Skip to main content
Plants logoLink to Plants
. 2022 Nov 25;11(23):3244. doi: 10.3390/plants11233244

Fine Mapping of Stripe-Rust-Resistance Gene YrJ22 in Common Wheat by BSR-Seq and MutMap-Based Sequencing

Can Chen 1,2,, Weihao Hao 1,2,, Jingchun Wu 1,3,4, Hongqi Si 1,2, Xianchun Xia 4, Chuanxi Ma 1,2,3,5,*
PMCID: PMC9740260  PMID: 36501284

Abstract

Identification and accurate mapping of new resistance genes are essential for gene pyramiding in wheat breeding. The YrJ22 gene is a dominant stripe-rust-resistance gene located at the distal end of chromosome 2AL, which was identified in a leading Chinese-wheat variety, Jimai 22, showing high resistance to CYR32, a prevalent race of Puccinia striiformis tritici (Pst) in China. In the current study, 15 F1 and 2273 F2 plants derived from the cross of Jimai 22/Avocet S were used for the fine-mapping of YrJ22. The RNA-Seq of resistant and susceptible bulks of F2 plants (designated BSR-Seq) identified 10 single-nucleotide polymorphisms (SNP) in a 12.09 Mb physical interval on chromosome 2AL. A total of 1022 EMS-induced M3 lines of Jimai 22 were screened, to identify susceptible mutants for MutMap analysis. Four CAPS markers were developed from SNPs identified using BSR-Seq and MutMap. A linkage map for YrJ22 was constructed with 11 CAPS/STS and three SSR markers. YrJ22 was located at a 0.9 cM genetic interval flanked by markers H736 and H400, corresponding to a 340.46 kb physical region (768.7–769.0 Mb), including 13 high-confidence genes based on the Chinese Spring reference genome. TraesCS2A01G573200 is a potential candidate-gene, according to linkage and quantitative real-time PCR (qPCR) analyses. The CAPS marker H732 designed from an SNP in TraesCS2A01G573200 co-segregated with YrJ22. These results provide a useful stripe-rust-resistance gene and molecular markers for marker-assisted selection in wheat breeding and for further cloning of the gene.

Keywords: BSR-Seq, MutMap-based cloning, Puccinia striiformis tritici, Triticum aestivum

1. Introduction

Wheat (Triticum aestivum) is a widely grown momentous food-crop, with an estimated global production of 776.7 million tonnes in 2020 [1]. Stripe rust from Puccinia striiformis f. sp. tritici (Pst) is a very serious fungal disease, which affects wheat-grain yield and quality and brings great challenges to wheat production worldwide [2]. A large number of Pst spores accumulated on leaves strongly weaken the photosynthetic capacity, eventually leading to yield reduction [3,4]. Due to wide spreading and difficult prevention and control, stripe rust has been ranked as a first-grade national crop disease by the Ministry of Agriculture and Rural Affairs of China [5]. Stripe rust occurred on over four million ha in China in 2020 [6]. The utilization of resistant cultivars remains the most economical, environment-friendly and effective way to control the disease. At present, 84 stripe-rust-resistance genes have been formally catalogued [7,8,9,10,11,12,13], but relatively few genes maintain resistance to the predominant races CYR32, CYR33 and CYR34 in China [14,15], which leads directly to the loss of resistance to stripe rust in many wheat varieties. It is, therefore, very urgent to explore new genes and effective markers, to breed resistant wheat-varieties [16].

Molecular marker-assisted selection (MAS) is effective in the pyramiding of resistance genes [17]. Developing diagnostic or tightly linked molecular markers is essential for MAS. However, the large and complex wheat genome largely hinders the fine mapping and cloning of genes and the development of molecular markers [18]. Although many wheat resistance-genes have been identified, most of them are mapped at large intervals. To date, nine wheat stripe-rust resistance-genes have been cloned, including the recently cloned Yr28/YrAS2388 [19,20]. The Yr5, Yr7 and YrSP genes were identified by mutant resistance gene enrichment sequencing (MutRenSeq), while the others were isolated by map-based cloning [21,22,23,24,25]. Among them, three are adult plant resistance (APR) genes, including Yr18, encoding an ABC transporter gene, Yr36, a kinase-START gene, and Yr46, encoding a hexose transporter. The other cloned Yr genes show all-stage resistance (ASR), encoding a nucleotide-binding site (NBS) and leucine-rich repeat (LRR) proteins, except for Yr15 [26].

The rapid development of molecular technologies, such as transcriptome and resequencing, greatly accelerates the pace of resistance-gene localization and map-based cloning [27]. With the development of next-regeneration sequencing (NGS) assisted pooling [28], the BSR-Seq that combines bulked segregant analysis (BSA) and RNA-Seq has been widely used in the fine mapping and cloning of genes in wheat [29]. Using this method, more than a dozen disease resistance genes and dwarf genes have been fine mapped, such as PmQ, YrZH22 and Rht-2BL, indicating the effectiveness of BSR-Seq [30,31,32]. Many single-nucleotide polymorphisms (SNPs) excavated from RNA-Seq provide molecular markers for the fine mapping and map-based cloning of genes [33].

MutMap-based cloning comprises ethyl-methane sulfonate (EMS) mutagenesis, sequencing, and mapping [34]. Mutational Mapping (MutMap) is a rapid method for gene isolation, based on whole-genome resequencing, genetic mapping and causative mutations. Typically, mutations are mapped in an F2 population derived from a cross between the isolated-mutant line and a wild type, using a BSA-based approach [35]. It could accelerate the identification of the genomic positions of genes in rice by comparing and sequencing bulked DNAs from the F2 population from the cross of the mutant and wild-type parental line [36]. It has been applied in the identification of OsCAO1, which most probably caused pale green leaves and the semi-dwarf, using seven mutants of a Japanese rice cultivar Hitomebore [37]. Another strategy that is more straightforward for mapping mutations would be the comparison of the genome sequences of the mutant and wild type. Nordström performed a mapping approach by directly sequencing allelic mutants without crossing [38]. The causal genes were identified in rice and Arabis alpina by comparing k-mers in whole-genome sequencing. In model-plant species with small genomes, mapping by causative mutations and whole-genome sequencing has proven an efficient approach for identifying genes related to growth habit, color of leaves and blast resistance [39,40]. For example, Ms1, an essential gene for microgametogenesis in hexaploid wheat, was further mapped and cloned with 676 msle plants by MutMap-based cloning [41]. Another example related to resistance is the identification of candidate genes for Fusarium wilt and sterility mosaic disease in pigeonpea (Cajanus cajan), by a combined approach of sequencing-based bulked segregant analysis and whole-genome resequencing-based nonsynonymous SNPs [42]. This technique, in addition to the complete genome sequence of the Chinese Spring (CS) genome released by The International Wheat Genome Sequencing Project in 2017, will greatly accelerate the mapping and cloning of wheat genes on adapted and wild wheat plants [41,43].

Jimai 22, a facultative medium-gluten wheat for noodles and steamed bread, is a widely grown cultivar with the largest planting area during recent decades, and is an extensively used breeding parent in China, due to its high and stable yield, high adaptability, and resistance to multiple diseases [44]. It contains a new stripe-rust-resistance gene, YrJ22, against CYR32 mapped by SSR markers and 90 K SNP chip [45]. YrJ22 was located at the distal end of chromosome 2AL in an 8.3 cM chromosome region between an SSR marker Xwmc658 and SNP marker IWA1348. In the present study, we fine-mapped YrJ22 to a close interval, using BSR-Seq and MutMap analysis, through the markers developed according to the variations of sequence analysis.

