Abstract
Cowpea is an important source of dietary proteins in the semi-arid regions of sub-Saharan Africa. Its productivity is constrained by several viral diseases and there are limited updates on the incidence and distribution of these diseases in Nigeria. This study assessed the distribution and prevalence of cowpea viruses in Southwest Nigeria. Field surveys were conducted in 2017 and 2018, in which a total of 600 leaf samples were randomly collected from 60 cowpea fields in four (Oyo, Ogun, Ondo and Osun) states at 15 fields per state and 10 samples per field. Disease incidence and severity were recorded while virus infections were confirmed by enzyme-linked immunosorbent assay or reverse transcription polymerase chain reaction. Viral disease symptoms of systemic mosaic, mottling, puckering, vein-banding, leaf deformation and stunted growth were observed. Highest virus incidence and severity (100% and 4.8 ± 0.4) were observed at Adeosun Avenue, Ondo state, whereas Boredun, Osun state had the least (80% and 3.8 ± 0.7), with some symptomless fields found among the states. Seven viruses, viz.: cowpea aphid-borne mosaic virus (CABMV), cowpea mild mottle virus (CPMMV), bean common mosaic virus-blackeye cowpea mosaic strain (BCMV-BlCM), cucumber mosaic virus (CMV), southern bean mosaic virus (SBMV), cowpea mottle virus (CMoV) and cowpea yellow mosaic virus (CYMV) were detected from 173 (28.8%) samples collected from 32 (53.3%) fields across the states. CPMMV was prevalent, detected from 30.0% of surveyed fields, whereas CYMV was the least prevalent (3.3%). Multiple infections of two to four viruses were observed among 12.5% of samples from 51.7% of fields. Highest incidence of single and multiple virus infections were observed in Ondo state. This updates on virus distributions in Southwest Nigeria will be useful for multiple virus resistance-breeding programs and other viral disease management strategies for improved cowpea productivity.
Supplementary Information
The online version contains supplementary material available at 10.1007/s42360-022-00576-8.
Keywords: Cowpea fields, Disease management, Mosaic virus, Multiple infections, RT-PCR, Survey
Introduction
Cowpea (Vigna unguiculata (L.) Walp) is a key grain legume and an important source of dietary proteins in the semi-arid regions of sub-Saharan Africa (SSA). The high protein content, nitrogen fixation abilities and drought tolerance make it very important in SSA, in the context of food and nutritional security (Gomes et al. 2019). It is widely cultivated in West Africa for its protein-enriched seeds for human consumption and the stems used as fodder for livestock (Boukar et al. 2013). About 75% of the cowpea production is concentrated in Niger, Burkina Faso and Nigeria, with the last being the main producer, accounting for about 40.9% of the 8.9 million tons annual global production (FAOSTAT 2020).
The bulk of the production of cowpea is attributed to the semi-arid zones of northern Nigeria despite the increasing economic importance of the commodity in the southern states. However, the current security challenges in the Northern part of Nigeria has been identified as a major factor behind the reduction in cowpea supply to the southern part of the country (Aluko et al. 2016). The attendant threat on food security has thus become an impetus to the need to increase production in other suitable agro-ecologies. Southwest Nigeria is endowed with some spread of savannah agro-ecologies suitable for cowpea production and also blessed with vast genetic pool of local varieties of cowpea cultivated by farmers under different production systems (Saka et al. 2018). Several farmers grow cowpea in Southwest Nigeria either under sole cropping or inter-cropped, usually with cassava (Saka et al. 2018), while most of the national systems as well as International Research Institute in Nigeria, which cultivate large hectares of land for cowpea research and multiplication, are located in the Southwest region. Research efforts have also consistently produced cowpea varieties that are of different maturity periods and adaptability to diverse agro-ecologies of Nigeria (Brader 2002).
Cowpea yield is however constrained by both biotic and abiotic factors. Although, environmental factors such as ozone pollution reduces cowpea productivity (Hayes et al. 2000), biotic factors cause higher and more economical yield losses. The average cowpea yield in Nigeria (about 777 kg ha−1) is low compared to that of many other countries such as Egypt (3674 kg ha−1) and Iraq (5591 kg ha−1) (FAOSTAT 2020), mainly due to infestations by insect pests, parasitic weed striga, and infections by bacterial, fungal and viral diseases (Boukar et al. 2013). Viral diseases are known to reduce cowpea grain yields by 20–80% (Legg et al. 2019). Farmers in Nigeria usually plant cowpea cultivars which are susceptible to viruses. Most of their commercial varieties only consider sweetness, preferred seed colour, seed size and cooking value, and not virus resistance.
The seven cowpea viruses frequently reported in Nigeria are: cowpea aphid-borne mosaic virus (CABMV, genus Potyvirus), bean common mosaic virus-blackeye cowpea mosaic strain (BCMV-BlCM, genus Potyvirus), cowpea yellow mosaic virus [(CYMV, also known as cowpea mosaic virus (CPMV), genus Comovirus)], cowpea mild mottle virus (CPMMV, genus Carlavirus), cucumber mosaic virus (CMV, genus Cucumovirus), southern bean mosaic virus (SBMV, genus Sobemovirus) and cowpea mottle virus (CMoV, genus Gammacarmovirus) (Thottappilly and Rossel 1996; Boukar et al. 2013). These viruses have a wide host range, are transmitted by insect vectors especially by aphids, whiteflies or beetles and are also seed-transmitted in cowpea (Odedara and Kumar 2016). Virus infected cowpea produces different mosaic symptoms, mottling and reduction in yield or plant death in highly susceptible plants (Shoyinka et al. 1997). Some foliar symptoms such as vein-banding from BCMV-BlCM infection and veinal or mid-rib chlorosis for CMV seem to be characteristic of the viruses on cowpea. However, most of these viruses produce common systemic symptoms of mosaic, mottling, puckering, leaf deformation and stunted growth. Hence, symptoms induced on plants by different virus infection can only indicate the presence of virus but cannot be used to identify specific viruses, in which case, diagnostic tools are required for effective identification (Ogunsola et al. 2021).
Coinfection of more than one virus is frequent on the field and multiple infections of two to five viruses on a plant have been reported in Nigeria (Shoyinka et al. 1997), Uganda (Urawu et al. 2015) and Ghana (Adams et al. 2020). Multiple infection is enhanced by infestation by several virus transmitting insect vectors and the occurrence of same insect vectors transmitting many viruses of the same genus or different genera (e.g. Aphis crassivora transmits CABMV, BCMV-BlCM and CMV) (DaPalma et al. 2010). Multiple infections usually result in virus-virus interactions among the co-infecting viruses, which might produce a synergy that can break down the host’s resistance to a single viral disease, leading to a severe pathological response in form of a devastating reduction in cowpea productivity (Ogunsola et al. 2021).
Systematic pest and disease surveillance is a critical component of biovigilance and is key in identifying current problems and anticipating potential threats to crops (Carisse et al. 2017). A survey of cowpea viruses conducted in 1991–1993 throughout all agro-ecological zones in Nigeria earlier indicated the incidence of six viruses, viz; CABMV, CYMV, CMoV, BCMV-BlCM, SBMV and CMV in single and multiple infections, with prevalence of SBMV (in 1991) and CABMV (in 1992 and 1993) (Shoyinka et al. 1997). Another field survey in northern Nigeria confirmed the incidence of five of these viruses, with exception only to CYMV (Eni et al. 2013). However, up-to-date information on the incidence, prevalence and distribution of the cowpea viruses is sparse in Nigeria, while this is essential for effective management of viral diseases. Variations in virus population are expected from previous statistics of cowpea viruses in Nigeria due to the fast-evolving nature of viruses and the anthropogenic climate change (Legg et al. 2019). Genetic recombination between isolates originating from different host plants and geo-climatic locations as well as mutations have been reported as the significant mechanisms playing roles in generating diverse populations of plant viruses (Basavaraj et al. 2019).
