU1091 |
| C. elegans SU1094: zyx-1(cp415[mNG::zyx-1a])II; tes-1(ok1036)IV | This paper | SU1094 |
| C. elegans SU1100: zyx-1(gk190)II; curIs[plin-26::lifeact::mcherry::unc-54 3'UTR; unc-119(+)] | This paper | SU1100 |
| C. elegans SU1101: tes-1(syb5622[mNG::FLAG::tes-1, deltaLIM1-3])IV; curIs[plin-26::lifeact::mcherry::unc-54 3'UTR; unc-119(+)] | This paper | SU1101 |
| C. elegans SU1107: zyx-1Δ(cp419[Pmyo-2>GFP])II; tes-1(syb5622[mNG::FLAG::tes-1, deltaLIM1-3])IV | This paper | SU1107 |
| C. elegans SU496: N2; jcEx159 [5kbptes-1::tes-1::gfp; pRF4; F35D3] | This paper | SU496 |
| C. elegans SU708: N2; jcEx229[pRF4; Ptes-1::tes-1deltaPET::gfp F2-8; F35D3] | This paper | SU708 |
| C. elegans SU709: N2; jcEx230[pRF4; Ptes-1::tes-1deltaPET::gfp F2-6; F35D3] | This paper | SU709 |
| C. elegans SU710: N2; jcEx231[pRF4; Ptes-1::tes-1deltaLIM1::gfp; F35D3] | This paper | SU710 |
| C. elegans SU713: N2; jcEx234[pRF4; Ptes-1::tes-1deltaLIM2::gfp F2-7; F35D3] | This paper | SU713 |
| C. elegans SU714: N2; jcEx235[pRF4; Ptes-1::tes-1deltaLIM3::gfp; F35D3] | This paper | SU714 |
| C. elegans SU715: N2; jcEx236[pRF4; Ptes-1::tes-1deltaLIM1-3::gfp; F35D3] | This paper | SU715 |
| C. elegans SU896: hmp-1(jc58[hmp-1::mScarlet-I + Lox511])V | This paper | SU896 |
| C. elegans SU931: curIs[plin-26::lifeact::mcherry::unc-54 3'UTR; unc-119(+)] | This paper | SU931 |
| C. elegans SU955: tes-1(jc71[mNG::FLAG::tes-1])IV | This paper | SU955 |
| C. elegans VC299: zyx-1(gk190)II | Moerman Lab | VC299 |
| C. elegans VC696: tes-1(ok1036)IV | Moerman Lab | VC696 |
| Oligonucleotides | ||
| tes-1 N-terminal 5’ Homology arm Forward Primer: GGCTGCTCTTCgTGGtttcttacctattttaaaatgacacctgcc | IDT | N/A |
| tes-1 N-terminal 5’ Homology arm Reverse Primer: GGGTGCTCTTCgCATCATtactgaaattaattggcatttaacgct | IDT | N/A |
| tes-1 N-terminal 3’ Homology arm Forward Primer: GGCTGCTCTTCgACGACCGACGTCACGTCTCCCGTTGTtGAC | IDT | N/A |
| tes-1 N-terminal 3’ Homology arm Reverse Primer: GGGTGCTCTTCgTACGTCTGGAAGTGGTGCCCACGCATAC | IDT | N/A |
| tes-1 N-terminal sgRNA: GCACGGCTTCTCGTCCACAA | IDT | N/A |
| tes-1 2kb promoter amplify Forward Primer: GCGTCGACGAGTTTTTGTCAAGAGTAAGAC | IDT | N/A |
| tes-1 2kb promoter amplify Reverse Primer: GCCCCGGGATCAACTGATCATCCGGATTCG | IDT | N/A |
| tes-1 5kb promoter amplify Forward Primer: GCCTGCAGGAAGACAACGCTTGTCAAGAAT | IDT | N/A |
| tes-1 5kb promoter amplify Reverse Primer: GCGTCGACATTTTGCCCTCGAAATGCAATAC | IDT | N/A |
| Recombinant DNA | ||
| cDNA yk662b10 (hmr-1) | NEXTDB, Kohara Lab | https://nematode.nig.ac.jp/doc/readme.php |
| cDNA yk285a2 (ajm-1) | NEXTDB, Kohara Lab | https://nematode.nig.ac.jp/doc/readme.php |
| cDNA yk1054c06 (zyx-1) | NEXTDB, Kohara Lab | https://nematode.nig.ac.jp/doc/readme.php |
| Plasmid: pPD95_75 | Addgene | Addgene_1494 |
| F35D3 | Whitfield et al.37 | N/A |
| pRF4 [rol-6(su1006) transgenic marker] | Mello et al.38 | N/A |
| Cbr-unc-119(+) | Maduro et al.39 | N/A |
| Pmyo-2::dTomato | Korswagen Lab | N/A |
| Plasmid: Ptes-1(2kb)::tes-1::gfp | This paper | pAML224 |
| Plasmid: Ptes-1(5kb)::tes-1::gfp | This paper | pAML224v2 |
| Plasmid: SUMO-His-hmp-1 | Callaci et al., 11 | N/A |
| Software and algorithms | ||
| Fiji | ImageJ | https://imagej.nih.gov/ij/ |