2. Results

2.1. Phenotypic Characterization of Stripe-Rust Resistance

Among the Jimai 22 × Avocet S F2 population, 1720 plants were resistant, whereas 553 were susceptible (Table 1), fitting a 3:1 segregation ratio based on a chi-square test (χ2 = 0.46, P1df > 0.05), and indicating that a dominant gene in Jimai 22 conferred resistance to stripe rust. Among 1022 lines from the EMS treatment, 990 were homozygous resistant and 27 segregated, whereas 5 were homozygous susceptible. In total, 34 plants from 21 different M3 lines were evaluated as highly susceptible, with IT = 4.

Table 1.

Stripe-rust reactions to Pst race CYR32 in parent F1 and F2 plants.

Plant Material Total Infection Type Expected
Ratio
χ2 p
0 0 1 2 3 4
Jimai 22 10 10
Avocet S 10 3 7
F1 15 15
F2 2273 3 1482 169 66 128 425 3:1 0.46 0.55

2.2. BSR-Seq and MutMap Analysis

Two RNA bulks were prepared by mixing RNA equally from 50 highly resistant (IT = 0;) F2 plants and 50 highly susceptible (IT = 4) ones. BSR-Seq genotyping was applied to detect various SNPs between the resistant and susceptible bulks. The BSR-Seq generated 132,101,678 and 178,459,594 reads (clean data) in the resistant and susceptible bulks, respectively. After quality control, we obtained 116,892,150 (88.49%) and 158,409,984 (88.77%) uniquely mapped reads for resistant and susceptible bulks, respectively. By calculating the ΔSNP-index values for both bulks, using the coordinates of uniquely aligned reads, 61 SNPs associated with stripe-rust resistance were obtained, based on the frequency distributions of genes with ΔSNP-index ≥ 0.9 on each chromosome (Figure 1), in which half were located on group 2 homoeologous groups and 10 were located on chromosome 2A, in a 12.09 Mb physical interval (761,299,381 to 773,385,650 bp).

Figure 1.

Figure 1

Number of polymorphic SNPs distributing on different chromosomes associated with stripe-rust resistance, based on RNA-Seq of resistant and susceptible bulks.

After MutMap sequencing and data analysis, 618.27 Gb clean reads were obtained, with Q30 reaching 80%. Approximately 36,586,593 SNPs and 3,228,052 indels were subjected to a following mutation analysis after mapping to the reference genome using BWA. In total, 9,529,169 polymorphic SNPs between Jimai 22 and the susceptible mutant pool were detected, locating on 21 wheat chromosomes (Figure 2). In line with the locations of the SNPs, compared with the reference genome from SnpEff, it is possible to annotate whether the SNP loci are present in the inter-gene region, gene region or CDS region, and whether there is a code shift mutation (Figure S1). Among 40,852 SNPs with a non-synonymous substitute, 11,631 were located on homoeologous group 2 chromosomes (2A:1256, 2B:1645, 2D:8730). SNPs located in the coding region with non-synonymous substitution were found for the associations with the resistance phenotype. Through the locational and functional analysis of these SNPs, a 40.08 Mb region on chromosome 2A (732,984,789–773,060,805 bp) was identified, where 11 SNPs were assumed as potential candidates for causing the mutation, according to the SNP-index ≥ 0.9.

Figure 2.

Figure 2

Distribution of SNP-index values on wheat chromosomes using MutMap. SNP-index = 0 means bulked DNA representing wild-type genome. Color dots represent SNP-index by calculation, black line is SNP-index plot. Regression lines were obtained by averaging SNP indices from a moving window of the 4 Mb interval with 10 kb increments. Red line refers to theoretical correlation-threshold line.

2.3. Collinearity Analysis of 2A, 2B, and 2D

Since the regions enriched by polymorphic SNPs from BSR-Seq and MutMap were not only chromosome 2A, we carried out a collinear sequence analysis of the target regions on chromosomes 2A, 2B, and 2D. The results showed that the 2A-, 2B-, and 2D-associated regions had high homology and collinearity (Figure S2). After analyzing the collinearity of the chromosomes, the different SNP-enriched regions on 2B (754,863,037 to 793,413,063 bp) from BSR-Seq, and on 2D (618,246,861 to 651,700,214 bp) from MutMap are highly homologous with the mapped bin (760,565,802–774,217,712 bp) of YrJ22 in a previous study [41]. Finally, a 10.39 Mb region on 2A (762,567,882 to 772,967,287 bp) including 208 genes was identified. Eleven and five polymorphic SNPs in this region-mining from BSR-Seq and MutMap, respectively, were candidates for marker development.

2.4. Development of Polymorphic Markers

SNPs associated with stripe-rust resistance identified by BSR-Seq and MutMap analysis were selected for the development of CAPS markers. Three markers, H796, H896 and H034 were converted from SNPs of BSR-Seq, and H690 was developed from MutMap analysis. The flanking sequences of SNPs identified from BSR-Seq and MutMap analysis were used to blast the CS RefSeq, to design PCR primers. A linkage map was constructed with these SNP-CAPS markers first, while YrJ22 was flanked in a 6.8 cM region by H896 and H796. Using functional annotation analysis, a total of 168 genes were screened in this genomic interval, including seven resistance (R) genes. After the sequence alignment of these genes between Jimai 22 and Avocet S in the 6.8 cM region, markers H400, H727, H732, H736 and H801 were developed using the SNPs and indels of these genes (Table 2). The markers were verified, based on polymorphisms between parental lines, and between resistant and susceptible DNA bulks (Figure 3).

Table 2.

Markers developed for mapping YrJ22.

Marker Forward Primer Sequence
(5′–3′)
Reverse Primer Sequence
(5′–3′)
Physical
Pos.*
(Mb)
Restriction
Enzyme
Product
Size
(bp)
H796 AGTGGGGCTATTTTGTCGG CCTTGTTCATGGCTGGTTG 773.2 BSSHII 739
H896 TCTAGTTGCTGCCGTGGTTA AACCAAACGGACACACATGG 764.1 HpyCH4V 718
H804 GTGCCGTGAGCACCCTGCTG TGGACGTCTTTTGCCCTCTTGAA 772.6 FoKI 869
H690 GGATTCTCACGGTCACTCAA CTCATTCCCGCAACAGG 773.0 HaeIII 546
H805 GAGCAGCCGGAGGAGTTG CAGGAGGAGATGGAGAGCAT 772.7 FoKI 1013
H034 AGTAGGGTAAATGGCGAGCAG GTCCCAAGGAACAAACACG 750.4 Hpy188III 720
H727 GGGTGGTCACATCCAGGTCC GAACATGCCTCAGAACAATGGA 768.7 TspRI 443
H400 CGATTGCTGCTTTCCTTCAT ATCCCATCGGTCCCGTGTT 768.7 BbvI 1677
H732 GCATCGCAGCAACACTCG GGAGACAATGGGCGGTTT 768.9 BstUI 1128
H736 GTGCTCCTTACAGGGAACAAC ATCCACAGCCGAACCAAA 769.0 HpyCH4III 1573
H801 GGACAAATACAAGGGTTCG TGTCGTCGGGATTCAAGG 772.4 - 279

* Physical position based on Chinese Spring reference genome (IWGSC v1.0, http://www.wheatgenome.org/ (accessed on 12 August 2021)).

Figure 3.