To remedy the poor yield and low productivity of cowpea caused by viral diseases, information upon the occurrence and distribution of viruses seems to be of utmost important. This will provide the breeding objectives for virus-resistant high yielding cowpea varieties to overcome the low productivity and enhance food and nutritional security in the developing nations, where cowpea is an important source of dietary protein (Ajeigbe et al. 2012). Thus, field surveys of cowpea virus infections, under single or multiple conditions, were conducted in Oyo, Ogun, Ondo and Osun states of Southwestern Nigeria, to obtain a more recent information on the incidence, prevalence and distribution of cowpea infecting viruses in the region. The results of these surveys will be useful in designing appropriate, effective and sustainable management strategies against cowpea viral diseases.
Materials and methods
Field survey of cowpea viruses
A total of 600 cowpea plants (with or without symptoms) were randomly sampled by walking in a “W” shaped path, across 60 cowpea fields (10 leaf samples per field) in four states (Oyo, Ogun, Ondo and Osun states) of the Southwest region of Nigeria as described in Aliyu et al. (2012). Five local government areas (LGA) where cowpea are predominantly cultivated were selected in each state, choosing three fields per LGA. The surveys were conducted during September 2017 and October 2018, coinciding with the vegetative growth or early flowering stage of the plants. Coordinates and altitude of the field locations were measured by a Geographical Positioning System (GPS) device (eTrex Garmin, Taiwan). After collection, the samples were placed in plastic sample bags, kept in an ice box on the field and later stored at 4 °C before the laboratory diagnostic test for viruses. Virus detection was carried out at the Virology and Molecular Diagnostics Laboratory (MDV), International Institute of Tropical Agriculture (IITA) Ibadan, Nigeria.
Evaluation of viral disease incidence, prevalence and severity
Disease incidence was expressed in percentage, by dividing the number of infected samples (samples on which at least one viral species were detected) over the total samples collected × 100 (Odedara et al. 2008). Virus prevalence (virus with the widest occurrence) was assessed by the ratio of the number of fields from which virus was detected over the total number of surveyed fields, expressed as a percentage. Disease severity was determined visually by the symptoms of virus infection on the sampled plants using a symptom severity rating scale of 1–5, where 1 = no visible symptoms, 2 = mild mosaic or mottling on few leaves, 3 = mosaic or mottling on many leaves, 4 = severe mosaic on all the leaves, puckering and mild stunting and 5 = severe mosaic, puckering, leaf distortion, severe stunting with necrosis or death of leaves or plants (Fig. 1) (Shoyinka et al. 1997; Ogunsola et al. 2021).
Fig. 1.
Disease symptom severity rating scale 1–5 of some cowpea viruses: a BCMV-BlCM, b CABMV, c SBMV, d CMoV and e CMV symptoms. Healthy control (1) and symptomatic leaves of virus infected Ife Brown (2–5)
Virus detection by ACP-ELISA
Samples were tested for seven cowpea viruses (CABMV, CPMMV, BCMV-BlCM, CMoV, CMV, SBMV and CYMV) already reported in Nigeria, using homologous anti-rabbit antibodies to individual virus available at the VMD Unit of IITA, Nigeria, with Antigen Coated Plate-Enzyme-linked Immunosorbent Assay (ACP-ELISA) as described in Kumar et al. (2001). About 100 mg of tissue from the leaf apex was used for virus testing in a 96- well NUNC MaxiSorb (Nunc, Denmark) ELISA plate. Alkaline phosphatase (ALP)-labelled anti-rabbit antibodies were used to detect the immobilized antigen–antibody complex, and p-nitrophenylphosphate (Sigma, Gillingham, UK) was used as substrate. After 1 h of incubation, readings were taken at absorbance of 405 nm (A405 nm) in a Multiscan Plus ELISA plate reader (Labsystems, Helsinki, Finland). Sample with ELISA reading (A405 nm) value that is at least twice (2 ×) that of the healthy control was considered as positive to virus.
Virus detection using RT-PCR
Samples that tested negative for virus in ELISA were verified by reverse transcription-polymerase chain reaction (RT-PCR) for reconfirmation. RT-PCR test was performed on four of the seven viruses (BCMV-BlCM, CABMV, CMV and CPMMV) due to some constraints. Total RNA was extracted from 100 mg leaf tissue according to a modified Cetyltrimethyl Ammonium Bromide (CTAB) method (Abarshi et al. 2010) and used for detection of the viruses. Quality of the extracted RNA was analysed by agarose gel electrophoresis earlier described by Kumar (2009). The total RNA concentration and purity were estimated by agarose gel electrophoresis and Nano Drop (2000) spectrophotometer (Thermo Scientific Tegrant Corporation; Wilmington, Delaware, USA), according to the manufacturer’s instructions.
RT-PCR was performed following the procedure described by Kumar (2009) using specific primer pairs (Table 1) corresponding to the respective viruses. PCR amplification was carried out in 12.5 µl reaction mixture comprising 10 × PCR reaction buffer (supplied with Taq enzyme), 0.75 µl of 25 mM MgCl2, 0.25 µl mixture of 10 mM deoxynucleotide triphosphates (dNTPs), 0.25 µl of respective primers, 12 units of Molony-murine leukaemia virus (M-MLV) reverse transcriptase (RT) (Promega Corporation, USA), 0.3 units of Taq DNA polymerase (Promega Corporation, Madison, Wisconsin, USA), 2.0 µl of 10 ng/µl total RNA and sterile distilled water. Amplification was performed with Applied Biosystems (GeneAmp® PCR System 9700) Cycler machine. Amplification of BCMV-BlCM RNA was carried out as follows: one cycle for 30 min at 42 °C and 35 cycles of denaturation at 94 °C for 1 min, primer annealing at 52 °C for 1 min, extension at 72 °C for 1 min and finally, 7 min of extension at 72 °C. CABMV cycling conditions were one cycle for 30 min at 42 °C and 35 cycles of denaturation at 94 °C for 30 s, annealing at 54 °C for 30 s, extension at 72 °C for 30 s and final extension at 72 °C for 5 min. The thermal cycler conditions for CMV and CPMMV were similar to that of CABMV except that annealing temperature was 55 °C for both CMV and CPMMV. Amplified RT-PCR products were separated in 1% (w/v) agarose gels electrophoresis in 0.5 × TBE and visualized under UV transilluminator (BioRad) after staining in ethidium bromide (0.5 µg/ml).
Table 1.
Primers used in RT-PCR
| Virus | Primer | Sequence (5ʹ → 3ʹ) | Fragment size (bp) | References |
|---|---|---|---|---|
| BCMV-BlCM | BCMV F | ATGTGGTACAATGCTGTGAAG | 470 | Kumar (2009) |
| BCMV R | TTTCAGTATTCTCGCTGGTTG | |||
| CABMV | CABMV F | GTACTCCAGTCTGATGGAAAGG | 525 | Kumar (2009) |
| CABMV R | GTCCGAGAAGTGGTGCATAA | |||
| CMV | CMV F | GCCGTAAGCTGGATGGACAA | 538 | Wylie et al. (1993) |
| CMV R | CCGCTTGTGCGTTTAATGGCT | |||
| CPMMV | CPMMV F | CACTTGGAATTTTATGTTGAC | 250 | Yadav et al. (2013) |
| CPMMV R | TCATTTCGATTGGACCTATC |
BCMV-BlCM bean common mosaic virus-blackeye cowpea mosaic strain, CABMV cowpea aphid borne mosaic virus, CMV cucumber mosaic virus, CPMMV cowpea mild mottle virus
Data analysis
Disease incidence data were transformed using Arcsine Transformation and the incidence and severity data were subjected to analysis of variance (ANOVA) using the PROC GLM statement of Statistical Analysis System, version 9.2 (SAS 2008). The means were separated using Duncan multiple range test (DMRT).
Results
Virus incidence and symptom severity
Symptoms of cowpea virus diseases observed at different locations across the four states were mosaic, puckering, mottling, vein-banding, leaf deformation and stunted growth. Although, foliar symptoms, such as vein banding from BCMV-BlCM infection, puckering and leaf deformation by SBMV, mottling for CMoV and veinal chlorosis with mild puckering by CMV, seem characteristic of some of the viruses on cowpea, a systemic foliar symptoms of mosaic, chlorosis and stunting were common among the viruses. Symptoms severity ranged from moderate to severe whereas, some cowpea plants were symptomless. Aphids and whiteflies were the main insect vectors found on most of the infected fields, while leaf beetles and other cowpea infecting insects were observed in some locations. Symptomatology and diagnosis demonstrated that virus incidence and severity differed significantly (p < 0.0001) among field locations (Table 2). Higher incidence corresponded to higher virus disease severity in most of the fields. Among the areas with virus presence, highest incidence and severity of viruses were observed at Adeosun Avenue, Ondo state (100% and 4.8 ± 0.4), followed by Ogun (90% and 4.8 ± 0.4), Oyo (90% and 3.3 ± 0.5) while the least disease incidence and severity were recorded in Osun state (80% and 3.8 ± 0.7). However, some fields in each of the states had no viral symptom (0% and 1.0) while Ogun state had the highest number of symptomless fields (10).