| GraphPad Prism v.9.0 | GraphPad | https://www.graphpad.com/scientific-software/prism/ |
| Adobe illustrator | Adobe | https://www.adobe.com |
| Micromanager | Micromanager | https://micro-manager.org/ |
| Fusion | Andor | https://andor.oxinst.com/downloads/view/fusion-release-2.3 |
| Imaris | Imaris | https://imaris.oxinst.com/ |
| QuickTime movie plugins for ImageJ | Hardin Lab | https://worms.zoology.wisc.edu/research/4d/4d.html |
| JACoP Plugins | ImageJ | https://imagej.nih.gov/ij/plugins/track/jacop.html |
NIH 3T3 fibroblasts (American Type Culture Collection, Manassas, VA) and mouse embryonic fibroblasts (MEFs) were cultured in DMEM media (Mediatech, Herndon, VA) and supplemented with 10% fetal bovine serum (HyClone; ThermoFisher Scientific, Hampton, NH), 2 mM L-glutamine (Invitrogen, Caarlsbad, CA) and penicillin–streptomycin (Invitrogen).
METHOD DETAILS
Molecular cloning
A ~5kb genomic sequence containing 2kb promoter and entire genomic region of tes-1 was PCR amplified using Phusion polymerase (ThermoFisher). The primers used were: 5’ GCGTCGACGAGTTTTTGTCAAGAGTAAGAC and 3’ GCCCCGGGATCAACTGATCATCCGGATTCG. The PCR product was digested with SalI and SmaI and ligated into a similarly digested Fire lab vector pPD95.75, which contains the GFP sequence. A frameshift was repaired via PCR to generate a Ptes-1(2kb)::tes-1::gfp construct (pAML224). To generate Ptes-1(5kb)::tes-1::gfp, additional promoter sequence was PCR amplified using Phusion polymerase. The primers used were: 5’ GCCTGCAGGAAGACAACGCTTGTCAAGAAT and 3’ GCGTCGACATTTTGCCCTCGAAATGCAATAC. The PCR product and pAML224 were digested using PstI and SalI and ligated together to generate pAML224v2. The identity of pAML224v2 was confirmed via sequencing. Domain deletions were performed using circle PCR as described previously 4.
CRISPR
mNG::TES-1 worms were generated via plasmid-based CRISPR/Cas9 34 using repair templates cloned using SapTrap cloning 35. All domain deletions mutations (PHX strains) were generated by SunyBiotech (Fujian, China). Guides, homology arms primers, and single-stranded repair templates for all CRISPR/Cas9 editing can be found in the key resources table.
Microinjection
DNA was microinjected into worms as described previously 36. Briefly, injection mixes consisting of 5ng/μl of transgenic tes-1 DNA constructs, 20 ng/μl of junk DNA (F35D337) and 75 ng/μl of pRF4 (rol-6(su1006) transgenic marker DNA)38 were microinjected into both gonads of hermaphrodites. Progeny were screened for the presence of rol-6(su1006), and stable lines were established by passaging of worms. For zyx-1 transgenics, purified zyx-1 deletion construct DNA (100ng/ml) was mixed with coinjection markers pRF4 (200ng/ml), Cbr-unc-119(+) (30ng/ml)39, and Pmyo-2::dTomato (5ng/ml) (courtesy Rik Korswagen, Utrecht Univ.) diluted in sterile water. At least two stable lines from each injected transgene were. used to analyze expression patterns.
Injection RNA interference was performed as described previously 40. dsRNA was generated using ThermoFisher T7 and/or T3 Megascript kits; templates included Ahringer library 41 clones C10H11.9 (let-502) and C06C3.1 (mel-11), and Kohara clones yk662b10 (hmr-1), yk285a2 (ajm-1), and yk1054c06 (zyx-1) (NEXTDB, http://nematode.lab.nig.ac.jp/).