Figure 3

PCR amplification of polymorphic markers (ac). Polymorphic test of CAPS markers H400, H732 and H736, respectively, on 1.5% agarose gel. Pr: Jimai 22, Ps: Avocet S, F1: F1 plants, R: resistant F2 plants, S: susceptible F2 plants, M: Trans 2K DNA Marker.

2.5. Linkage-Map Construction and Candidate-Genes Analysis

Based on the genotypes and phenotypes of 553 susceptible F2 plants, a linkage map was constructed with newly developed and former linkage-markers (Figure 4). The interval for YrJ22 was narrowed down from 8.3 cM to 0.9 cM by flanking markers, corresponding to a 340.46 kb physical region on chromosome 2AL, referring to CS RefSeq. The new genetic-interval for YrJ22 overlapped with the previous study (Figure 5a). The SNPs in the genetic map were used to blast the Aikang58, Fielder, ArinaLrFor, Julius, LongReach_Lancer, Mace, SY_Mattis, Norin61 and CS RefSeq, to identify homologous contigs and gene annotations. The annotation of the 340.46 kb-region sequence identified 13 high-confidence genes (Table 3) [46]. To identify the candidate resistance-genes, all the 13 genes annotated in the target area were cloned from Jimai 22 and Avocet S for sequence alignment. Nine of them show polymorphisms between parents (Figure 5b). Among them, TraesCS2A01G572900, TraesCS2A01G573000, TraesCS2A01G5740100 and TraesCS2A01G573100 cannot be amplified in Jimai 22 and resistant F2 plants, but the full length of them from Avocet S were obtained and were highly consistent with the sequences in CS RefSeq by BLAST (identifying over 98.50%), indicating that there are great differences or indels between Jimai 22 and CS RefSeq (Figure 5c). There were several SNPs found by sequence alignment between Jimai 22 and Avocet S in TraesCS2A01G5740000, TraesCS2A01G572700, TraesCS2A01G573200 and TraesCS2A01G573600. No difference was identified in four other genes after comparison, showing that it is not the candidate gene. The co-segregation marker H732 was developed from an SNP in TraesCS2A01G573200, the annotated gene in the target genomic-region (Figure 5d). The qPCR analysis demonstrated that expression of TraesCS2A01G573200 in Jimai 22 was significantly higher than the susceptible line Avocet S at 12 and 24 hai with race CYR32 (p < 0.01) (Figure 6), indicating that TraesCS2A01G573200 is a potential candidate gene for YrJ22.

Figure 4.

Figure 4

(a) Linkage and physical maps for stripe-rust-resistance gene YrJ22 on chromosome arm 2AL. Loci names are indicated on the right side of the map. Kosambi map distances (cM) are shown on the left side. The physical positions refer to Chinese Spring RefSeq v1.0 (http://www.wheatgenome.org/, accessed on 20 October 2021). (b) Collinearity analysis of the target genomic-interval on chromosome 2AL in Chinese Spring RefSeq v1.0 with three Triticum species. The picture shows collinear interval of three Triticum species flanked by H727 and H736, marked as red rectangles. The blue ones show the R-gene within the region. The yellow one indicates the position of novel genes in the target interval of the three species.

Figure 5.

Figure 5

Map-based cloning of the stripe-rust-resistance gene YrJ22. (a) Genetic maps from a previous study [45] and the present work (lower). (b) Physical map of seven polymorphism genes between Jimai 22 and Avocet S. 1: TraesCS2A01G5740000, 2: TraesCS2A01G572900, 3: TraesCS2A01G5740100, 4: TraesCS2A01G573000, 5: TraesCS2A01G573100, 6: TraesCS2A01G573200, 7: TraesCS2A01G573600. (c) Black box represents region that could be amplified in Avocet S and susceptible lines; grey box indicates the region that is absent in Jimai 22. (d) Genomic structure of TraesCS2A01G573200 in reference sequences of CS. Abbreviations include exon (E) and intron (In).

Table 3.

Thirteen genes in the candidate region.

Name Length (bp) Position on Chr2A * (bp) Functional Annotation *
TraesCS2A01G572700 1455 768,663,628–768,665,082 Peroxidase
TraesCS2A01G572800 1625 768,676,637–768,678,261 Peroxidase
TraesCS2A01G740000LC 1200 768,691,235–768,692,434 F-box domain containing protein
TraesCS2A01G572900(R) 5771 768,729,058–768,734,828 Disease resistance protein
TraesCS2A01G740100LC 483 768,882,506–768,882,988 Endonuclease/exonuclease/
phosphatase family protein
TraesCS2A01G573000 1497 768,923,600–768,925,096 Retrovirus-related Pol polyprotein from transposon TNT 1-94
TraesCS2A01G573100(NLR) 5239 768,926,410–768,931,648 Disease resistance protein (TIR-NBS-LRR class)
TraesCS2A01G573200 1655 768,981,429–768,983,083 Succinate dehydrogenase subunit
TraesCS2A01G740200LC 1251 768,992,115–768,993,365 F-box domain containing protein
TraesCS2A01G573300 1463 768,997,070–768,998,532 Peroxidase
TraesCS2A01G573400 1706 769,003,029–769,004,734 Peroxidase
TraesCS2A01G573500 1136 769,020,358–769,021,493 Peroxidase
TraesCS2A01G573600 1129 769,032,902–769,034,030 Peroxidase

* Refer to Chinese Spring reference genome (IWGSC v1.0, http://www.wheatgenome.org/, accessed on 12 August 2021).

Figure 6.

Figure 6

qPCR analysis of the candidate gene TraesCS2A01G573200 in Jimai 22 and Avocet S at 12 and 24 h after inoculation with CYR32. **, significant difference at p < 0.01, based on Fisher’s least significant difference method.

3. Discussion

The use of resistance genes is one of the most effective and environment-friendly strategies for controlling disease. Durable and broad-spectrum resistance can be achieved in wheat by combining several resistance genes [47]. Fine-mapping and cloning of Yr genes provide a useful gene resource and molecular markers, to reduce the risks of stripe rust [48].

3.1. Combining Mutmap and BSR-Seq Is an Effective Approach to Fine-Mapping

To develop closely linked markers and to clone genes, map-based cloning is a classic method, while BSR-Seq and MutMap are gradually being used in map-based cloning in wheat [49]. BSR-Seq has been frequently used for the fine-mapping of resistance genes, such as Yr15, Yr26, and PmQ [21,31,50]. With the comparisons between resistant and susceptible bulks, SNPs linked with the target gene can be identified for development of molecular markers. In this study, 61 SNPs associated with the target gene by BSR-Seq were identified, ten, nineteen and one were located on chromosome 2A, 2B and 2D, respectively. Collinear sequence analysis showed that the target region is highly homologous among 2A, 2B and 2D. Wu found that high sequence-similarities among homeologs and homologs are major causes of false SNP-calling in common wheat [4]. In this situation, collinear sequence analysis can increase the accurate chromosomal localization. The mapping of Yr26 showed that the genetic backgrounds of the cross parents and Chinese Spring affect the positioning results from BSR-Seq [50]. In this study, 2A is not the chromosome ranked top by the number of polymorphic SNPs from BSR-Seq or MutMap. To refine the chromosomal location and discriminate subgroups among three sub-genomes, chromosome-specific markers with physical information should be considered. This fully demonstrates that even with a huge and complex wheat genome, BSR-Seq and MutMap could help gene localization in specific homoeologous groups, with the help of chromosome-specific markers to assist fine-mapping rapidly.