Table 2.
Incidence and severity of single and multiple viral infections of cowpea in Southwest Nigeria
| State | LGAa | Field locationb | Location coordinates | Elevation (m) | Detected virusc | Incidence (%) | Severity | |
|---|---|---|---|---|---|---|---|---|
| Oyo | Ido | Omi Adio | 7° 22′ 57.32″ N | 3° 45′ 0.14″ E | 158 | CP, CM | 30efg* | 3.3 ± 0.6hij |
| Idi-amu Ido | 7° 31′ 10.20″ N | 3° 41′ 56.33″ E | 184 | – | 0g | 1.0 ± 0n | ||
| Bako | 7° 24′ 5.90″ N | 3° 46′ 20.97″ E | 175 | CP | 80abc | 2.8 ± 0.5kl | ||
| Ibadan N.E | Monantan | 7° 25′ 9.08″ N | 3° 57′ 51.8″ E | 237 | – | 0g | 1.0 ± 0n | |
| Iwo Road | 7° 24′ 11.48″ N | 3° 56′ 34.19″ E | 232 | – | 0g | 1.0 ± 0n | ||
| Academy | 7° 24′ 45.50″ N | 3° 57′ 14.83″ E | 256 | – | 0g | 1.0 ± 0n | ||
| Akinyele | Alabata | 7° 35′ 22.2″ N | 3° 52′ 11.50″ E | 280 | – | 0g | 1.0 ± 0n | |
| Elekuru | 7° 35′ 42.0″ N | 3° 51′ 48.24″ E | 272 | CP | 30efg | 3.0 ± 0jk | ||
| Moniya | 7° 29′ 53.84″ N | 3° 54′ 24.62″ E | 245 | – | 0g | 1.0 ± 0n | ||
| Oyo East | Fashola Odo ogun | 7° 52′ 59.98″ N | 3° 31′ 0.0″ E | 248 | SB, CY | 30efg | 3.0 ± 1.0jk | |
| Shonku, Oyo rd | 7° 54′ 0.0″ N | 3° 45′ 0.0″ E | 213 | – | 0g | 1.0 ± 0n | ||
| Fashola | 7° 53′ 27.35″ N | 3° 46′ 59.88″ E | 291 | – | 0g | 1.0 ± 0n | ||
| Ibadan S.W | IAR&T Apata | 7° 22′ 41.30″ N | 3° 50′ 38.33″ E | 158 | CP, CA, BC | 50cdef | 4.0 ± 0.7ef | |
| NCRI Apata | 7° 23′ 12.44″ N | 3° 50′ 30.3″ E | 167 | CA, CP | 90ab | 3.3 ± 0.5hij | ||
| Odo Ona | 7° 23′ 1.18″ N | 3° 50′ 48.84″ E | 172 | SB, CY | 30efg | 3.7 ± 0.6fgh | ||
| Ogun | Odeda | Alabata | 7° 14′ 4.34″ N | 3° 26′ 36.24″ E | 175 | CP, CM | 40def | 2.5 ± 0.6l |
| Odeda | 7° 13′ 58.55″ N | 3° 32′ 51.61″ E | 127 | – | 0g | 1.0 ± 0n | ||
| Osiele Idera | 7° 11′ 49.2″ N | 3° 27′ 10.8″ E | 161 | – | 0g | 1.0 ± 0n | ||
| Ifo | Onihale | 6° 45′ 54.83″ N | 3° 12′ 53.17″ E | 49 | – | 0g | 1.0 ± 0n | |
| Kajola | 6° 46′ 49.51″ N | 3° 13′ 56.35″ E | 66 | CP, SB, CM, CMo | 90ab | 4.8 ± 0.4abc | ||
| Oko Paki | 6° 46′ 36.41″ N | 3° 13′ 58.51″ E | 70 | CP, CA, BC | 20fg | 2.0 ± 0m | ||
| Ipokia | Idiroko | 6° 38′ 21.91″ N | 2° 44′ 42.32″ E | 84 | – | 0g | 1.0 ± 0n | |
| Ilase | 6° 41′ 24.61″ N | 2° 47′ 15.22″ E | 48 | – | 0g | 1.0 ± 0n | ||
| Ihunbo | 6° 41′ 16.30″ N | 2° 44′ 39.48″ E | 70 | – | 0g | 1.0 ± 0n | ||
| Ado Odo Ota | Otta | 6° 41′ 32.82″ N | 3° 9′ 53.71″ E | 21 | – | 0g | 1.0 ± 0n | |
| Iju | 6° 39′ 17.42″ N | 3° 8′ 9.78″ E | 38 | – | 0g | 1.0 ± 0n | ||
| Atan | 6° 38′ 18.96″ N | 3° 8′ 17.77″ E | 27 | – | 0g | 1.0 ± 0n | ||
| Yewa South | Alagbo | 6° 41′ 13.24″ N | 3° 0′ 38.48″ E | 51 | CP, CM | 0g | 1.0 ± 0n | |
| Owode | 6° 41′ 59.24″ N | 2° 57′ 43.38″ E | 52 | CP, CA, BC | 60bcde | 4.2 ± 0.8de | ||
| Ajilete | 6° 41′ 59.64″ N | 2° 55′ 52.67″ E | 42 | – | 0g | 1.0 ± 0n | ||
| Ondo | Akure North | Adeosun Avenue | 7° 15′ 50.58"N | 5° 14′ 23.75"E | 360 | CP, CA, BC, CMo | 100a | 4.8 ± 0.4ab |
| Omowale | 7° 15′ 33.21″ N | 5° 14′ 36.18″ E | 351 | CM | 60bcde | 4.2 ± 0.4de | ||
| Oba Ile Estate | 7° 15′ 16.70″ N | 5° 14′ 23.88″ E | 328 | CM | 80abc | 4.8 ± 0.5abc | ||
| Ose | Elegbeka | 6° 58′ 49.52″ N | 5° 40′ 23.91″ E | 144 | CP, CA, CMo | 40def | 2.8 ± 0.5kl | |
| Ifon | 6° 55′ 56.68″ N | 5° 45′ 57.01″ E | 153 | BC, CMo | 80abc | 4.4 ± 0.5cde | ||
| Elegbeka Express | 7° 0′ 2.58″ N | 5° 41′ 56.33″ E | 197 | CP, CA, BC, CMo | 70abcd | 5.0 ± 0a | ||
| Akoko N.E | Okorun Titun | 7° 30′ 59.10″ N | 5° 42′ 44.67″ E | 448 | unidentified | 80abc | 4.7 ± 0.5abc | |
| Apen | 7° 31′ 20.33″ N | 5° 41′ 15.71″ E | 446 | – | 0g | 1.0 ± 0n | ||
| Asere Awara | 7° 30′ 59.09″ N | 5° 42′ 45.15″ E | 452 | CP, CA, BC | 70abcd | 3.7 ± 0.5gfh | ||
| Akoko S.W | Oba Akoko | 7° 22′ 9.78″ N | 5° 43′ 25.53″ E | 310 | CP, CA | 70abcd | 4.6 ± 0.8bc | |
| Oba Expressway | 7° 21′ 2.13″ N | 5° 41′ 55.45″ E | 267 | CP, CA | 60bcde | 3.2 ± 0.8ij | ||
| Ose Oba Akoko | 7° 19′ 4.77″ N | 5° 40′ 26.19″ E | 241 | – | 0g | 1.0 ± 0n | ||
| Akure South | Owena | 7° 14′ 10.00″ N | 5° 8′ 35.85″ E | 328 | – | 0g | 1.0 ± 0n | |
| Emiloro Oda | 7° 10′ 9.37″ N | 5° 13′ 41.35″ E | 327 | – | 0g | 1.0 ± 0n | ||
| Alagbaka | 7° 13’37.10”N | 5° 12’55.28”E | 352 | - | 0 g | 1.0 ± 0n | ||
| Osun | Boripe | Oni oba | 7° 48’25.21”N | 4° 37’26.98”E | 348 | CM | 0 g | 1.0 ± 0n |
| Idi Okiti | 7° 48’26.99”N | 4° 36’39.66”E | 367 | CA, BC | 50cdef | 4.4 ± 0.6bcd | ||
| Idi Okiti 2 | 7° 48’28.31”N | 4° 36’28.78”E | 378 | CP, CA, BC | 40def | 4.5 ± 0.6bcd | ||
| Osogbo | Boredun | 7° 34’55.21”N | 4° 36’29.48”E | 351 | CA | 80abc | 3.8 ± 0.7 fg | |
| Uni. Osun | 7 ° 45’26.56”N | 4° 36’17.92”E | 330 | - | 0 g | 1.0 ± 0n | ||
| Oke Bale | 7° 45’47.11”N | 4° 34’29.38”E | 356 | CA, BC | 20 fg | 3.5 ± 0.7ghi | ||
| Olorunda | Kelebe | 7° 48’5.01”N | 4° 35’49.28”E | 355 | CP, CA | 20 fg | 2.5 ± 0.7 L | |
| Agric. Min. | 7° 47’53.37”N | 4° 36’37.02”E | 351 | unidentified | 50cdef | 4.6 ± 0.6abc | ||
| Kelebe 2 | 7° 48’6.12”N | 4° 36’23.00”E | 364 | CA, CY | 30efg | 3.0 ± 1.0jk | ||
| Ifelodun | Dominion Ikirun | 7° 55’35.05”N | 4° 38’52.04”E | 358 | - | 0 g | 1.0 ± 0n | |
| Oshogbo rd | 7° 51’14.99”N | 4° 37’15.85”E | 385 | CM | 0 g | 1.0 ± 0n | ||
| Beehive | 7° 51’18.19”N | 4° 37’14.63”E | 383 | - | 0 g | 1.0 ± 0n | ||
| Irewole | Orisumbare Ikire | 7° 23’0.99”N | 4° 11’28.50”E | 194 | - | 0 g | 1.0 ± 0n | |
| Irewole | 7° 22’26.92”N | 4° 10’31.04”E | 206 | - | 0 g | 1.0 ± 0n | ||
| Irewole II | 7° 22’44.42”N | 4° 10’34.37”E | 224 | - | 0 g | 1.0 ± 0n | ||
*Means (values represent means from 2017 and 2018 data) followed by the same letter are not significantly different by DMRT (p < 0.0001)
aLGA, Local government area, N.E., North east, S.W., Southwest
bUni. Osun, Osun state University; Agric. Min., Ministry of Agriculture
cCP, CPMMV; CA, CABMV; BC, BCMV-BlCM; CY, CYMV; SB, SBMV; CMo, CMoV; “unidentified”, detection of non-identified virus
“-”, no detection of virus
Detection and distribution of cowpea viral infections in Southwest Nigeria
The two diagnostic assays confirmed and identified the viruses on infected plant samples. Viruses were detected from 173 (28.8%) of the total samples collected from 32 (53.3%) of the surveyed fields. Incidence of seven viruses; viz.: CPMMV, CABMV, BCMV-BlCM, CMV, SBMV, CYMV and CMoV were confirmed from cowpea samples collected across the four states of Southwest Nigeria. The seven viruses were detected by ACP-ELISA in many samples, while six of the samples that were negative to viruses by ACP-ELISA tested positive by RT-PCR, one each for BCMV-BlCM and CMV, and four for CPMMV (Fig. 2a, c, d). Oyo and Ogun states were the ones with more virus species diversity, having six species each, with the presence of CPMMV, CABMV, BCMV-BlCM, CMV, SBMV, and CYMV in the first, and CPMMV, CABMV, BCMV-BlCM, CMV, SBMV and CMoV in the second state. Meanwhile, five virus species were detected at both Ondo (CPMMV, CABMV, BCMV-BlCM, CMV and CMoV) and Osun state (CPMMV, CABMV, BCMV-BlCM, CMV and CYMV). In addition, CPMMV, CABMV, BCMV-BlCM, CMV were identified in the four states surveyed whereas SBMV (Oyo and Ogun states), CYMV (Oyo and Osun states) and CMoV (Ogun and Ondo states) were detected only in two states.
Fig. 2.
Detection of A BCMV-BlCM, B CABMV, C CMV and D CPMMV in cowpea by RT-PCR; M = DNA size marker (100 bp ladder; Promega); lanes 1–10 = extracts of 10 cowpea samples with negative results to virus by ACP-ELISA (a = BCMV-BlCM, b = CABMV, c = CMV and d = CPMMV); B = no template control, H = uninfected cowpea sample; D = virus positive control
Single virus infections were detected in some cowpea fields while multiple infections (detection of two of more viruses on a sample) were observed in most of the fields (Table 2). Multiple virus infections generally showed a more severe symptoms in most of the plants and produced a combination of symptoms showed by each of the coinfecting viruses under single infection. The highest number of virus infected plants was recorded in Ondo state in 71 (47.3%) samples collected from 10 (66.7%) fields. This was followed by Osun state with 38 (25.3%) infected samples from 9 (60.0%) fields. Thirty-four (22.7%) infected samples were recorded from 7 (46.7%) fields in Oyo state, while the least was from Ogun state with 30 (20.0%) infected samples obtained from 5 (33.3%) fields.
Latent infections, in which symptomless plants tested positive via ACP-ELISA, were observed. CPMMV and CMV were detected from some symptomless cowpea samples from Alagbo in Ogun state, and CMV from Oni oba and Oshogbo road in Osun state by ACP-ELISA (Table 2). Although, BCMV-BlCM, CMV and CPMMV were detected by ACP-ELISA in many samples, this was not the case for BCMV-BlCM in a sample from Oko paki, CMV in a sample at Alabata both in Ogun state, and CPMMV in four samples from IAR&T Apata in Oyo state, which were detected only by RT-PCR (Fig. 2a, c, d and Table 2). Moreover, all symptomatic leaf samples were positive for viruses with the exception of samples from Okorun Titun, Ondo state and Ministry of Agriculture, Osun state, which were negative to the seven viruses assayed in this study both by ELISA and RT-PCR hence, the suspected viruses were not identified (Table 2).
Prevalence of cowpea viruses in Southwest Nigeria
Of the seven cowpea viruses identified from the study areas, CPMMV was prevalent, detected from 18 (30%) fields (Table 3). Although, CABMV showed wider occurrence on the number of infected samples (16.3%) than CPMMV (12.3%), CPMMV was more widely distributed, detected on more cowpea fields than CABMV. CYMV was the least prevalent (3.3%) on the field.
Table 3.
Prevalence of cowpea viruses in Southwest Nigeria
| Detected | Oyo State | Ogun State | Ondo State | Osun State | Prevalence | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| virus | Sa | S (%) | Fb | F (%) | S | S (%) | F | F (%) | S | S (%) | F | F (%) | S | S (%) | F | F (%) | TSc | TS (%) | TFd | TF (%) |
| CPMMVe | 28 | 18.7 | 5 | 33.3 | 23 | 15.3 | 5 | 33.3 | 10 | 6.7 | 6 | 40.0 | 13 | 8.67 | 2 | 13.3 | 74 | 12.3 | 18 | 30 |
| CABMV | 16 | 10.7 | 2 | 13.3 | 8 | 5.3 | 3 | 20.0 | 50 | 33.3 | 6 | 40.0 | 24 | 16 | 6 | 40.0 | 98 | 16.3 | 17 | 28.3 |
| BCMV-BlCM | 4 | 2.7 | 1 | 6.7 | 6 | 4.0 | 3 | 20.0 | 32 | 21.3 | 4 | 26.7 | 19 | 12.7 | 3 | 20.0 | 61 | 10.2 | 11 | 18.3 |
| CMV | 16 | 10.7 | 2 | 13.3 | 10 | 6.7 | 2 | 13.3 | 16 | 10.7 | 2 | 13.3 | 20 | 13.3 | 2 | 13.3 | 62 | 10.3 | 8 | 13.3 |
| SBMV | 6 | 4.0 | 2 | 13.3 | 6 | 4.0 | 2 | 13.3 | – | – | – | – | – | – | – | – | 12 | 2.0 | 4 | 6.7 |
| CYMV | 6 | 4.0 | 1 | 6.7 | – | – | – | – | – | – | – | – | 3 | 2 | 1 | 6.7 | 9 | 1.5 | 2 | 3.3 |
| CMoV | – | – | – | – | 5 | 3.3 | 3 | 20.0 | 14 | 9.3 | 4 | 26.7 | – | – | – | – | 19 | 3.2 | 7 | 11.7 |
aS, number of samples from which virus was detected out of 150 samples collected per state
bF, number of fields where virus was detected out of the 15 cowpea fields surveyed per state, (F add to more than 15 and F (%) add to more than 100% in some cases due to multiple virus infections)
cTS, total number of infected samples from 600 samples collected across the states
dTF, total number of fields where virus was detected out of the 60 surveyed fields across the states
e“–”, no detection of virus
Incidence and distribution of multiple viral infections of cowpea
Multiple infections of two to four viruses on a plant were observed on 12.5% of the total samples taken from 51.7% of the surveyed cowpea fields in Southwest Nigeria (Table 4). The highest number of samples (27) and fields (12) with multiple viral infections were found in Ondo state, followed by Osun (21 and 6) and Ogun (15 and 8), with the least from Oyo state (12 and 5). Among the multiple infections scenarios, dual infection was prevalent, both on the number of samples (45.3%) and fields where detected (51.6%). This was followed by triple infection (42.7% and 38.7%) while coinfection with four viruses (12% and 9.7%) was the least prevalent, observed only in Ogun and Ondo states. Triple infection of CPMMV + CABMV + BCMV-BlCM was observed in all the states, while coinfections involving CPMMV with either CMV or CABMV were the most frequent among dual infections.
Table 4.
Detection of intra-host multiple viral infections of cowpea from Southwest Nigeria
| State | Multiple virus infectionsa | Coinfection per sample | Coinfection per field | ||
|---|---|---|---|---|---|
| No. of samples | S (%)b | No. of fields | F (%)c | ||
| Oyo | CP + CA + BC | 2 | 1.3 | 1 | 6.7 |
| CP + CA | 2 | 1.3 | 1 | 6.7 | |
| CP + CM | 2 | 1.3 | 1 | 6.7 | |
| SB + CY | 6 | 4.0 | 2 | 13.3 | |
| Ogun | CP + CM + SB + CMo | 8 | 5.3 | 1 | 6.7 |
| CP + CA + BC | 2 | 1.3 | 2 | 13.3 | |
| CA + BC + CMo | 1 | 0.7 | 1 | 6.7 | |
| CP + CM | 1 | 0.7 | 1 | 6.7 | |
| CA + BC | 2 | 1.3 | 2 | 13.3 | |
| SB + CMo | 1 | 0.7 | 1 | 6.7 | |
| Ondo | CP + CA + BC + CMo | 1 | 0.7 | 2 | 13.3 |
| CP + CA + CMo | 5 | 3.3 | 1 | 6.7 | |
| CP + CA + BC | 10 | 6.7 | 5 | 33.3 | |
| CP + CA | 5 | 3.3 | 2 | 13.3 | |
| CP + CMo | 1 | 0.7 | 1 | 6.7 | |
| BC + CMo | 5 | 3.3 | 1 | 6.7 | |
| Osun | CP + CA + BC | 12 | 8.0 | 2 | 13.3 |
| CP + CA | 6 | 4.0 | 1 | 6.7 | |
| CA + BC | 2 | 1.3 | 2 | 13.3 | |
| CA + CY | 1 | 0.7 | 1 | 6.7 | |
| Totald | 75 | 12.5 | 31 | 51.7 | |
aCP, CPMMV; CA, CABMV; BC, BCMV-BlCM; CY, CYMV; SB, SBMV; CMo, CMoV
bS (%), percentage of coinfected samples out of the 150 samples collected per state
cF (%), percentage of number of fields where coinfections were observed out of the 15 surveyed fields per state
dTotal number and percentages of coinfected samples out of 600 samples from 60 fields across the states
Discussion
Virus diseases are part of the major constraints to agricultural production especially in West Africa, where control methods are either not available, not affordable or not readily accessible by farmers (Legg et al. 2019). Effective surveillance of plant diseases usually identifies potential pest problems before they create major crop losses, while permitting sufficient time for mitigation strategies to be developed, tested, and implemented (McCallum et al. 2021). Field surveys of cowpea viruses conducted in Southwest Nigeria showed incidence of seven cowpea viruses, viz: CPMMV, CABMV, BCMV-BlCM, CMV, SBMV, CYMV and CMoV. Virus symptoms of mosaic, puckering, mottling, vein-banding, leaf deformation and stunted growth, confirmed by ELISA or RT-PCR, revealed the geographical distribution of these viruses in the region.
Higher virus incidence and severity observed in Ondo than in other states and the virus distribution pattern indicate variation in the incidence and distribution of cowpea viruses in Southwest Nigeria. Such variation among field locations can be attributed to differences in the vector spread, seed-borne virus inoculum and alternative hosts or volunteer plants from the previous crops (Biemond et al. 2013; Odedara and Kumar 2016). Edema et al. (1997) and Shoyinka et al. (1997) attributed the variability to changes in weather conditions within seasons and farming systems in different environments. This implies that effective virus disease management approach needs to consider the variation in type and distribution of viruses as well as the dynamics of occurrence of viruses, especially in the proactive plans to prevent epidemic spread of cowpea viral diseases.
The survey results provided updated information on the incidence and distribution of cowpea viruses in Southwest Nigeria. Previous surveys reported incidence of six viruses (CABMV, BCMV-BlCM, CMV, SBMV, CMoV and CYMV) in all agro-ecological zones of Nigeria, with no report of virus in Ondo and Osun State (Shoyinka et al. 1997). However, we observed in addition to these six viruses, a high incidence and widest distribution of CPMMV on cowpea in Southwest region of Nigeria.
Although, CPMMV has been reported to be prevalent on cowpea in Uganda (Urawu et al. 2015), previous surveys of cowpea fields in the Savanna zones of Nigeria reported low incidence and distribution of the virus (Odedara and Kumar 2016), while this virus was not detected in other cowpea field surveys in Nigeria (Aliyu et al. 2012; Eni et al. 2013). A recent report has however categorised CPMMV among the important and most frequent seed transmitted cowpea viruses (Kumar et al. 2021). The observed prevalence of CPMMV in cowpea is contrary to the previous report of prevalence of CABMV in Nigeria (Shoyinka et al. 1997). CABMV was referred to as a cosmopolitan cowpea virus causing high yield losses of up to 40% in cowpea (Bashir et al. 2002). However, this survey result indicates a recent upsurge of the occurrence of CPMMV on cowpea in Southwest Nigeria.
The observed high incidence and prevalence of CPMMV, under single and multiple infections, might be attributable to the high population of its insect vectors (Bemisia tabaci) on farmers’ fields in Southern Nigeria (Vetten and Allen 1983), supplemented by the seed transmission rate (3%) of the virus in cowpea (Nain et al. 1994). This virus is already known as a limiting factor to the production of soybean (Glycine max (L.) Merr.) in many countries such as Argentina, Egypt, Israel, Kenya, Brazil, Thailand, Malaysia and Nigeria (Zubaidah and Kuswantoro 2016). Thus, there is a need to investigate into the level of yield loss attributable to CPMMV infection in cowpea.
To the best of our knowledge, this is the first report of the occurrence of cowpea viruses in Ondo and Osun states of Southwest Nigeria. The novel reports on the incidence of five viruses in each of the two states, with Ondo state having highest incidence and severity in the survey areas, will be helpful in the viral disease management in Southwest region of Nigeria for improved cowpea productivity. Virus management options readily available to farmers include: keeping fields free of weeds and volunteer plants (alternative hosts for viruses and their vectors); ensuring old crops are completely destroyed after harvest to remove sources of infection; removing (rogueing) plants showing virus disease symptoms, the use of insect traps or insecticides to control vector populations and planting virus resistant varieties (Karim 2016; Schreinemachers et al. 2015). Moreover, the use of host plant resistance has been considered the most effective, economical and environmentally friendly control measure for cowpea viruses (Urawu et al. 2013). This updates on cowpea virus incidence and distribution will provide useful information to virologists and cowpea breeders on screening for sources of multiple resistance to viruses among cowpea genotypes, putting the virus disease distribution and prevalence in Southwest Nigeria into consideration. This is important in developing improved, multiple-virus resistant cowpea varieties. For instance, CYMV was not prevalent in Southwest Nigeria, detected only in one field each in Oyo and Osun states. This implies that much breeding efforts will be channelled on CPMMV, which is currently prevalent in the zone, as well as to other viruses in the introgression of genes for resistances to viruses and other plant diseases into the susceptible cowpea land races and commercial varieties in Nigeria. However, the use of host resistance can be supplemented with other preventive measures against the spread of viruses to the locations where they were not yet detected. Schreinemachers et al. (2015) suggested that host plant resistance should be used in combination with other crop management such as good field sanitation and vector control, for legume viruses, as this make the control method more effective and prolongs the period that the host-plant resistance remains effective since virus species have the potential to evolve quickly and may thus overcome the resistance.
Several cultivars of cowpea have also been reported in Nigeria and other African countries. Boukar et al. (2019) reported the released of many cowpea varieties by National and International Research Institutes in Africa. In Nigeria, released varieties include Ife brown, IAR 339-1, IAR 341, IT97K-499-35, IT99K-573-1-1, etc. In Senegal, there were Ndambour, Mougne, Bambey 21 and 23, while in Tanzania and Burkina Faso, there were TKx133-16D-2, IT00K-1263 and IT99K-573-2-1, and KN-1 (Vita 7), TVx3236 and IT98K-205-8, respectively. Many cowpea varieties and landraces of various phenotypic (e.g. seed coat colour and texture, and seed sizes) and agronomic characters are usually cultivated in Southwest Nigeria, depending on farmer’s and consumers’ preferences. Among these varieties, sources of resistance to some viruses have been reported. For instance, cowpea varieties: IT82D-889, IT90K-277-2, and TVu201 were found to be resistant to several isolates of BCMV-BlCM and CABMV (VanBoxtel et al. 2000) while IT85F-2841, MU-93 and SECOW-2W were resistant to CABMV (Urawu et al. 2013). Unfortunately, most of the available commercial varieties and landraces in Nigeria are susceptible to viruses which contributed to the high viral infections observed from most of the surveyed cowpea fields..
Under multiple viral infections, higher symptom severity was observed in most of the plants than in single infections. The occurrence of multiple infections on 51.7% of the surveyed fields is an indication that multiple infection is becoming commonplace on cowpea fields in Southwest Nigeria. Such infection type have been earlier reported to have caused a more devastating disease conditions, resulting in high loss of yield and productivity in Nigeria (Shoyinka et al. 1997; Nsa and Kareem 2015) as well as other countries (Urawu et al. 2015; Adams et al. 2020). Multiple infections have also influenced the titer of the coinfecting viruses. This influence on disease severity and virus accumulation by coinfection however, depend on the type of virus, host resistance status, type of virus-virus-host interaction (either synergistic or antagonistic), and climatic factors (Ogunsola et al. 2021).
The incidence, geographical distribution and prevalence of the viruses seem to influence the type of multiple infection. For instance, the least prevalent CYMV was observed only in double infections with either SBMV or CABMV whereas CPMMV or CABMV were involved in most of the coinfections. In addition, although, Oyo and Ogun states have the highest diversity of virus species (of six viruses each), Ondo state, with the highest virus incidence and severity also showed highest occurrence of multiple virus infections. This suggests that virus incidence, distribution and prevalence may influence virus coinfection, evolution and coevolution dynamics. The high incidence of multiple infections in Ondo state might also be attributable to cultivation of highly susceptible cowpea landraces by the farmers. Since double infections involving CPMMV is predominant among coinfections, and triple infections of CPMMV + CABMV + BCMV-BlCM was observed in all the surveyed states, development of multiple viral disease resistant cowpea varieties, based-on the present knowledge of the coinfecting viruses, will be helpful in the effective management of the viral diseases in the affected areas.
The observed latent infection of CPMMV and CMV has been previously reported in cowpea (Legg et al. 2019; Ogunsola et al. 2021). This is capable of causing unnoticeable spread of the two viruses on farmers’ fields, which might have also enhanced the observed wide distribution of CPMMV in cowpea. This necessitates random sampling of symptomless plants in addition to symptomatic ones for an effective field survey of cowpea viruses. The situation whereby CPMMV and CMV were detected only by RT-PCR and not ACP-ELISA in few samples from Oyo and Ogun state might be due to very low virus concentration in those samples or probably the presence of serologically variable strains of the viruses (Aliyu et al. 2012), since the two viruses were detected serologically from other plant samples. On the other hand, the highly symptomatic plant samples from Ondo state and Osun state, which were not diagnosed by ACP-ELISA or RT-PCR suggests infections by viruses outside the seven frequently reported on cowpea in Nigeria, and which were not assayed in this study. These might be single or multiple infections of the seldom reported cowpea viruses in Nigeria such as cowpea golden mosaic virus (CGMV, genus Begomovirus), a non seed-transmitted virus (Boukar et al. 2013), cowpea chlorotic mottle virus (CCMV, genus Bromovirus) (Thottappilly et al. 1993), sunn-hemp mosaic virus (SHMV, genus Tobamovirus), which is not yet known to be insect-transmissible (Legg et al. 2019) or bean pod mosaic virus (BPMV, genus Comovirus) (Odedara and Kumar 2016). Alternatively, it might be infections of new variants of cowpea viruses not yet identified, and capable of emerging from the occurrence of multiple virus infections. Coinfections can lead to virus-virus interactions as a result of cross-protection, mutual exclusion or recombination among the viruses and some of these interactions usually result in the development of a new variant of virus (Renteria-Canett et al. 2011; Syller 2012). Since new virus variants can be more devastating than the existing ones, likelihood of their occurrence in cowpea should be investigated.
The widespread of multiple infections, coupled with the effects of global Covid-19 pandemic in which lock-down and restrictions in movement hinder farmers’ activities on farms and markets (Andama et al. 2020) and the recent occasional attacks on farmers by cattle herdsmen which deprive farmers of easy access to farms and cause losses of farm produce (Okoro 2018), might drastically reduce cowpea production in Southwest Nigeria. This is capable of posing a negative impact on the food and nutritional security of Nigeria, where cowpea is the most important and cheapest source of dietary protein to both rural and urban communities (Ajeigbe et al. 2012). Recently in Nigeria, attention is being focused on the dual purpose cowpea varieties to be used both as grain for consumption and as fodder (Boukar et al. 2020). However, the high incidence and wide distribution of multiple viral infections on farmers’ fields with the consequent more severe foliar damages than in single infections, can impair such dual functions.
The observed variation in the incidence and prevalence of single and multiple cowpea viruses in Southwest Nigeria, over the years, might have been enhanced by climate change, which impact has been reported in Nigeria (Adepitan and Falayi 2019), changes occurring within farming systems and crop intensification (Legg et al. 2019), usage of virus susceptible landraces and poor insect vector management. Disease control measures need to consider compatibility with sustainable and climate-resilient crop production systems, soil resources regeneration, protection of water and air, and development of crop germplasm with increased tolerance or resistance to pathogens and pests, which can also produce more food of high nutritional quality (Roberts et al. 2021). Effective cowpea viral disease management strategies are thus required, especially the integrated management that combines the use of multiple-disease resistant varieties with regulating of insect vectors population and use of clean seed germplasm. These updates on virus incidence and distributions in Southwest Nigeria will be useful in such virus disease management measures to achieve higher cowpea productivity.
Conclusion
The survey results provided a more recent information on virus incidence, prevalence and distribution in the Southwest Nigeria. The study revealed incidence of seven seed transmitted viruses (CPMMV, CABMV, BCMV- BlCM, CMV, SBMV, CYMV and CMoV) and a prevalence of CPMMV in cowpea in the surveyed region, under single and multiple infection scenarios. This necessitates disease management methods that integrate introgression of multiple virus disease resistance into the consumers’ preferred cowpea varieties and adoption of efficient seed certification systems for improved and sustainable cowpea productivity. The novel observation of a high incidence of single and multiple viruses in Ondo state of Nigeria calls for attention to the affected areas. An occasional survey of cowpea fields is required in Nigeria to identify new and emerging viruses which might be more devastating in cowpea. The variation in the incidence and prevalence of cowpea viruses in Nigeria over the years also necessitates a re-evaluation of the losses in yield and productivity that are attributable to viral diseases under single and multiple infections.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
We thank Dr. P. Lava Kumar, the Head of Virology and Molecular Diagnostics Unit/ Germplasm Health Unit of IITA, Ibadan, Nigeria, for professional advice and extending IITA laboratory diagnostic facilities for this study. The survey equipment provided by the Head of Post Entry Plant Quarantine, Surveillance and Diagnostic Station, Nigeria Agricultural Quarantine Service, Moor Plantation Ibadan, Nigeria, is also appreciated.
Author contributions
KEO contributed to conceptualization, methodology, analysis, resources, survey supervision and writing of the original draft of the manuscript. AY: contributed to resources, editing, survey data collection and laboratory diagnosis. OAE contributed to survey data collection and laboratory diagnosis. All authors have read and approved the final article.
Data Availability Statement
Supplementary data on virus disease incidence and severity; and RT-PCR confirmatory test are available.
Declarations
Conflict of interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- Abarshi MM, Mohammed IU, Wasswa P, Hillocks RJ, Holt J, Legg JP, Seal SE, Maruthi MN. Optimization of diagnostic RT-PCR protocols and sampling procedures for the reliable and cost-effective detection of cassava brown streak virus. J Virol Methods. 2010;163:353–359. doi: 10.1016/j.jviromet.2009.10.023. [DOI] [PubMed] [Google Scholar]
- Adams FK, Kumar L, Kwoseh C, Akromah R. Occurrence of cowpea viruses in the forest and savannah agro-ecological zones of Ghana. Afr Crop Sci J. 2020;28(3):441–448. doi: 10.4314/acsj.v28i3.8. [DOI] [Google Scholar]
- Adepitan JO, Falayi EO. Variability changes of some climatology parameters of Nigeria using wavelet analysis. Sci Afr. 2019;2:e00017. doi: 10.1016/j.sciaf.2018.e000172468-2276/©2018. [DOI] [Google Scholar]
- Ajeigbe HA, Saidou AK, Singh BB, Hide O, Satoshi T (2012) Potentials for cowpea (Vigna unguiculata) for dry season grain and fodder production in the Sudan and Sahel zones of West Africa. In: Boukar O, Coulibaly O, Fatokun C, Lopez K, Tamò M (eds) Innovative research along the cowpea value chain, proceedings of the 5th World Cowpea conference on improving livelihoods in the cowpea value chain through advancement in science, IITA, Nigeria, held in Senegal, pp 189–201
- Aliyu TH, Balogun OS, Kumar L. Survey of the symptoms and viruses associated with cowpea (Vigna Unguiculata L.) in the Agro-ecological zones of Kwara state, Nigeria. Ethiop J Environ Stud Manag. 2012;5(4):613–619. doi: 10.4314/ejesm.v5i4.S22. [DOI] [Google Scholar]
- Aluko OJ, Osikabor B, Adejumo AA, Sumade S. Perceived effect of Boko-Haram insurgency on means of accessing cowpea from north-east Nigeria to Bodija market, Ibadan, Oyo State, Nigeria. Open Access Libr J. 2016;3:e2723. doi: 10.4236/oalib.1102723. [DOI] [Google Scholar]
- Andama K, Edeha H, Obohb V, Pauwc K, Thurlowc J. Impacts of COVID-19 on food systems and poverty in Nigeria. Adv Food Sustain. 2020;5:2452–2635. doi: 10.1016/bs.af2s.2020.09.002. [DOI] [Google Scholar]
- Basavaraj YB, Kumar A, Jain RK, Kumar P, Parameswari B, Prakash J. Molecular diversity of Papaya ringspot virus in India: genetic recombination and mutations between the isolates from different hosts and geo-climatic locations are role players in virus evolution. Indian Phytopathol. 2019;72:497–511. doi: 10.1007/s42360-019-00157-2. [DOI] [Google Scholar]
- Bashir M, Ahmad Z, Ghafoor A. Cowpea aphid borne mosaic potyvirus: a review. Int J Pest Manag. 2002;48:155–168. doi: 10.1080/09670870110118722. [DOI] [Google Scholar]
- Biemond PC, Oguntade O, Kumar PL, Stomph TJ, Termorshuizen A, Struik P. ‘Does the informal seed system threaten cowpea seed health’? Crop Prot. 2013;43:166–174. doi: 10.1016/j.cropro.2012.09.007. [DOI] [Google Scholar]
- Boukar O, Bhattacharjee R, Fatokun C, Kumar PL, Gueye B. Cowpea. In: Singh M, Upadhyaya HD, Bisht IS, editors. Genetic and genomic resources of grain legume improvement. London: Elsevier; 2013. pp. 137–156. [Google Scholar]
- Boukar O, Belko N, Chamarthi S, Togola A, Batieno J, Owusu E, Haruna M, Diallo S, Umar ML, Olufajo O, Fatokun C. Cowpea (Vigna unguiculata): genetics, genomics and breeding. Plant Breed. 2019;138:415–424. doi: 10.1111/pbr.12589. [DOI] [Google Scholar]
- Boukar O, Abberton M, Oyatomi O, Togola A, Tripathi L, Fatokun C. Introgression breeding in cowpea (Vigna unguiculata (L.) Walp.) Front Plant Sci. 2020;11:567425. doi: 10.3389/fpls.2020.567425. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brader L (2002) Forward. In: Fatokun, CA, Tarawali SA, Singh BB, Kormawa PM, Tamò M (eds) Challenges and opportunities for enhancing sustainable cowpea production. Proceedings of the World cowpea conference III held at the International Institute of Tropical Agriculture (IITA), Ibadan, Nigeria, 4–8 September 2000. P vi, IITA, Ibadan, Nigeria
- Carisse O, Fall ML, Vincent C. Using a biovigilance approach for pest and disease management in Quebec vineyards. J Indian Dent Assoc. 2017;39:393–404. [Google Scholar]
- DaPalma T, Doonan BP, Trager NM, Kasman LM. A systematic approach virus-virus interactions. Virus Res. 2010;149:1–9. doi: 10.1016/j.virusres.2010.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Edema R, Adipala E, Florini DA. Influence of season and cropping system on the occurrence of cowpea diseases in Uganda. Plant Dis. 1997;81:465–468. doi: 10.1094/PDIS.1997.81.5.465. [DOI] [PubMed] [Google Scholar]
- Eni AO, Ogunsanya P, Oviasuyi T, Hughes Jd’A, Alarming increase in the incidence of cucumber mosaic virus in cowpea (Vigna Unguiculata (L.) Walp.) in Northern Nigeria. Arch Phytopathol Plant Prot. 2013;46(16):1958–1965. doi: 10.1080/03235408.2013.782218. [DOI] [Google Scholar]
- FAOSTAT (2020) Food and Agriculture Organization of the United Nations. FAO Statistics Division, Rome, Italy. http://www.fao.org/faostat/en/#data/QC. Accessed 13 July 2022
- Gomes AMF, Nhantumbo N, Ferreira-Pinto M, Massinga R, Ramalho JC, Ribeiro- Barros A. Breeding elite cowpea (Vigna unguiculata (L.) Walp.) varieties for improved food security and income in Africa: opportunities and challenges. Legume Crops. 2019 doi: 10.5772/Intechopen.84985. [DOI] [Google Scholar]
- Hayes F, Harmens H, Sharps K, Radbourne A. Ozone dose–response relationships for tropical crops reveal potential threat to legume and wheat production, but not to millet. Sci Afr. 2000;9:e00482. doi: 10.1016/j.sciaf.2020.e00482. [DOI] [Google Scholar]
- Karim FA (2016) Survey of cowpea viral disease symptoms and detection of associated viruses in selected cowpea growing areas in Ghana. Thesis, Kwame Nkrumah University of Science and Technology, Kumai, Ghana. http:hdi.handle.net/123456789/9269
- Kumar PL, Jones AT, Sreenivasulu P, Fenton B, Reddy DVR. Characterization of a virus from pigeon pea with affinities to species in the genus Aureus virus, family Tombusviridae. Plant Dis. 2001;85:208–215. doi: 10.1094/PDIS.2001.85.2.208. [DOI] [PubMed] [Google Scholar]
- Kumar PL, Cuervo M, Kreuze JF, Muller G, Kulkarni G, Kumari SG, Massart S, Mezzalama M, Alakonya A, Muchugi A, Graziosi I, Ndjiondjop M, Sharma R, Negawo AT. Phytosanitary interventions for safe global germplasm exchange and the prevention of transboundary pest spread: the role of CGIAR Germplasm Health Units. Plants. 2021;10(2):328. doi: 10.3390/plants10020328. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kumar PL (2009) Methods for the diagnosis of plant virus diseases. Laboratory manual. International Institute of Tropical Agriculture 5–90 Ibadan, Nigeria, IITA
- Legg JP, Kumar PL, Mahuku G, Wosula E, Stavolone L, Terry E, Bosque-Perez N (2019) Viruses affecting African crops and their vectors. In: Neuenschwander P, Tamo M (eds) Critical issues in plant health: 50 years of research in African agriculture. 19–23. Cambridge, UK: BurleighDodds Science Publishing, ISBN: 978 1786762320. www.bdspublishing.com. 10.19103/AS.2018.0043.05
- McCallum BD, Geddes CM, Chatterton S, Peng G, Carisse O, Turkington TK, Olfert O, Leeson J, Sharpe S, Stephens E. We stand on guard for thee: a brief history of pest surveillance on the Canadian Prairies. Crop Prot. 2021;149:105748. doi: 10.1016/j.cropro.2021.105748. [DOI] [Google Scholar]
- Nain PS, Rishi N, Bishnoi SS. Profile of viral diseases of cowpea (Vigna unguiculata) in northern India. Indian J Virol. 1994;10(2):128–136. [Google Scholar]
- Nsa IY, Kareem KT. Additive interactions of unrelated viruses in mixed infections of cowpea (Vigna unguiculata L. Walp) Front Plant Sci. 2015;6:812–825. doi: 10.3389/fpls.2015.00812. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Odedara OO, Hughes Jd’A, Odebode AC, Odu BO, Multiple virus infections of lablab (Lablab purpureus L. Sweet) in Nigeria. J Gen Plant Pathol. 2008;74:322–325. doi: 10.1007/s10327-008-0098-0. [DOI] [Google Scholar]
- Odedara O, Kumar P. Incidence and diversity of viruses in cowpea and weeds in the unmanaged farming systems of savanna zones in Nigeria. Arch Phytopathol Plant Prot. 2016;50:1–12. doi: 10.1080/03235408.2016.1241203. [DOI] [Google Scholar]
- Ogunsola KE, Ilori C, Fatokun CA, Boukar O, Ogunsanya P, Kumar PL. Disease incidence and severity in cowpea lines evaluated for resistance to single and multiple infections of endemic viruses in Nigeria. J Crop Improv. 2021;35(3):427–452. doi: 10.1080/15427528.2020.1824952. [DOI] [Google Scholar]
- Okoro JP (2018) Herdsmen/farmers conflict and its effects on socio-economic development in Nigeria. J Peace, Secur Dev 4(1):143–158. https://www.researchgate.net/publication/335778034
- Renteria-Canett I, Xoconostle-Cazares B, Ruiz-Medrano R, Rivera-Bustamante RF. Geminivirus mixed infection on pepper plants: synergistic interaction between Pepper huasteco yellow vein virus and Pepper golden mosaic virus. Virol J. 2011;8:104. doi: 10.1186/1743-422X-8-104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Roberts DP, Short NM, Sill J, Lakshman DK, Hu X, Buser M. Precision agriculture and geospatial techniques for sustainable disease control. Indian Phytopathol. 2021;74:287–305. doi: 10.1007/s42360-021-00334-2. [DOI] [Google Scholar]
- Saka JO, Agbeleye OA, Ayoola OT, Lawal BO, Adetumbi JA, Oloyede-Kamiyo QO. Assessment of varietal diversity and production systems of cowpea (Vigna unguiculata (L.) Walp.) in Southwest Nigeria. J Agric Rural Dev Trop Subtrop. 2018;119(2):43–52. doi: 10.17170/kobra-2018121864. [DOI] [Google Scholar]
- SAS (Statistical Analysis System) (2008) SAS user’s guide version 9.2. SAS Institute Incorporated, Cary
- Schreinemachers P, Balasubramaniam S, Boopathi NM, Ha CV, Kenyon L, Praneetvatakul S, Sirijinda A, Le NT, Srinivasan R, Wu M. Farmers’ perceptions and management of plant viruses in vegetables and legumes in tropical and subtropical Asia. Crop Prot. 2015;75:115–123. doi: 10.1016/j.cropro.2015.05.012. [DOI] [Google Scholar]
- Shoyinka SA, Thottappilly G, Adebayo GG, Anno-Nyako FO. Survey on cowpea virus incidence and distribution in Nigeria. Int J Pest Manag. 1997;43:127–132. doi: 10.1080/096708797228816. [DOI] [Google Scholar]
- Syller J. Facilitative and antagonistic interactions between plant viruses in mixed infection. Mol Plant Pathol. 2012;13:204–216. doi: 10.1111/j.1364-3703.2011.00734.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thottappilly G, Rossel HW. Viral disease of cowpea in Africa. IITA Res Guide. 1996;53:28. [Google Scholar]
- Thottappilly G, Sehgal OP, Rossel HW. Characteristics of a cowpea chlorotic mottle virus isolate from Nigeria. Plant Dis. 1993;77:60–63. doi: 10.1094/PD-77-0060. [DOI] [Google Scholar]
- Urawu M, Melis R, Laing M, Derera J. Genetic inheritance of resistance to cowpea aphid-borne mosaic virus in cowpea. Euphytica. 2013;189:191–201. doi: 10.1007/s10681-012-0756-3. [DOI] [Google Scholar]
- Urawu M, Obuo J, Omadi R. Distribution and detection of cowpea viruses infecting cowpea in Uganda. Am J Plant Sci. 2015;6(5):574–581. doi: 10.4236/ajps.2015.65062. [DOI] [Google Scholar]
- VanBoxtel J, Singh BB, Thottappilly G, Maule AJ. Resistance of (Vigna Unguiculata (L.) Walp.) Breeding Lines to blackeye cowpea mosaic and cowpea aphid borne mosaic potyvirus isolates under experimental conditions. J Plant Dis Prot. 2000;107(2):197–204. [Google Scholar]
- Vetten HJ, Allen DJ. Effects of environment and host on vector biology and incidence of two whitefly-spread diseases of legumes in Nigeria. Ann Appl Biol. 1983;102(2):219–227. doi: 10.1111/j.1744-7348.1983.tb02687.x. [DOI] [Google Scholar]
- Wylie S, Wilson CR, Jones RAC, Jones MGK. A polymerase chain reaction Assay for Cucumber mosaic virus in lupin seeds. Austr J Agric Res. 1993;44:41–51. doi: 10.1071/AR9930041. [DOI] [Google Scholar]
- Yadav MK, Biswas KK, Lal SK, Baranwal VK, Jain RK. A distinct strain of Cowpea mild mottle virus infecting soybean in India. J Phytopathol. 2013;161(10):739–744. doi: 10.1111/jph.12119. [DOI] [Google Scholar]
- Zubaidah S, Kuswantoro H. Foliar symptoms recovery: developing scoring technique for assessment of soybean resistance to CPMMV (cowpea mild mottle virus) J Biol Res. 2016;21(2):85–89. doi: 10.23869/bphjbr.21.2.20167. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Supplementary data on virus disease incidence and severity; and RT-PCR confirmatory test are available.