Antibody and Phalloidin Staining
Immunostaining was performed using freeze-cracking 42. Staining was performed as described previously 43. Embryos were mounted onto poly-L-lysine-coated ring slides and incubated with primary antibodies in PBST and 5% non-fat dry milk overnight at 4°C. Embryos were then incubated with secondary antibodies in PBST and 5% non-fat dry milk for approximately three hours at room temperature. The following primary antibodies were used: 1:1000 mouse-anti-GFP (Invitrogen), 1:1000 rabbit-anti-GFP, 1:4000 polyclonal rabbit-anti-HMP-1, 1:4000 polyclonal rabbit-anti-HMR-1 and 1:200 monoclonal mouse-anti-AJM-1 (MH27). The following secondary antibodies were used: 1:50 anti-rabbit IgG Texas Red, 1:50 anti-rabbit FITC, 1:50 anti-mouse Texas Red and 1:50 anti-mouse FITC.
Phalloidin staining of mutant and wild-type embryos was used to visualize actin in fixed embryos 5. Embryos were mounted on poly-L-lysine-coated ring slides and fixed using the following: 4% paraformaldehyde, 0.1 mg/mL lysolecithin, 48 mM Pipes pH 6.8, 25 mM Hepes pH 6.8, 2 mM MgCl2, and 10 mM EGTA for 20 minutes at room temperature. 1:20 Phalloidin-488 was incubated with embryos at room temperature for 90 minutes. Images of stained embryos were acquired as described below.
For co-immunostaining and phalloidin staining, embryos were gathered in a 1.5 mL Eppendorf tube and permeabilized with a solution of 4% paraformaldehyde, 10% Triton-X-100, 48 mM Pipes pH 6.8, 25 mM Hepes pH 6.8, 2 mM MgCl2 and 10mM EGTA for 20 minutes at room temperature. Embryos were incubated overnight in PBST+5% dry milk+1:1000 rabbit-anti-GFP at 4C on a nutator. Secondary antibodies (1:10 Phalloidin-660 and 1:50 anti-rabbit FITC) were incubated for 2 hours at room temperature. Images of stained embryos were acquired as described below.
DIC Imaging
Four dimensional DIC movies were gathered on either a Nikon Optiphot-2 connected to a QImaging camera or an Olympus BX5 connected to a Scion camera. Mounts were made as previously described 44. QuickTime movie plugins for ImageJ (https://worms.zoology.wisc.edu/research/4d/4d.html) were used to compress and view movies.
Confocal Microscopy
Spinning-disc confocal images of tes-1 transgenics were acquired with a Z-slice spacing of 0.2μm for imaging of actin, 0.3 μm for embryos stained for both GFP and actin, and 0.5μm for all other imaging using either Perkin Elmer Ultraview or Micromanager software 45,46 and a Nikon Eclipse E600 microscope connected to a Yokogawa CSU10 spinning disk scanhead and a Hamamatsu ORCA-ER charge-coupled device (CCD) camera. Junctional/cytoplasmic signal measurements were performed as described previously 47. Fisher’s exact test calculations were performed online at https://www.socscistatistics.com/tests/fisher/default2.aspx or using GraphPad Prism v. 9.0 software (GraphPad Software, San Diego, California USA, www.graphpad.com). The extension of Fisher’s exact test to a 4 × 2 contingency table48 was performed online at http://vassarstats.net/fisher2x4.html. Other statistical analyses were performed using GraphPad Prism. For zyx-1 transgenics, imaging was carried out using a Zeiss LSM 710 laser scanning confocal microscope equipped with 10x and 63x oil lenses. For endogenous knock-ins, imaging was performed using a Dragonfly 500 spinning disc confocal microscope (Andor Corp., Belfast, Ireland), mounted on a Leica DMi8 microscope, equipped with a Zyla camera and controlled by Fusion software (Andor Corp.). Images were collected using 0.18 μm slices with a 100×/1.3 NA oil immersion Leica objective at 20°C.
Colocalization Analysis
Colocalization analysis was performed in Fiji using Just Another Colocalization Plugin (JACoP; https://imagej.nih.gov/ij/plugins/track/jacop.html) 49. 5 focal planes from >10 junctional segments were combined into single stacks for each genotype. Maximum intensity Z projections were obtained, and automated Costes thresholding within JACoP was visually confirmed in each case. Significant difference in Pearson’s R for colocalizations was assessed using the online Z calculator available at http://vassarstats.net/rdiff.html
Protein Expression and Purification
GST- and SUMO-His-tagged proteins were expressed in BL21-Gold (DE3) Escherichia coli cells and purified as described 50,51. Cells were induced with 0.1mM IPTG at 18°C for 16 hours. Wash and elution buffers were as follows: GST wash (1X PBS, 500mM NaCl, 0.1% Tween-20, and 1mM DTT), GST elution (50mM Tris pH 8.0, 0.3% glutathione, 150mM NaCl), His wash (50mM Na-Phosphate pH 8.0, 300mM NaCl, 0.1% Tween-20, 10mM Imidazole), and His elution (250mM Imidazole, 100mM NaCl, 10% glycerol, 50mM Hepes pH 7.6). For actin-pelleting assays, the GST tag was cleaved from GST-TES-1 using ProTEV Plus (Promega), according to manufacturer’s instructions.