3.2. Genetic and Physical Mapping of YrJ22

Jimai 22 has been a leading cultivar in China since 2006, and is also used as a founder parent for breeding, due to its immune reaction to CYR32 and excellent agronomic traits [45,51]. The stripe-rust-resistance gene, YrJ22, in Jimai 22 was mapped within an 8.3 cM interval on the distal region of 2AL bin 1–0.85–1.00 [45], while it was mapped in a 0.9 cM interval flanked by H400 and H736 corresponding to 0.3 Mb in the present study, in line with the previous result. Unlike YrJ22, Yr1 and Yr32 are two officially named Yr genes on 2AL [48]. Both differ from YrJ2, based on gene-specific PCR fragments and multi-pathotype tests [45]. Besides these, some temporarily named Yr genes were located on 2AL. YrZM175, the only temporarily named ASR gene on 2AL, from Zhongmai 175 was linked with markers YrZM175-CAPS1 and YrZM175-InD1, spanning a 636.4 kb genomic region [52]. Based on its physical position and linked markers, YrJ22 appears to be located at a unique locus. Many genes for APR were previously mapped on 2AL, such as Qyr.saas-2A from Chuanmai 55, QYr.cau-2AL from Hongqimai, QYr.caas-2AL in Zhong 892, QYrqin.nwafu-2AL in QN142 and QYr.wpg.6 in PNW, which is different from YrJ22 according to the physical locations and characteristic reactions to Pst [53,54,55,56,57].

3.3. Analysis of the Candidate Region of YrJ22

Genes which translate into NLR proteins are major components of the innate immune system, and are often causal genes for disease resistance in plants [58]. Redundancy analysis indicates that ~30% of the NLR signatures are shared across all genomes in wheat cultivars [59,60]. The cloned ASR Yr genes, such as Yr5 and Yr10, encode for NBS and several LRRs proteins. Because of the release of the CS sequence, some cloned R genes are not present in the wheat reference-genome [61]. In the present study, two out of thirteen genes in the candidate region were blasted with the NLR protein structure from CS RefSeq v1.0 as reference. Li cloned Pm41 and found a presence/absence variation (PAV) in the Pm41 locus between wild emmer wheat (WEW) accession IW2 and hexaploid wheat CS [62]. Yr36 originated from WEW, was present in southern WEW populations and was absent in other WEW populations and in durum, and common wheat [63]. PAV in a gene encodes a coiled coil (CC), nucleotide-binding site (NBS), and leucine-rich repeat (LRR). The CNL protein was reported in the leaf-rust-resistance gene Lr10 in hexaploid wheat, and is not closely related to other wheat Lr genes [64]. The sequence alignment of TraesCS2A01G572900, TraesCS2A01G573000 and TraesCS2A01G573100 indicates that the 252.76 kb (chr2A:768,729,058 to 768,981,815 bp) genomic sequence could be a PAV in the YrJ22 locus between Jimai 22 and the reference genome. In TraesCS2A01G573200, we found some sequence variations, including 14 SNPs between Jimai 22 and Avocet S; three variations caused amino-acid substitution (Figure S3). A co-segregation marker, H732, was developed, based on the T-C SNP between parental lines. TraesCS2A01G573200 encodes a succinate dehydrogenase subunit; the expression of this gene in Jimai 22 was significantly higher than the susceptible parent, which could serve as a candidate for the map-based cloning of YrJ22.

4. Materials and Methods

4.1. Plant Materials

The wheat variety Jimai 22 showed high resistance to CYR32 (IT = 0~0;), whereas Avocet S was highly susceptible (IT = 4). Jimai 22 was crossed with Avocet S, producing F1 and F2 (2273 plants) for genetic analysis, and the highly susceptible variety Mingxian169 was used as control. A total of 1022 EMS-induced lines (M3) from Jimai 22 were employed for Mutmap-based cloning, and were kindly donated by Drs. Jianmin Song, at the Crop Research Institute, Shandong Academy of Agricultural Sciences, and Xianchun Xia, at the Institute of Crop Sciences, National Wheat Improvement Center, Chinese Academy of Agricultural Sciences (CAAS).

4.2. Evaluation of Stripe-Rust Reaction

The stripe-rust inoculations were conducted in the greenhouse of the National Wheat Improvement Center, CAAS. The Jimai 22, Avocet S, 15 F1 and 2273 F2 plants were scored for stripe-rust resistance by sowing in plastic pots (9 × 9 × 9 cm) with 15 plants each, with three plants of Mingxian 169 as control in each pot. A total of 1022 M3 lines (5 seeds per line) were challenged by Pst race CYR32 to identify homozygous susceptible-lines. Seedlings at the two-leaf stage were inoculated with CYR32 by brushing fresh conidia from sporulating leaves. Inoculated plants were incubated in a dark dew-chamber for 24 h, with a temperature of 8–12 °C and 100% relative humidity. After incubation, the plants were kept under long-day conditions (a 16-h light/8-h darkness photoperiod, at 15 ± 2 °C) [45]. Approximately 2 weeks after inoculation, when the susceptible control Mingxian169 was fully infected, the infection type (IT) was scored on a 0–4 scale [65,66]. Plants with ITs 0–2 were considered as resistant, and those with 3–4 as susceptible.

4.3. BSR-Seq Analysis

The total RNAs were extracted from leaves with an Illumina HiSeq platform at Beijing Novogene Bioinformatics Technology Co. Ltd. Two RNA bulks were prepared by mixing RNA equally from 50 highly resistant (IT = 0;) F2 plants and 50 highly susceptible (IT = 4) ones. The RNA quality and concentration was checked using Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) and 1% agarose gel. The quality of the original RNA-Seq reading was evaluated with the software Trimmomatic v0.32 [67]. The low-quality bases and adapter sequences in the raw reads were filtered out to obtain clean reads and a high quality of data. To identity and sort the unique reads with high quality, the alignments between the clean reads and the reference genome-sequence (CS RefSeq v1.0, http://www.wheatgenome.org/, accessed on 12 August 2021) were checked using STAR v2.5.1b [68]. Before the SNPs detection, Samtools rmdup was used to remove PCR duplicates from the PCR fragments with adapters during the library preparation; PCR optical duplicates occurred during clustering in a flow-cell before sequencing [69]. The unique and confident alignments were used to identify SNP variation, using the “Haplotype Caller” module in the GATK v4.0.12.0 software [70]. The SNP variations with allele-frequency difference (AFD) ≥0.9 were regarded as associated with disease resistance, and used as templates for developing SNP markers.

4.4. MutMap Analysis

To obtain resequencing data, DNA for MutMap analysis was extracted from the fresh leaves of susceptible M3 plants and Jimai 22. Jimai 22 (wild type, WT) and a bulked DNA pool from the equal mixing of DNA from 20 highly susceptible (IT = 4) M3 plants, were used for MutMap analysis. The DNA quality and concentration were determined using agarose gel and a DS-11 spectrophotometer (DeNovix, Wilmington, DE, USA). Whole DNA were sequenced using the Illumina HiSeq 2500 platform (Illumina, San Diego, CA, USA), based on the Illumina protocol, including quality control and base-calling analysis by Illumina Casava v1.8. The phred score (Qphred) was used to filter the raw data, to remove the adapter and low-quality base. The clean reads (618.27 Gb, Q30 ≥ 80%, Ave-depth = 20.50×) were aligned to the wheat reference-genome IWGSC RefSeq v1.0 using Burrows Wheeler Aligner (BWA) software. The sequencing reads were mapped to the reference genome and then subjected to subsequent mutation-analysis. The BWA software was mainly used for the alignment of short sequences obtained from second-generation high-throughput sequencing (Illumina HiSeq 2500 sequencing platform) with the reference genome. Over 99.42% reads in both samples were mapped to the reference genome. To identify reliable SNPs by GATK, SAMtools software was used to mark the duplicates first [71]. The reads from the WT and S-bulks were then aligned, and variants were called for in both samples against the developed assembly. The SNP-index (at a position) was defined as the ratio of the count of alternate bases and the count of reads aligned. The SNP-index-plot regression lines were obtained by averaging the SNP indices from a moving window of the 4 Mb interval, with 10 kb increments [72]. The SNP-index can be scanned across the genome to find the region with a value ranging from 0.9 to 1, harboring the gene responsible for the mutant phenotype. The effects of SNPs obtained from association analysis were annotated and predicted, using SnpEff [73].

4.5. Genomic DNA Isolation

Genomic DNA was extracted using a high-salt and low-PH reagent [74], in which PVP-40 combines with phenols to prevent DNA browning, and potassium acetate at a low PH allows proteins to precipitate more efficiently.

4.6. Development of Polymorphic CAPS and STS Markers

The polymorphic SNPs obtained by BSR-Seq and MutMap analysis were used to design specific primers with Primer Premier5 and WatCut (http://watcut.uwaterloo.ca/template.php, accessed on 25 October 2021). To develop cleaved amplified polymorphic sequences (CAPS) markers for identifying candidate SNP variations, the flanking sequences of each SNP were extended to approximately 2 kb on both sides, based on the CS RefSeq (https://urgi.versailles.inra.fr/blast/blast.php, accessed on 14 September 2021), and were then used as a template [75]. The sequence-tagged-site (STS)-marker loci in the region of the target gene were generated by the BSR-Seq and MutMap by Primer Premier5, following [76].

4.7. Quantitative Real-Time PCR Analysis

The total RNA was extracted from the primary leaves of Jimai 22 and Avocet S at 12 and 24 h after inoculation with Pst CYR32 with three biological replicates, using a RNAprep Pure Plant Plus Kit (TIANGEN, Beijing, China). First-strand cDNA was synthesized using the HiScript II Q RT Super Mix for qPCR (Vazyme Biotech Co., Ltd., Nanjing, China), and was performed with AceQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd., Nanjing, China) in a CFX384TM Real-Time System (Bio-Rad Laboratories, Monza, Italy). The expression of the candidate gene (TraesCS2A01G573200) was analyzed using the forward primer 5′-CCGTGGTGCCTCAAACTC-3′ and the reverse primer 5′-GCTCAACTGTGGCTTCTTCA-3′. Three repeats for each RNA sample were run as technical replicates. The wheat actin gene (AB181991) was amplified as the reference gene. Relative expression was determined using the 2−∆∆ct method [77].

4.8. Statical Analysis and Genetic Map Construction

Chi-squared (χ2) tests were used to determine whether the segregating ratio of F2 population fit that expected by SPSS Statistics V22.0. The genotypic data obtained from the polymorphic markers were used for linkage analysis using Mapmaker 3.0, and a genetic map was drawn with the MapDraw V2.1 software [47].

5. Conclusions

Jimai 22 is a high-yield cultivar with ASR to stripe rust, and has been frequently used as a parent in wheat breeding. The resistance to CYR32 in Jimai22 was conferred by a new gene, YrJ2, on 2AL. YrJ22 can be pyramided with other Yr genes, especially APR genes, to widen its resistance spectrum and enhance a sustainable resistance. The co-segregating marker H732 can be used in MAS for the improvement of stripe-rust resistance in wheat breeding.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants11233244/s1, Figure S1: Statistical results of candidate SNP annotations; Figure S2: Collinearity analysis of wheat chromosomes 2A, 2B, and 2D; Figure S3: (a) Sequence alignment of TraesCS2A01G573200 between Jimai 22 and Avocet S, (b) Alignment of the deduced amino-acid sequences of TraesCS2A01G573200 between Jimai 22 and Avocet S.

Author Contributions

C.C., X.X. and C.M. made contributions to the conception and design of the work, W.H. and J.W. performed experiments and created the figures and tables, C.C. and W.H. wrote the manuscript, C.C. and X.X. contributed to the discussion, H.S., X.X. and C.M. reviewed and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Data Availability Statement

The data presented in this study is available on request from the corresponding author.

Conflicts of Interest

The authors declare that there are no conflict of interest.

Funding Statement

This work was supported by grants from the National Natural Science Foundation of China (31701417, 31961143007), the Agriculture Research System of China (CARS-03), the University Synergy Innovation Program of Anhui Province (GXXT-2019-033), and Jiangsu Collaborative Innovation Center for Modern Crop Production (JCIC-MCP).