Actin-Pelleting Assays
Actin co-sedimentation assays were performed as described previously 50. Briefly, 5μM purified, cleaved proteins (quantified via a Bradford Assay) were incubated at room temperature for one hour with 0 or 5μM polymerized chicken F-actin (Cytoskeleton, Inc.). BSA was used a negative control, and SUMO-His-HMP-1 11 was used as a positive control. Samples were then centrifuged at 100,000 rpm for 20 min at 4°C in a TLA-120.1 rotor using a Beckman Optima tabletop ultracentrifuge. Samples were run on 12% SDS-PAGE gels, stained with Coomassie Brilliant Blue, and bands were quantified using ImageJ.
Co-immunoprecipitations and Western Blots
C. elegans expressing TES-1::GFP were grown in liquid culture as previously described 52. Co-immunoprecipitations were completed as in 32. Western blots were performed as described previously 53, using rabbit anti-GFP, rabbit anti-HMP-1 11 and mouse anti-ZYX-1 54 primary antibodies and Li-COR IRDye® secondary antibodies to detect proteins.
Stress fiber strain site assay
A tes-1 LCR::mCherry construct was designed and expressed using the procedures described in detail by Winkelman et al. 2. Briefly, a synthetic gBlock DNA encoding a mammalian codon-optimized version of the LIM1-3 domain of TES-1 was ordered from IDT (Coralville, Iowa) and cloned into a CMV-driven expression vector that fused the C-terminus of LCR(Tes) to mCherry, and used to transfect zyxin −/− mouse embryo fibroblast cells (MEFs) rescued with stably integrated GFP-zyxin. Transfected MEFs were imaged on an inverted Nikon Ti-E microscope (Nikon, Melville, NY) with a Yokogawa CSU-X confocal scanhead and Zyla 4.2 sCMOS Camera (Andor, Belfast, UK). A 405 nm laser coupled to a Mosaic digital micromirror device (Andor) was used to locally damage stress fibers. Kymography of TES-1(LIM1-3)::GFP was performed using ImageJ as described in 2.
QUANTIFICATION AND STATISTICAL ANALYSIS
Graphs were generated using GraphPad Prism. Unpaired Student’s T-test or ANOVA was used to determine statistically significant differences between groups. Statistical test parameters, outcomes and reporting on number of samples used in each experiment are indicated in figure legends.
Supplementary Material
Time lapse movie comparing hmp-1(fe4) homozygous and hmp-1(fe4); tes-1(RNAi) embryos. The latter fail consistently during early elongation, and all develop the Humpback phenotype. Time is shown in hours:minutes.
Time lapse movie showing laser induction of a stress fiber strain site (SFSS) in a representative zyxin −/− mouse embryo fibroblast (MEF) rescued with stably integrated M. musculus GFP-zyxin and transiently transfected with a construct encoding ZYX-1 LCR::mCherry related to Figure 4D. White box show where light was targeted, and white arrows denote developing SFSS. Time is shown in minutes:sec.
Time lapse movie showing laser induction of a stress fiber strain site (SFSS) in a representative zyxin −/− mouse embryo fibroblast (MEF) rescued with stably integrated M. musculus GFP-zyxin and transiently transfected with a construct encoding TES-1 LCR::mCherry related to Figure 4F. White box show where light was targeted, and white arrows denote developing SFSS. Time is shown in minutes:sec.
Cell-cell junctions are vulnerable to damage due to high tension generated during dramatic morphogenetic changes. Lynch et al. show that the LIM domain-containing repeat proteins TES-1/Tes and ZYX-1/Zyxin are components of a multicellular, tension-sensitive system that stabilizes the junctional actin cytoskeleton during embryonic morphogenesis.