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.FAO Despite a Cut in World Cereal Production, this Year’s Forecast Output Remains an All-Time High. 2020. [(accessed on 20 October 2021)]. Available online: https://uga.ua/en/news/despite-a-cut-in-world-cereal-production-this-year-s-forecast-output-remains-an-all-time-high/
  • 2.Wellings C.R. Global status of stripe rust: A review of historical and current threats. Euphytica. 2011;179:129–141. doi: 10.1007/s10681-011-0360-y. [DOI] [Google Scholar]
  • 3.Chen X.M., Can J. Epidemiology and control of stripe rust (Puccinia striiformis f. sp. Tritici) on wheat. Plant Pathol. 2005;27:314–337. [Google Scholar]
  • 4.Wu J., Yu R., Wang H., Zhou C., Huang S., Jiao H., Yu S., Nie X., Wang Q., Liu S., et al. A large-scale genomic association analysis identifies the candidate causal genes conferring stripe rust resistance under multiple field environments. Plant Biotechnol. J. 2020;19:177–191. doi: 10.1111/pbi.13452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.The National Agro-Tech Extension and Service Center (NATESC) Forecast of occurrence trend of major crop diseases and insect pests in China in 2020. China Plant Prot. 2020;2:37–39. [Google Scholar]
  • 6.Zeng Q., Zhao J., Wu J., Zhan G., Han D., Kang Z. Wheat Stripe Rust and Integration of Sustainable Control Strategies in China. Front. Agric. Sci. Eng. 2022;9:37–51. doi: 10.15302/J-FASE-2021405. [DOI] [Google Scholar]
  • 7.McIntosh R.A., Dubcovsky J., Rogers W.J., Xia X.C., Raupp W.J. Catalogue of gene symbols for wheat. Annu. Wheat Newsl. 2021;67:104–113. [Google Scholar]
  • 8.McIntosh R.A., Dubcovsky J., Rogers W.J., Morris C., Appels R., Xia X.C. Catalogue of Gene Symbols for Wheat: 2015–2016 Supplement. [(accessed on 20 October 2021)];2017 Available online: https://wheat.pw.usda.gov/GG3/wgc.
  • 9.Dong Z., Hegarty J.M., Zhang J., Zhang W., Chao S., Chen X., Zhou Y., Dubcovsky J. Validation and characterization of a QTL for adult plant resistance to stripe rust on wheat chromosome arm 6BS (Yr78) Theor. Appl. Genet. 2017;130:2127–2137. doi: 10.1007/s00122-017-2946-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Feng J.Y., Wang M.N., See D.R., Chao S., Zheng Y., Chen X.M. Characterization of novel gene Yr79 and four additional quantitative trait loci for all-stage and high-temperature adult-plant resistance to strip-e rust in spring wheat PI182103. Phytopathology. 2018;108:737–747. doi: 10.1094/PHYTO-11-17-0375-R. [DOI] [PubMed] [Google Scholar]
  • 11.Gessese M., Bariana H., Wong D., Hayden M., Bansal U. Molecular Mapping of Stripe Rust Resistance Gene Yr81 in a Common Wheat Landrace Aus27430. Plant Dis. 2019;103:1166–1171. doi: 10.1094/PDIS-06-18-1055-RE. [DOI] [PubMed] [Google Scholar]
  • 12.Pakeerathan K., Bariana H., Qureshi N., Wong D., Hayden M., Bansal U. Identification of a new source of stripe rust resistance Yr82 in wheat. Theor. Appl. Genet. 2019;132:3169–3176. doi: 10.1007/s00122-019-03416-y. [DOI] [PubMed] [Google Scholar]
  • 13.Li J., Dundas I., Dong C., Li G., Trethowan R., Yang Z., Hoxha S., Zhang P. Identification and characterization of a new stripe rust resistance gene Yr83 on rye chromosome 6R in wheat. Theor. Appl. Genet. 2020;133:1095–1107. doi: 10.1007/s00122-020-03534-y. [DOI] [PubMed] [Google Scholar]
  • 14.Wang B., Hu X., Li Q., Hao B., Zhang B., Li G., Kang Z. Development of Race-Specific SCAR Markers for Detection of Chinese Races CYR32 and CYR33 of Puccinia striiformis f. sp. tritici. Plant Dis. 2010;94:221–228. doi: 10.1094/PDIS-94-2-0221. [DOI] [PubMed] [Google Scholar]
  • 15.Wang L., Tang X., Wu J., Shen C., Dai M., Wang Q., Zeng Q., Kang Z., Wu Y., Han D. Stripe rust resistance to a burgeoning Puccinia striiformis f. sp. tritici race CYR34 in current Chinese wheat cultivars for breeding and research. Euphytica. 2019;215:68. doi: 10.1007/s10681-019-2383-8. [DOI] [Google Scholar]
  • 16.Cheng P., Xu L.S., Wang M.N., See D.R., Chen X.M. Molecular mapping of genes Yr64 and Yr65 for stripe rust resistance in hexaploid derivatives of durum wheat accessions PI 331260 and PI 480016. Theor. Appl. Genet. 2014;127:2267–2277. doi: 10.1007/s00122-014-2378-8. [DOI] [PubMed] [Google Scholar]
  • 17.Zegeye H., Rasheed A., Makdis F., Badebo A., Ogbonnaya F.C. Genome-Wide Association Mapping for Seedling and Adult Plant Resistance to Stripe Rust in Synthetic Hexaploid Wheat. PLoS ONE. 2014;9:e105593. doi: 10.1371/journal.pone.0105593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.The International Wheat Genome Sequencing Consortium (IWGSC) A chromosome-based draft sequence of the hexaploid bread wheat (Triticum aestivum) genome. Science. 2014;345:1251788. doi: 10.1126/science.1251788. [DOI] [PubMed] [Google Scholar]
  • 19.Zheng S., Wu Y., Zhou M., Zeng L., Liu R., Li Y., Liu Z., Zhang C., Lu L., Zhang L. Characterization and diagnostic marker development for Yr28-rga1 conferring stripe rust resistance in wheat. Eur. J. Plant Pathol. 2019;156:623–634. doi: 10.1007/s10658-019-01912-x. [DOI] [Google Scholar]
  • 20.Zhang C., Huang L., Zhang H., Hao Q., Lyu B., Wang M., Epstein L., Liu M., Kou C., Qi J., et al. An ancestral NB-LRR with duplicated 3′UTRs confers stripe rust resistance in wheat and barley. Nat. Commun. 2019;10:4023. doi: 10.1038/s41467-019-11872-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Liu W., Frick M., Huel R., Nykiforuk C.L., Wang X., Gaudet D.A., Eudes F., Conner R.L., Kuzyk A., Chen Q., et al. The Stripe Rust Resistance Gene Yr10 Encodes an Evolutionary-Conserved and Unique CC–NBS–LRR Sequence in Wheat. Mol. Plant. 2014;7:1740–1755. doi: 10.1093/mp/ssu112. [DOI] [PubMed] [Google Scholar]
  • 22.Krattinger S.G., Lagudah E.S., Spielmeyer W., Singh R.P., Huerta-Espino J., McFadden H., Bossolini E., Selter L.L., Keller B. A Putative ABC Transporter Confers Durable Resistance to Multiple Fungal Pathogens in Wheat. Science. 2009;323:1360–1363. doi: 10.1126/science.1166453. [DOI] [PubMed] [Google Scholar]
  • 23.Klymiuk V., Yaniv E., Huang L., Raats D., Fatiukha A., Chen S., Feng L., Frenkel Z., Krugman T., Lidzbarsky G., et al. Cloning of the wheat Yr15 resistance gene sheds light on the plant tandem kinase-pseudo kinase family. Nat. Commun. 2018;9:3735. doi: 10.1038/s41467-018-06138-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Fu D., Uauy C., Distelfeld A., Blechl A., Epstein L., Chen X., Sela H., Fahima T., Dubcovsky J. A Kinase-START Gene Confers Temperature-Dependent Resistance to Wheat Stripe Rust. Science. 2009;323:1357–1360. doi: 10.1126/science.1166289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Moore J.W., Herrera-Foessel S., Lan C., Schnippenkoetter W., Ayliffe M., Huerta-Espino J., Lillemo M., Viccars L., Milne R., Periyannan S., et al. A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nat. Genet. 2015;47:1494–1498. doi: 10.1038/ng.3439. [DOI] [PubMed] [Google Scholar]
  • 26.Marchal C., Zhang J., Zhang P., Fenwick P., Steuernagel B., Adamski N.M., Boyd L., McIntosh R., Wulff B.B.H., Berry S., et al. BED-domain-containing immune receptors confer diverse resistance spectra to yellow rust. Nat. Plants. 2018;4:662–668. doi: 10.1038/s41477-018-0236-4. [DOI] [PubMed] [Google Scholar]
  • 27.Zegeye W.A., Zhang Y., Cao L., Cheng S. Whole Genome Resequencing from Bulked Populations as a Rapid QTL and Gene Identification Method in Rice. Int. J. Mol. Sci. 2018;19:4000. doi: 10.3390/ijms19124000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Francis Y.L.C., Henry C.M.L., Yiu S.M. Sequence assembly using next generation sequencing data—Challenges and solutions. Sci. China (Life Sci.) 2014;57:1140–1148. doi: 10.1007/s11427-014-4752-9. [DOI] [PubMed] [Google Scholar]
  • 29.Zou C., Wang P., Xu Y. Bulked sample analysis in genetics, genomics and crop improvement. Plant Biotechnol. J. 2016;14:1941–1955. doi: 10.1111/pbi.12559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wang Y., Xie J., Zhang H., Guo B., Ning S., Chen Y., Lu P., Wu Q., Li M., Zhang D., et al. Mapping stripe rust resistance gene YrZH22 in Chinese wheat cultivar Zhoumai 22 by bulked segregant RNA-Seq (BSR-Seq) and comparative genomics analyses. Theor. Appl. Genet. 2017;130:2191–2201. doi: 10.1007/s00122-017-2950-0. [DOI] [PubMed] [Google Scholar]
  • 31.Li Y., Shi X., Hu J., Wu P., Qiu D., Qu Y., Xie J., Wu Q., Zhang H., Yang L., et al. Identification of a Recessive Gene PmQ Conferring Resistance to Powdery Mildew in Wheat Landrace Qingxinmai Using BSR-Seq Analysis. Plant Dis. 2020;104:743–751. doi: 10.1094/PDIS-08-19-1745-RE. [DOI] [PubMed] [Google Scholar]
  • 32.Xie J.Z. Ph.D. Thesis. China University of Agricultural; Beijing, China: 2016. Establishment and application of BSR-Seq for gene mapping in wheat and sequence analysis of Aegilops tauschii chromosome arm 3DS. [Google Scholar]
  • 33.Liang Y., Zhang D.-Y., Ouyang S., Xie J., Wu Q., Wang Z., Cui Y., Lu P., Zhang D., Liu Z.-J., et al. Dynamic evolution of resistance gene analogs in the orthologous genomic regions of powdery mildew resistance gene MlIW170 in Triticum dicoccoides and Aegilops tauschii. Theor. Appl. Genet. 2015;128:1617–1629. doi: 10.1007/s00122-015-2536-7. [DOI] [PubMed] [Google Scholar]
  • 34.Nakata M., Miyashita T., Kimura R., Nakata Y., Yamakawa H. MutMapPlus identified novel mutant alleles of a rice starch branching enzyme IIb gene for fine-tuning of cooked rice texture. Plant Biotechnol. J. 2017;16:1–13. doi: 10.1111/pbi.12753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Mo Y., Howell T., Vasquez-Gross H., de Haro L.A., Dubcovsky J., Pearce S. Mapping causal mutations by exome sequencing in a wheat TILLING population: A tall mutant case study. Mol. Genet. Genom. 2017;293:463–477. doi: 10.1007/s00438-017-1401-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Li M., Dong L., Li B., Wang Z., Xie J., Qiu D., Li Y., Shi W., Yang L., Wu Q., et al. A CNL protein in wild emmer wheat confers powdery mildew resistance. New Phytol. 2020;228:1027–1037. doi: 10.1111/nph.16761. [DOI] [PubMed] [Google Scholar]
  • 37.Abe A., Kosugi S., Yoshida K., Natsume S., Takagi H., Kanzaki H., Matsumura H., Yoshida K., Mitsuoka C., Tamiru M., et al. Genome sequencing reveals agronomically important loci in rice using MutMap. Nat. Biotechnol. 2012;30:174–178. doi: 10.1038/nbt.2095. [DOI] [PubMed] [Google Scholar]
  • 38.Nordström K.J.V., Albani M.C., James G.V., Gutjahr C., Hartwig B., Turck F., Paszkowski U., Coupland G., Schneeberger K. Mutation identification by direct comparison of whole-genome sequencing data from mutant and wild-type individuals using k-mers. Nat. Biotechnol. 2013;31:325–330. doi: 10.1038/nbt.2515. [DOI] [PubMed] [Google Scholar]
  • 39.Fekih R., Takagi H., Tamiru M., Abe A., Natsume S., Yaegashi H., Sharma S., Sharma S., Kanzaki H., Matsumura H., et al. MutMap+: Genetic mapping and muta-nt identification without crossing in rice. PLoS ONE. 2013;8:e68529. doi: 10.1371/journal.pone.0068529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Schneeberger K., Ossowski S., Lanz C., Juul T., Petersen A.H., Nielsen K.L., Jorgensen J.E., Weigel D., Andersen S.U. SHORE map: Simultaneous mapping and mutation identification by deep sequencing. Nat. Methods. 2009;6:550–551. doi: 10.1038/nmeth0809-550. [DOI] [PubMed] [Google Scholar]
  • 41.Wang Z., Li J., Chen S., Heng Y., Chen Z., Yang J., Zhou K., Pei J., He H., Deng X.W., et al. Poaceae-specific MS1 encodes a phospholipid-binding protein for male fertility in bread wheat. Proc. Natl. Acad. Sci. USA. 2017;114:12614–12619. doi: 10.1073/pnas.1715570114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Singh V.K., Khan A.W., Saxena R.K., Kumar V., Kale S.M., Sinha P., Chitikineni A., Pazhamala L.T., Garg V., Sharma M., et al. Next-generation sequencing for identification of candidate genes for Fusarium wilt and sterility mosaic disease in pigeonpea (Cajanus cajan) Plant Biotechnol. J. 2016;14:1183–1194. doi: 10.1111/pbi.12470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Appels R. Wheat research and breeding in the new era of a high-quality reference genome. Front. Agric. Sci. Eng. 2019;6:225. doi: 10.15302/J-FASE-2019265. [DOI] [Google Scholar]
  • 44.Yang Z.Z., Wang Z.H., Hu Z.R., Xin M.M., Guo W.L. Comparative analysis of the genomic sequences between commercial wheat varieties jimai 22 and liangxing 99. Acta Agron. Sinica. 2020;46:1870–1883. [Google Scholar]
  • 45.Chen C., He Z., Lu J., Li J., Ren Y., Ma C., Xia X. Molecular mapping of stripe rust resistance gene YrJ22 in Chinese wheat cultivar Jimai 22. Mol. Breed. 2016;36:118. doi: 10.1007/s11032-016-0540-5. [DOI] [Google Scholar]
  • 46.Ma S., Wang M., Wu J., Guo W., Chen Y., Li G., Wang Y., Shi W., Xia G., Fu D., et al. WheatOmics: A platform combining multiple omics data to accelerate functional genomics studies in wheat. Mol. Plant. 2021;14:1965–1968. doi: 10.1016/j.molp.2021.10.006. [DOI] [PubMed] [Google Scholar]
  • 47.Liu R.-H., Meng J.-L. MapDraw: A microsoft excel macro for drawing genetic linkage maps based on given genetic linkage data. Hereditas. 2003;25:317–321. [PubMed] [Google Scholar]
  • 48.Luo M., Xie L., Chakraborty S., Wang A., Matny O., Jugovich M., Kolmer J.A., Richardson T., Bhatt D., Hoque M., et al. A five-transgene cassette confers broad-spectrum resistance to a fungal rust pathogen in wheat. Nat. Biotechnol. 2021;39:561–566. doi: 10.1038/s41587-020-00770-x. [DOI] [PubMed] [Google Scholar]
  • 49.Li Y., Xia C., Wang M., Yin C., Chen X. Whole-genome sequencing of Puccinia striiformis f. sp. tritici mutant isolates identifies avirulence gene candidates. BMC Genom. 2020;21:247. doi: 10.1186/s12864-020-6677-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Wu J., Zeng Q., Wang Q., Liu S., Yu S., Mu J., Huang S., Sela H., Distelfeld A., Huang L., et al. SNP-based pool genotyping and haplotype analysis accelerate fine-mapping of the wheat genomic region containing stripe rust resistance gene Yr26. Theor. Appl. Genet. 2018;131:1481–1496. doi: 10.1007/s00122-018-3092-8. [DOI] [PubMed] [Google Scholar]
  • 51.Wu Q., Chen Y., Xie J., Dong L., Wang Z., Lu P., Wang R., Yuan C., Zhang Y., Liu Z. A 36 Mb terminal deletion of chromosome 2BL is responsible for a wheat semi-dwarf mutation. Crop J. 2020;9:873–881. doi: 10.1016/j.cj.2020.06.015. [DOI] [Google Scholar]