TES-1 and ZYX-1 promote the integrity of actin networks during elongation
The LIM domains of TES-1 and ZYX-1 are required for normal function and localization
TES-1 and ZYX-1 are recruited to apical junctions in a tension-dependent manner
Both TES-1 and ZYX-1 can be recruited to strained actin fibers
ACKNOWLEDGEMENTS
cDNA clones for hmr-1, ajm-1, zyx-1, zoo-1, hmp-1, and tes-1 (yk collection) were provided by Yuji Kohara (National Institute of Genetics). A.L., Y.Z., B.L., S.M., and J.H. were supported by NIH grants R01GM058038 and MIRA R35GM145312 awarded to J.H.; B.M. was supported by a Gilliam Fellowship from the Howard Hughes Medical Institute, and by an Advanced Opportunities Fellowship and a COVID-19 dissertation completion fellowship from the University of Wisconsin-Madison; S.B. and A.A. were supported by NIH grant R35GM134865 awarded to A.A.; J.W. was supported by NIH grant F32GM122372 and by NIH grant R01GM104032 and Army Research Office Multidisciplinary University Research Initiative W911NF1410403 awarded to M.G.; B.G. and M.M.S. were supported by NIH MIRA R35GM134838 awarded to B.G. and NIH F32GM119348 awarded to M.M.S. Some strains were provided by the Caenorhabditis Genetics Center (CGC; https://cbs.umn.edu/cgc/home), which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440).
Abbreviations used in this study:
- AJ
adherens junction
- CCC
cadherin-catenin complex
- CFB
circumferential filament bundle
- DIC
differential interference contrast
- LIM
Lin-l1, Isl-1, Mec-3
- PET
Prickle, Espinas, Testin
- CR
cysteine-rich
- SFSS
stress fiber strain site
Footnotes
Declaration of Interests
The authors declare no competing or financial interests.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
REFERENCES
- 1.Smith MA, Hoffman LM, and Beckerle MC (2014). LIM proteins in actin cytoskeleton mechanoresponse. Trends Cell Biol 24, 575–583. 10.1016/j.tcb.2014.04.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Winkelman JD, Anderson CA, Suarez C, Kovar DR, and Gardel ML (2020). Evolutionarily diverse LIM domain-containing proteins bind stressed actin filaments through a conserved mechanism. Proc Natl Acad Sci U S A. 10.1073/pnas.2004656117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Sun X, Phua DYZ, Axiotakis L Jr., Smith MA, Blankman E, Gong R, Cail RC, Espinosa de Los Reyes S, Beckerle MC, Waterman CM et al. (2020). Mechanosensing through Direct Binding of Tensed F-Actin by LIM Domains. Dev Cell 55, 468–482 e467. 10.1016/j.devcel.2020.09.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Lynch AM, Grana T, Cox-Paulson E, Couthier A, Cameron M, Chin-Sang I, Pettitt J, and Hardin J (2012). A Genome-wide Functional Screen Shows MAGI-1 Is an L1CAM-Dependent Stabilizer of Apical Junctions in C. elegans. Curr Biol 22, 1891–1899. 10.1016/j.cub.2012.08.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Costa M, Raich W, Agbunag C, Leung B, Hardin J, and Priess JR (1998). A putative catenin-cadherin system mediates morphogenesis of the Caenorhabditis elegans embryo. J Cell Biol 141, 297–308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Coutts AS, MacKenzie E, Griffith E, and Black DM (2003). TES is a novel focal adhesion protein with a role in cell spreading. J Cell Sci 116, 897–906. [DOI] [PubMed] [Google Scholar]
- 7.Garvalov BK, Higgins TE, Sutherland JD, Zettl M, Scaplehorn N, Köcher T, Piddini E, Griffiths G, and Way M (2003). The conformational state of Tes regulates its zyxin-dependent recruitment to focal adhesions. J Cell Biol 161, 33–39. 10.1083/jcb.200211015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Kang H, Bang I, Weis WI, and Choi HJ (2016). Purification, crystallization and initial crystallographic analysis of the α-catenin homologue HMP-1 from Caenorhabditis elegans. Acta Crystallogr F Struct Biol Commun 72, 234–239. 10.1107/s2053230×16001862. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Oldenburg J, van der Krogt G, Twiss F, Bongaarts A, Habani Y, Slotman JA, Houtsmuller A, Huveneers S, and de Rooij J (2015). VASP, zyxin and TES are tension-dependent members of Focal Adherens Junctions independent of the α-catenin-vinculin module. Sci Rep 5, 17225. 10.1038/srep17225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sala S, Van Troys M, Medves S, Catillon M, Timmerman E, Staes A, Schaffner-Reckinger E, Gevaert K, and Ampe C (2017). Expanding the Interactome of TES by Exploiting TES Modules with Different Subcellular Localizations. J Proteome Res 16, 2054–2071. 10.1021/acs.jproteome.7b00034. [DOI] [PubMed] [Google Scholar]
- 11.Callaci S, Morrison K, Shao X, Schuh AL, Wang Y, Yates JR, Hardin J, and Audhya A (2015). Phosphoregulation of the C. elegans cadherin-catenin complex. Biochem J 472, 339–352. 10.1042/bj20150410. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Cheah JS, Jacobs KA, Lai TW, Caballelo R, Yee JL, Ueda S, Heinrich V, and Yamada S (2021). Spatial proximity of proteins surrounding zyxin under force-bearing conditions. Mol Biol Cell 32, 1221–1228. 10.1091/mbc.E19-10-0568. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Sala S, Catillon M, Hadzic E, Schaffner-Reckinger E, Van Troys M, and Ampe C (2017). The PET and LIM1-2 domains of testin contribute to intramolecular and homodimeric interactions. PLoS One 12, e0177879. 10.1371/journal.pone.0177879. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Sala S, and Oakes PW (2021). Stress fiber strain recognition by the LIM protein testin is cryptic and mediated by RhoA. Mol Biol Cell 32, 1758–1771. 10.1091/mbc.E21-03-0156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Winkelman JD, Anderson CA, Suarez C, Kovar DR, and Gardel ML (2020). Evolutionarily diverse LIM domain-containing proteins bind stressed actin filaments through a conserved mechanism. Proc Natl Acad Sci U S A 117, 25532–25542. 10.1073/pnas.2004656117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Griffith E, Coutts AS, and Black DM (2005). RNAi knockdown of the focal adhesion protein TES reveals its role in actin stress fibre organisation. Cell Motil Cytoskeleton 60, 140–152. 10.1002/cm.20052. [DOI] [PubMed] [Google Scholar]
- 17.Priess JR, and Hirsh DI (1986). Caenorhabditis elegans morphogenesis: the role of the cytoskeleton in elongation of the embryo. Dev Biol 117, 156–173. [DOI] [PubMed] [Google Scholar]
- 18.Piekny AJ, Johnson JL, Cham GD, and Mains PE (2003). The Caenorhabditis elegans nonmuscle myosin genes nmy-1 and nmy-2 function as redundant components of the let-502/Rho-binding kinase and mel-11/myosin phosphatase pathway during embryonic morphogenesis. Development 130, 5695–5704. 10.1242/dev.00807. [DOI] [PubMed] [Google Scholar]
- 19.Wissmann A, Ingles J, and Mains PE (1999). The Caenorhabditis elegans mel-11 myosin phosphatase regulatory subunit affects tissue contraction in the somatic gonad and the embryonic epidermis and genetically interacts with the Rac signaling pathway. Dev Biol 209, 111–127. 10.1006/dbio.1999.9242. [DOI] [PubMed] [Google Scholar]
- 20.Wissmann A, Ingles J, McGhee JD, and Mains PE (1997). Caenorhabditis elegans LET-502 is related to Rho-binding kinases and human myotonic dystrophy kinase and interacts genetically with a homolog of the regulatory subunit of smooth muscle myosin phosphatase to affect cell shape. Genes Dev 11, 409–422. [DOI] [PubMed] [Google Scholar]
- 21.Vuong-Brender TT, Ben Amar M, Pontabry J, and Labouesse M (2017). The interplay of stiffness and force anisotropies drives embryo elongation. Elife 6. 10.7554/eLife.23866. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Vasioukhin V, Bauer C, Yin M, and Fuchs E (2000). Directed actin polymerization is the driving force for epithelial cell-cell adhesion. Cell 100, 209–219. [DOI] [PubMed] [Google Scholar]
- 23.Slabodnick* MM, Tintori* SC, Prakash M, Higgins CD, Chen AH, Cupp TD, Wong T, Bowie E, Jug F, and Goldstein B (2022). Afadin and zyxin contribute to coupling between cell junctions and contractile actomyosin networks during apical constriction. Submitted. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Lecroisey C, Martin E, Mariol MC, Granger L, Schwab Y, Labouesse M, Ségalat L, and Gieseler K (2008). DYC-1, a protein functionally linked to dystrophin in Caenorhabditis elegans is associated with the dense body, where it interacts with the muscle LIM domain protein ZYX-1. Mol Biol Cell 19, 785–796. 10.1091/mbc.E07-05-0497. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Smith P, Leung-Chiu WM, Montgomery R, Orsborn A, Kuznicki K, Gressman-Coberly E, Mutapcic L, and Bennett K (2002). The GLH proteins, Caenorhabditis elegans P granule components, associate with CSN-5 and KGB-1, proteins necessary for fertility, and with ZYX-1, a predicted cytoskeletal protein. Dev Biol 251, 333–347. [DOI] [PubMed] [Google Scholar]
- 26.Smith MA, Blankman E, Gardel ML, Luettjohann L, Waterman CM, and Beckerle MC (2010). A zyxin-mediated mechanism for actin stress fiber maintenance and repair. Dev Cell 19, 365–376. 10.1016/j.devcel.2010.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Hadzic E, Catillon M, Halavatyi A, Medves S, Van Troys M, Moes M, Baird MA, Davidson MW, Schaffner-Reckinger E, Ampe C et al. (2015). Delineating the Tes Interaction Site in Zyxin and Studying Cellular Effects of Its Disruption. PLoS One 10, e0140511. 10.1371/journal.pone.0140511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Diogon M, Wissler F, Quintin S, Nagamatsu Y, Sookhareea S, Landmann F, Hutter H, Vitale N, and Labouesse M (2007). The RhoGAP RGA-2 and LET-502/ROCK achieve a balance of actomyosin-dependent forces in C. elegans epidermis to control morphogenesis. Development 134, 2469–2479. 10.1242/dev.005074. [DOI] [PubMed] [Google Scholar]
- 29.Gally C, Wissler F, Zahreddine H, Quintin S, Landmann F, and Labouesse M (2009). Myosin II regulation during C. elegans embryonic elongation: LET-502/ROCK, MRCK-1 and PAK-1, three kinases with different roles. Development 136, 3109–3119. 10.1242/dev.039412. [DOI] [PubMed] [Google Scholar]
- 30.Zhang H, Landmann F, Zahreddine H, Rodriguez D, Koch M, and Labouesse M (2011). A tension-induced mechanotransduction pathway promotes epithelial morphogenesis. Nature 471, 99–103. 10.1038/nature09765. [DOI] [PubMed] [Google Scholar]
- 31.Chan BG, Rocheleau SK, Smit RB, and Mains PE (2015). The Rho guanine exchange factor RHGF-2 acts through the Rho-binding kinase LET-502 to mediate embryonic elongation in C. elegans. Dev Biol 405, 250–259. 10.1016/j.ydbio.2015.07.010. [DOI] [PubMed] [Google Scholar]
- 32.Cox-Paulson EA, Walck-Shannon E, Lynch AM, Yamashiro S, Zaidel-Bar R, Eno CC, Ono S, and Hardin J (2012). Tropomodulin protects alpha-catenin-dependent junctional-actin networks under stress during epithelial morphogenesis. Curr Biol 22, 1500–1505. 10.1016/j.cub.2012.06.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Brenner S (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Dickinson DJ, Pani AM, Heppert JK, Higgins CD, and Goldstein B (2015). Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics 200, 1035–1049. 10.1534/genetics.115.178335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Schwartz ML, and Jorgensen EM (2016). SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans. Genetics 202, 1277–1288. 10.1534/genetics.115.184275. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Mello C, and Fire A (1995). Chapter 19 DNA Transformation. Caenorhubditis elegans: Modern Biologcal Analysis of an Organism. Elsevier BV. [Google Scholar]
- 37.Whitfield CW, Benard C, Barnes T, Hekimi S, and Kim SK (1999). Basolateral localization of the Caenorhabditis elegans epidermal growth factor receptor in epithelial cells by the PDZ protein LIN-10. Mol Biol Cell 10, 2087–2100. 10.1091/mbc.10.6.2087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Mello CC, Kramer JM, Stinchcomb D, and Ambros V (1991). Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J 10, 3959–3970. 10.1002/j.1460-2075.1991.tb04966.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Maduro M, and Pilgrim D (1996). Conservation of function and expression of unc-119 from two Caenorhabditis species despite divergence of non-coding DNA. Gene 183, 77–85. 10.1016/s0378-1119(96)00491-x. [DOI] [PubMed] [Google Scholar]
- 40.Walston T, Tuskey C, Edgar L, Hawkins N, Ellis G, Bowerman B, Wood W, and Hardin J (2004). Multiple Wnt signaling pathways converge to orient the mitotic spindle in early C. elegans embryos. Dev Cell 7, 831–841. 10.1016/j.devcel.2004.10.008. [DOI] [PubMed] [Google Scholar]
- 41.Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, Kanapin A, Le Bot N, Moreno S, Sohrmann M, et al. (2003). Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231–237. 10.1038/nature01278. [DOI] [PubMed] [Google Scholar]
- 42.Albertson DG (1984). Formation of the first cleavage spindle in nematode embryos. Developmental Biology 101, 61–72. 10.1016/0012-1606(84)90117-9. [DOI] [PubMed] [Google Scholar]
- 43.Leung B, Hermann GJ, and Priess JR (1999). Organogenesis of the Caenorhabditis elegans Intestine. Developmental Biology 216, 114–134. 10.1006/dbio.1999.9471. [DOI] [PubMed] [Google Scholar]
- 44.Raich WB, Agbunag C, and Hardin J (1999). Rapid epithelial-sheet sealing in the Caenorhabditis elegans embryo requires cadherin-dependent filopodial priming. Curr Biol 9, 1139–1146. 10.1016/S0960-9822(00)80015-9. [DOI] [PubMed] [Google Scholar]
- 45.Edelstein A, Amodaj N, Hoover K, Vale R, and Stuurman N (2010). Computer Control of Microscopes Using μManager. In Current Protocols in Molecular Biology, (Wiley-Blackwell; ). 10.1002/0471142727.mb1420s92. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Edelstein AD, Tsuchida MA, Amodaj N, Pinkard H, Vale RD, and Stuurman N (2014). Advanced methods of microscope control using μManager software. Journal of Biological Methods 1, 10. 10.14440/jbm.2014.36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Shao X, Lucas B, Strauch J, and Hardin J (2019). The adhesion modulation domain of Caenorhabditis elegans alpha-catenin regulates actin binding during morphogenesis. Mol Biol Cell 30, 2115–2123. 10.1091/mbc.E19-01-0018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Freeman GH, and Halton JH (1951). Note on an exact treatment of contingency, goodness of fit and other problems of significance. Biometrika 38, 141–149. [PubMed] [Google Scholar]
- 49.Bolte S, and Cordelieres FP (2006). A guided tour into subcellular colocalization analysis in light microscopy. J Microsc 224, 213–232. 10.1111/j.1365-2818.2006.01706.x. [DOI] [PubMed] [Google Scholar]
- 50.Maiden SL, Harrison N, Keegan J, Cain B, Lynch AM, Pettitt J, and Hardin J (2013). Specific conserved C-terminal amino acids of Caenorhabditis elegans HMP-1/α-catenin modulate F-actin binding independently of vinculin. J Biol Chem 288, 5694–5706. 10.1074/jbc.M112.438093. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Mayers JR, Fyfe I, Schuh AL, Chapman ER, Edwardson JM, and Audhya A (2011). ESCRT-0 assembles as a heterotetrameric complex on membranes and binds multiple ubiquitinylated cargoes simultaneously. J Biol Chem 286, 9636–9645. 10.1074/jbc.M110.185363. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Stiernagle T (2006). Maintenance of C. elegans. WormBook, 1–11. 10.1895/wormbook.1.101.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Zhang Y, Wang X, Matakatsu H, Fehon R, and Blair SS (2016). The novel SH3 domain protein Dlish/CG10933 mediates fat signaling in Drosophila by binding and regulating Dachs. Elife 5. 10.7554/eLife.16624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Lecroisey C, Brouilly N, Qadota H, Mariol MC, Rochette NC, Martin E, Benian GM, Ségalat L, Mounier N, and Gieseler K (2013). ZYX-1, the unique zyxin protein of Caenorhabditis elegans, is involved in dystrophin-dependent muscle degeneration. Mol Biol Cell 24, 1232–1249. 10.1091/mbc.E12-09-0679. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Time lapse movie comparing hmp-1(fe4) homozygous and hmp-1(fe4); tes-1(RNAi) embryos. The latter fail consistently during early elongation, and all develop the Humpback phenotype. Time is shown in hours:minutes.
Time lapse movie showing laser induction of a stress fiber strain site (SFSS) in a representative zyxin −/− mouse embryo fibroblast (MEF) rescued with stably integrated M. musculus GFP-zyxin and transiently transfected with a construct encoding ZYX-1 LCR::mCherry related to Figure 4D. White box show where light was targeted, and white arrows denote developing SFSS. Time is shown in minutes:sec.
Time lapse movie showing laser induction of a stress fiber strain site (SFSS) in a representative zyxin −/− mouse embryo fibroblast (MEF) rescued with stably integrated M. musculus GFP-zyxin and transiently transfected with a construct encoding TES-1 LCR::mCherry related to Figure 4F. White box show where light was targeted, and white arrows denote developing SFSS. Time is shown in minutes:sec.
Data Availability Statement
All data reported in this paper will be shared by the lead contact upon request.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.