  • 52.Wu J., Xu D., Fu L., Wu L., Hao W., Li J., Dong Y., Wang F., Wu Y., He Z., et al. Fine mapping of a stripe rust resistance gene YrZM175 in bread wheat. Theor. Appl. Genet. 2022;135:3485–3496. doi: 10.1007/s00122-022-04195-9. [DOI] [PubMed] [Google Scholar]
  • 53.Yang M.Y., Li G.G., Wan H.S., Li L.P., Li J., Yang W.Y., Pu Z.J., Yang Z.J., Yang E.N. Identification of QTLs for stripe rust r-esistance in a recombinant inbred line population. Inter. J. Mol. Sci. 2019;20:3410. doi: 10.3390/ijms20143410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Wang Z., Ren J., Du Z., Che M., Zhang Y., Quan W., Jiang X., Ma Y., Zhao Y., Zhang Z. Identification of a major QTL on chromosome arm 2AL for reducing yellow rust severity from a Chinese wheat landrace with evidence for durable resistance. Theor. Appl. Genet. 2018;132:457–471. doi: 10.1007/s00122-018-3232-1. [DOI] [PubMed] [Google Scholar]
  • 55.Liu J., He Z., Wu L., Bai B., Wen W., Xie C., Xia X. Genome-Wide Linkage Mapping of QTL for Adult-Plant Resistance to Stripe Rust in a Chinese Wheat Population Linmai 2 × Zhong 892. PLoS ONE. 2015;10:e0145462. doi: 10.1371/journal.pone.0145462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Zeng Q., Wu J., Liu S., Chen X., Yuan F., Su P., Wang Q., Huang S., Mu J., Han D., et al. Genome-wide Mapping for Stripe Rust Resistance Loci in Common Wheat Cultivar Qinnong 142. Plant Dis. 2019;103:439–447. doi: 10.1094/PDIS-05-18-0846-RE. [DOI] [PubMed] [Google Scholar]
  • 57.Naruoka Y., Garland-Campbell K.A., Carter A.H. Genome-wide association mapping for stripe rust (Puccinia striiformis F. sp. tritici) in US Pacific Northwest winter wheat (Triticum aestivum L.) Theor. Appl. Genet. 2015;128:1083–1101. doi: 10.1007/s00122-015-2492-2. [DOI] [PubMed] [Google Scholar]
  • 58.Beat K., Thomas W., Krattinger S.G. Advances in wheat and pathogen genomics: Implications for disease control. Annu. Rev. Phytopathol. 2018;56:67–87. doi: 10.1146/annurev-phyto-080516-035419. [DOI] [PubMed] [Google Scholar]
  • 59.Walkowiak S., Gao L., Monat C., Haberer G., Kassa M.T., Brinton J., Ramirez-Gonzalez R.H., Kolodziej M.C., Delorean E., Thambugala D., et al. Multiple wheat genomes reveal global variation in modern breeding. Nature. 2020;588:277–283. doi: 10.1038/s41586-020-2961-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Andersen E.J., Nepal M.P., Purintun J.M., Nelson D., Mermigka G., Sarris P.F. Wheat Disease Resistance Genes and Their Diversification Through Integrated Domain Fusions. Front. Genet. 2020;11:898. doi: 10.3389/fgene.2020.00898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Wang Y., Huang L., Luo W., Jin Y., Gong F., He J., Liu D., Zheng Y., Wu B. Transcriptome analysis provides insights into the mechanisms underlying wheat cultivar Shumai126 responding to stripe rust. Gene. 2020;768:145290. doi: 10.1016/j.gene.2020.145290. [DOI] [PubMed] [Google Scholar]
  • 62.Li J., Yang J., Li Y., Ma L. Current strategies and advances in wheat biology. Crop J. 2020;8:879–891. doi: 10.1016/j.cj.2020.03.004. [DOI] [Google Scholar]
  • 63.Huang L., Sela H., Feng L., Chen Q., Krugman T., Yan J., Dubcovsky J., Fahima T. Distribution and haplotype diversity of WKS resistance genes in wild emmer wheat natural populations. Theor. Appl. Genet. 2016;129:921–934. doi: 10.1007/s00122-016-2672-8. [DOI] [PubMed] [Google Scholar]
  • 64.Catherine F., Silvia T., Nils S., Laurence A., Aurélie N., Beat K. Map-based isolation of the leaf rust disease resistance gene Lr10 from the hexaploid wheat (Triticum aestivum L.) genome. Proc. Natl. Acad. Sci. USA. 2003;25:15253–15258. doi: 10.1073/pnas.2435133100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Bariana H.S., McIntosh R.A. Cytogenetic studies in wheat. XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A. Genome. 1993;36:476–482. doi: 10.1139/g93-065. [DOI] [PubMed] [Google Scholar]
  • 66.Li Z.F., Zheng T.C., He Z.H., Li G.Q., Xu S.C., Li X.P., Yang G.Y., Singh R.P., Xia X.C. Molecular tagging of stripe rust resistance gene YrZH84 in Chinese wheat line Zhou 8425B. Theor. Appl. Genet. 2006;112:1098–1103. doi: 10.1007/s00122-006-0211-8. [DOI] [PubMed] [Google Scholar]
  • 67.Bolger A.M., Lohse M., Usadel B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–2120. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Dobin A., Davis C.A., Schlesinger F., Drenkow J., Zaleski C., Jha S., Batut P., Chaisson M., Gingeras T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29:15–21. doi: 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Li H., Handsaker B., Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009;25:2078–2079. doi: 10.1093/bioinformatics/btp352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Walker M.A., Pedamallu C.S., I Ojesina A., Bullman S., Sharpe T., Whelan C.W., Meyerson M. GATK PathSeq: A customizable computational tool for the discovery and identification of microbial sequences in libraries from eukaryotic hosts. Bioinformatics. 2018;34:4287–4289. doi: 10.1093/bioinformatics/bty501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.McKenna A., Hanna M., Banks E., Sivachenko A., Cibulskis K., Kernytsky A., Garimella K., Altshuler D., Gabriel S., Daly M., et al. The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010;20:1297–1303. doi: 10.1101/gr.107524.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Altschul S.F., Madden T.L., Schäffer A.A., Zhang J., Zhang Z., Miller W., Lipman D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Cingolani P., Platts A., Wang L.L., Coon M., Nguyen T., Wang L., Land S.J., Lu X., Ruden D.M. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly. 2012;6:80–92. doi: 10.4161/fly.19695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Tian X., Wen W., Xie L., Fu L., Xu D., Fu C., Wang D., Chen X., Xia X., Chen Q., et al. Molecular Mapping of Reduced Plant Height Gene Rht24 in Bread Wheat. Front. Plant Sci. 2017;8:1379. doi: 10.3389/fpls.2017.01379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Ling H.-Q., Zhao S., Liu D., Wang J., Sun H., Zhang C., Fan H., Li D., Dong L., Tao Y., et al. Draft genome of the wheat A-genome progenitor Triticum urartu. Nature. 2013;496:87–90. doi: 10.1038/nature11997. [DOI] [PubMed] [Google Scholar]
  • 76.Singh V.K., Khan A.W., Jaganathan D., Thudi M., Roorkiwal M., Takagi H., Garg V., Kumar V., Chitikineni A., Gaur P.M., et al. QTL-seq for rapid identification of candidate genes for 100-seed weight and root/total plant dry weight ratio under rainfed conditions in chickpea. Plant Biotechnol. J. 2016;14:2110–2119. doi: 10.1111/pbi.12567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Schmittgen T.D., Livak K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008;3:1101–1108. doi: 10.1038/nprot.2008.73. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The data presented in this study is available on request from the corresponding author.


Articles from Plants are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES