Skip to main content
Toxicology Reports logoLink to Toxicology Reports
. 2022 Aug 17;9:1655–1665. doi: 10.1016/j.toxrep.2022.08.006

Bellidifolin from Gentianella acuta (Michx.) Hulten protects H9c2 cells from hydrogen peroxide-induced injury via the PI3K-Akt signal pathway

Siqi Li a,b,c,1, Congying Huang a,b,c,1, Xing Li a,b,c, Xiangxi Meng a,b,c, Rong Wen a,b,c, Xiaodong Zhang d,⁎, Chunhong Zhang a,⁎, Minhui Li a,b,c,⁎⁎
PMCID: PMC9742949  PMID: 36518482

Abstract

Cardiovascular disease is the most common disease in the world and the first among the causes of human death. Its morbidity and mortality increase annually, but no effective treatment is available. Therefore, new drugs should be developed to treat cardiovascular disease. Gentianella acuta (Michx.) Hulten (G. acuta) is an important Mongolian medicine in China and elicits protective effects on cardiovascular health. In this study, liquid chromatography-mass spectrometry (LC-MS) combined with network pharmacology was used to screen the main active ingredients and confirm that bellidifolin was one of the main components for the treatment of ischemic heart disease. Then, rat myocardial (H9c2) cells injury model induced by hydrogen peroxide (H2O2) in vitro was established to verify the effect of bellidifolin on oxidative stress stimulation, including determination of antioxidant enzyme activity and apoptosis. Transcriptome sequencing, qRT-PCR, and western blot were performed to further verify the antioxidant stress mechanism of bellidifolin. Results showed that bellidifolin pretreatment decreased the rate of apoptosis and the levels of lactate dehydrogenase (LDH), creatine kinase (CK), and alanine aminotransferase (ALT). Conversely, it increased the contents of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) in a dose-dependent manner, indicating that bellidifolin caused a protective effect on cardiomyocyte injury. Bellidifolin minimized the H2O2-induced cell injury by activating the PI3K-Akt signal pathway and downregulating glycogen synthase kinase-3β (GSK-3β) and p-Akt1/Akt1. Therefore, this work revealed that G. acuta has a good development prospect as an edible medicinal plant in cardiovascular disease. Its bellidifolin component is a potential therapeutic agent for cardiovascular disease induced by oxidative stress damage.

Keywords: Bellidifolin, Network pharmacology, Liquid chromatography-mass spectrometry, H2O2-induced injury, Oxidative stress, Protective effect

Abbreviations: G. acuta, Gentianella acuta(Michx.) Hulten; H9c2, rat myocardial; LDH, lactate dehydrogenase; CK, creatine kinase; ALT, alanine aminotransferase; SOD, superoxide dismutase; GSH-Px, glutathione peroxidase; GSK-3β, glycogen synthase kinase-3β; ROS, reactive oxygen species; PPI, protein-protein interaction; GO, gene ontology; PDB, protein data bank; KEGG, kyoto encyclopedia of genes and genomes; qRT-PCR, quantitative reverse transcription PCR; TP53, tumor protein P53; Akt1, protein kinase B1; TNF, tumor necrosis factor; VEGFA, vascular endothelial growth factor A; IL-6, interleukin 6; DEGs, differentially expressed genes; AMPK, AMP-activated protein kinase; cAMP, cyclic adenosine monophosphate; BP, biological processes; MF, molecular functions; CC, cellular components

Graphical Abstract

ga1

Highlights

  • •

    Tea made from G. acuta is consumed as a tonic for heart protection since a long time by the Ewenki population in Inner Mongolia.

  • •

    A variety of methods were used to study the mechanism of bellidifolin from G. acuta in the treatment of H2O2-induced cytotoxicity.

  • •

    The results demonstrate that PI3K-Akt signal pathway is the main pathway of bellidifolin in the treatment of H2O2-induced cytotoxicity.

1. Introduction

Cardiovascular disease has become an important disease that threatens human life and health all over the world [1], [2]. Atherosclerosis, myocardial ischemia–reperfusion, myocardial infarction are the common clinical diseases [3]. Cardiomyocyte injury is closely related to the occurrence of these diseases [4]. Oxidative stress- and apoptosis-induced cardiomyocyte injuries are important mechanisms of cardiovascular disease [5], [6]. Oxidative stress impairs the function of mitochondria [7] and promotes the excessive production of reactive oxygen species (ROS) [8], [9]. Excessive ROS cause serious damage to cardiomyocytes and lead to apoptosis by destroying the balance of oxidation and antioxidation [10], [11], [12]. Cardiomyocytes are highly differentiated cells; when they apoptose, cardiac dysfunction and heart failure occur [13], [14]. Therefore, the intervention of oxidative stress to reduce cardiomyocyte injury has been widely investigated in the treatment of cardiovascular diseases [15].

The use of plants to treat diseases can be traced back to hundreds of BC, and the development and utilization of medicinal plants is an important pillar of medical and health care all over the world [16]. Their active components have the advantages of lower toxicity and less side effects than synthetic compounds. Therefore, natural antioxidants have been widely investigated [17]. Medicinal plants are rich in antioxidants [18], which are an important source of active components against ischemic heart disease. In recent years, there are more and more studies on the use of natural products to treat cardiomyocyte injury [19], [20]. The isolation and identification of the active components in medicinal plants and the clarification of their cardioprotective mechanism can help us to obtain new ideas for the development of cardioprotective medicinal plants.

Gentianella acuta (Michx.) Hulten (G. acuta) is a commonly used medicine in Mongolian and Tibetan medicine [21], [22]. It belongs to Gentianaceae and is mainly distributed in northern China, Mongolian plateau, Siberia, and the Far East of Russia [23]. According to “Inner Mongolia Phytopharmacology,” it has the functions of clearing heat, promoting the gallbladder, and reducing jaundice. It mainly contains xanthone, schizoiridoid, and other compounds. Modern studies have shown that bellidifolin, a xanthone compound, can play a protective role in the heart [24], [25]. However, studies have yet to determine whether bellidifolin exerts protective effects against oxidative cytotoxicity as a result of its antioxidant property. Therefore, this study was performed to investigate the potential of bellidifolin against H2O2-induced oxidative stress in cultured H9c2 cells for the treatment of ischemic heart disease. This article was also studied to provide a new basis for the treatment of myocardial cell injury.

2. Materials and methods

2.1. Preparation of G. acuta and bellidifolin

G. acuta was collected from Genhe City, Inner Mongolia Autonomous Region. A powdered G. acuta sample was passed through an 80-mesh sieve, and 0.1 g of this sample was placed in a 50 mL conical flask. Methanol (10 mL, 70% MeOH) was added, and ultrasound (40 kHz, 20 min) was applied to produce the crude extract. The sample was then allowed to cool naturally to 25 °C, vortexed (30 s), centrifuged (4500 rpm, 4 °C, 10 min), and filtered through a microporous membrane (0.22 µm).

Bellidifolin was extracted from G. acuta. The whole grass of G. acuta was crushed, dried, refluxed, and extracted with 95% ethanol three times and concentrated under vacuum with a rotary evaporator. The crude mixture was extracted with ethyl acetate in a Soxhlet extractor until a colorless extract was obtained. The extract was concentrated, and the same amount of anhydrous ethanol was added to produce yellow precipitate. After being dried, the precipitate (25 g) was dissolved in ethyl acetate and mixed with the same amount of silica gel (200 mesh) until the silica particles became dry and uniform again. The sample was separated through silica gel column chromatography (150 g, 200–300 mesh silica gel) by using petroleum ether:ethyl acetate (7:3) through the elution of 2–3 column volumes. The liquid was collected, and the solvent was removed under reduced pressure to obtain the target compound (2 g).

2.2. LC-MS analysis of G. acuta

The SCIEX X500 QTOF system was used in this assay. Chromatographic separation was performed on the Acquity UPLC BEH C18 (100 mm × 2.1 mm, 1.7 µm; Waters) column. Acetonitrile (solvent B) and water (containing 0.1% formic acid, solvent A) were used as the mobile phase. The gradient was set at 5–95% B for 0–60 min. The flow rate was 0.3 mL/min, the column temperature was 40 °C, and the sample quantity was 5 μL.

Mass spectrometry data were acquired using the SCIEX X-500R QTOF (SCIEX, USA) equipped with an ESI interface in the positive ion modes. Parameters used were as follows: temperature, 500 °C; spray voltage, 5500 V (positive ion mode); curtain gas, 30 psi; and CAD gas, 7 psi. MS data were generated across a mass range of 100–1500 Da. The stepped normalized collision energy settings were 20, 40, and 60 V. All MS spectra were analyzed using SCIEX OS software (SCIEX, USA).

2.3. Network pharmacology and molecular docking analysis

The compounds in G. acuta, which appears in the results of LC-MS analysis and literature reports were found in Pubchem (https://pubchem.ncbi.nlm.nih.gov/) to obtain the SMILES number. And the corresponding targets of these compounds were searched in SwissTargetPrediction (http://www.swisstargetprediction.ch/). Gene names were then converted to protein names on UniProt (https://www.uniprot.org/). Disease targets were obtained from two existing resources, namely, Genecards (https://www.genecards.org/) and DisGeNET (http://www.disgenet.org/), with the keyword “ischemic heart disease.” Disease and drug targets were inputted to the jvenn online database (http://jvenn.toulouse.inra.fr/app/index.html) to obtain the intersection target. A Protein-Protein Interaction (PPI) network was constructed with the STRING online database (https://cn.string-db.org/). The Kyoto Encyclopedia of Genes and Genomes(KEGG) and Gene Ontology(GO) terms associated with biological processes (BP), molecular functions (MF), and cellular components (CC) were annotated and visualized using the Metascape database. Based on these compounds and targets information, the protein structure of the corresponding target was obtained from the Protein Data Bank (PDB) database (http://www.rcsb.org/). Water and small-molecule ligands were removed using PyMOL 2.4.1, and hydrogenation was performed with Autodock 1.5.6. Subsequently, the file was converted to a pdbqt format. With Autodock Vina 1.1.2, molecular docking was calculated, docking results through PyMOL were visualized, and a molecular docking mode diagram was established.

2.4. Reagents

High-glucose Dulbecco’s modified Eagle medium (DMEM), 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl tetrazolium bromide (MTT), frozen dimethyl sulfoxide (DMSO) stock solution, trypsin, TRIzol, RIPA, BCA kit and Annexin V-FITC kit were purchased from Solarbio (Beijing, China). Fetal bovine serum (FBS), penicillin, streptomycin, and phosphate-buffered saline (PBS) were purchased from HyClone (Logan,UT,USA). PrimeScript™ RT reagent kit was purchased from TaKaRa (Japan). Ultrapure water was purchased from Gen Pure (Germany), and 30% H2O2 was purchased from Nanjing Reagent (Nanjing,China). Lactate dehydrogenase (LDH), superoxide dismutase (SOD), aspartate aminotransferase (AST), creatine kinase (CK), and glutathione peroxidase (GSH-PX) assay kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). A PrimeScriptRT reagent kit (Perfect Real Time) was obtained from TaKaRa Biotechnology Co. (Japan). Antibodies against Akt1, p-Akt1, GSK-3β, and GAPDH were obtained from Affinity Biosciences (Cincinnati, OH, USA). Secondary antibodies were purchased from Beyotime (Shanghai, China).

2.5. Cell culture and treatment

H9c2 cells were purchased from Wuhan Procell Life Technology Co., Ltd. (Wuhan, China). The cells were cultured in DMEM containing 10% FBS and 100 μg/mL streptomycin and 100 U/mL penicillin at 37 °C, 5% CO2, and 95% saturated humidity. Cell growth was observed daily. H9c2 cells were harvested at the logarithmic growth stage for subsequent analyses and divided into control, H2O2 intervention, and bellidifolin groups.

2.6. Establishment of the H2O2-induced injury model

Cells at the logarithmic growth stage were digested with trypsin, diluted with DMEM to a density of 2 × 104 cells/mL, inoculated in 96-well plates for 24 h, assigned to the control and H2O2 intervention groups for the peroxidation challenge and cultured for 1, 2, and 3 h. Subsequently, 5 mg/mL pre-constituted MTT solution was added to the plates that were then incubated for 4 h. After incubation, the culture supernatant was removed, and DMSO (150 μL) added to each well. The contents were mixed and dissolved, and absorbance was measured at 570 nm. The cell survival rate was calculated to determine the optimal injury time and H2O2 concentration.

2.7. Cell viability assay

H9c2 cells were seeded in 96-well plates at a density of 2 × 104 cells/mL in 100 μL of media and incubated at 37 °C for 24 h. Next, bellidifolin was dissolved in DMSO (<0.01%) and then diluted with DMEM to obtain 10 μL of solutions of different concentrations (20, 40, and 80 μM). The cells were treated with these solutions for 24 h. Next, H2O2 (300 μmol/L) was added and allowed to incubate for 3 h (no addition in the control group). MTT (5 mg/mL, 10 μL) and DMSO (150 μL) were added, and a model was established. Lastly, cell viability was determined using MTT reduction assay, and absorbance was measured at 570 nm.

Cell activity was also evaluated through real-time cellular analysis (RTCA). RTCA monitors the cell proliferation in real time, records the cell index (CI), and plots the output with time as the abscissa and CI as the ordinate. For the RTCA, E-Plate 16 was placed in the xCELLigence RTCA system, and a reading was recorded every 15 min for up to 40 h. Changes in CI after bellidifolin treatment indicated the effect of the compound on H9c2 cells.

2.8. Detection of LDH, AST, and CK activities in the culture medium

H9c2 cells were seeded in a 6-well plate at a density of 2 × 104 cells/mL and treated as described above. Cell culture supernatant was collected, and the activities of LDH, AST, and CK were determined using a microplate reader (Thermo, USA) according to the procedure described in the kit.

2.9. Detection of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activities in H9c2 cells

The cells in each group were digested, collected, and suspended in PBS (1 mL). The activities of SOD and GSH-Px were determined according to the instructions of the kit.

2.10. Apoptosis assay

Cell suspensions were prepared after trypsin digestion; the cells were centrifuged at 1000 × g for 5 min. The supernatant was discarded, and the pellet was washed with PBS pre-cooled to 4 °C. The washed cells were centrifuged again (1000 × g, 5 min), and the obtained pellet was suspended in a 2 mL flow tube by using the binding buffer (300 μL) from the Annexin V-FITC kit to obtain a final cell concentration of 5 × 105 cells/mL. Next, 5 μL of Annexin V-FITC was first added to the suspension and incubated in the dark for 10 min and then with 5 μL PI; then, the specimen was stored in the dark for 5 min. Lastly, apoptotic cells were detected using a flow cytometer (BD, USA) by analyzing the cell suspensions within 1 h, and the apoptosis rate was calculated for each group.

2.11. RNA-seq transcriptome analysis

H9c2 cells were divided into control, H2O2 intervention (300 μmol/L H2O2), and bellidifolin (20, 40, and 80 μM) groups. After 12 h, H2O2 was added, and the plates were incubated for 3 h. The cells were then collected, and RNA was extracted using the TRIzol reagent. Sequencing was commissioned to Sangon Biotech Co., Ltd. (Shanghai, China). An Illumina HiSeq 2500 sequencing platform was used for high-throughput sequencing, including RNA library construction, cluster generation, reference genome comparison, screening for differentially expressed transcripts, and functional analysis (GO and KEGG functional enrichment analyses). RNA-seq data were then analyzed using DESeq to identify differentially expressed genes (DEGs) with the following screening criteria: q-value ≤ 0.05 and difference multiple fold change ≥ 1.5.

2.12. Quantitative reverse transcription PCR (qRT-PCR)

Total RNA was extracted from the cultured H9c2 cells by using TRIzol reagent and reverse-transcribed with a PrimeScript™ RT reagent kit with gDNA Eraser (Perfect Real Time) in accordance with the manufacturer’s instructions. The aliquots of the obtained cDNA samples were then amplified through PCR with the following schedule: 40 cycles at 95 °C for 30 s, primer annealing at 95 °C for 5 s, and extension at 60 °C for 34 s. The specifically designed primers are listed in Table 1. All primers were tested, the fluorescence signals were recorded, and the relative values were compared with those of the control group.

Table 1.

Oligonucleotide primers used in qRT-PCR.

Gene Forward Reverse
Akt GAAGGAGAAGGCCACAGGTC CCTGGTTGTAGAAGGGCAGG
GSK-3β GGAGAACTGGTGGCCATCAA ACACAGCCTGCAGACCATAC
β-actin CTGGGACGACATGGAGAAAA AAGGAAGGCTGGAAGAGTGC

2.13. Western blotting

Cells from all groups were washed twice with PBS and digested with RIPA containing PMSF and phosphatase inhibitors. The liquid supernatant was collected after centrifugation at 13,500 × g for 10 min at 4 °C. The protein concentration in the supernatant was determined using the BCA kit. Equal amounts of protein (60 µg) were separated on 10% SDS-PAGE and subsequently transferred to PVDF membranes. Afterward, the membranes were blocked with 5% (w/v) nonfat dry milk in TBST at room temperature for 1 h and incubated at 4 °C overnight with the following primary antibodies: anti-Akt1 (Cat. No.: AF0836, 1:1000), anti-p-Akt1 (Cat. No.: AF8355, 1:500), anti-GSK-3β (Cat. No.: AF5016, 1:1000), and anti-GAPDH (Cat. No.: AF7021, 1:2000). The membranes were then washed three times for 10 min each with TBST and incubated with horseradish peroxidase (HRP)-conjugated affinity-pure goat anti-rabbit IgG (H+L, 1:2000). Lastly, the membranes were washed three times on a shaking table and treated with enhanced chemiluminescent reagent (ECL Advance western blotting detection kit; GE Healthcare Life Sciences) in accordance with the manufacturer’s instructions. Western blot signal strength was measured using Western Bright™ ECL spray and quantitatively assessed using Syngene’s (Cambridge, UK) GeneTools.

2.14. Statistical analysis

All experiments were repeated three times, and data were analyzed using GraphPad Prism 9. Experimental results were expressed as means ± standard deviation (SD), and the groups were confirmed using the t-test or one-way ANOVA. P < 0.05 was considered statistically significant.

3. Result

3.1. Qualitative analysis of G. acuta via LC-MS

SCIEX OS software was used to process the data of all samples, and the obtained data were compared with TCM MS/MS Library 2.1 to identify each compound. The specific conditions are as follows: mass range, 100–1500 Da; mass error, < 5 ppm; difference isotope ratio, < 5%; and library hit score, > 80. A total of 8 compounds were identified in a positive ion mode in this method.

TCM MS/MS Library 2.1 is not comprehensive enough because it only contains 1295 compounds. Therefore, fragmentation laws and secondary fragmentation were also performed to assist in compound identification. In a positive ion mode, the parent ion is m/z 275.0559 [M+H]+ when the element composition function of the OS software was used. Therefore, the molecular formula of this compound may be C14H10O6. In collision-induced dissociation, four possible dissociation modes were set: a) –CH3 in the methoxy group on the A ring is removed, resulting in the secondary fragment ion of m/z 260.0326 [M+H-CH3]+; b) the removal of CO to produce the secondary fragment ion of m/z 247.0611 [M+H-CO]+; c) remove a molecule of H2O and C ring C–C (5−6, 7−8) fragmentation to produce m/z 232.0370 [M+H-C2H3O]+; and d) H2O that loses a molecule on the C ring and C–C (2–3, 8b-1) on the A ring is broken to obtain the fragment ion of m/z 214.0270 [M+H-C2H5O2]+. Based on the inferred cleavage rule, compound 9 was identified to be bellidifolin (Fig. 1 and Table 2). The specific information of the compounds identified by the above methods is shown in Table 2.

Fig. 1.

Fig. 1

Cracking laws of bellidifolin.

Table 2.

Identification of major chemical constituents in Gentianella acuta (Michx.) Hulten.

NO. Molecular Formula Retention Time (min) Mass (m/z) Identification
1 C16H20O9 6.50 357.1180 Gentiopicrina
2 C16H22O9 5.70 359.1336 Swerosidea
3 C19H18O11 6.53 423.0921 Mangiferina
4 C20H20O11 8.61 437.1082 7-O-Methylmangiferina
5 C21H20O11 7.82 449.1069 Isoorientina
6 C21H20O10 9.23 433.1121 Isovitexina
7 C15H10O6 8.49 287.0557 Luteolina
8 C30H48O3 43.45 457.3678 Ursolic Acida
9 C14H10O6 24.52 275.0559 Bellidifolin
a

Compared with TCM MS/MS library 2.1

3.2. Network pharmacological analysis of G. acuta for the treatment of ischemic heart disease

According to the identification results of LC-MS and literature reports, 37 active components and 210 potential targets were obtained (Table 3). Genecards and DisGeNET databases were used to search the targets with “ischemic heart disease”, and 4064 targets were obtained. The target of G. acuta and ischemic heart disease were input into jveen, and 135 common targets were determined (Fig. 2A). Compounds, compound targets, and disease targets were collated and imported into Cytoscape 3.7.1 to construct a drug active component–target network consisting of 249 nodes and 701 edges (Fig. 2B). According to the degree value analysis, the top five compounds are luteolin, swertiabisxanthone-i, cinnamic acid, 1,3,5-trihydroxyxanthone, and bellidifolin. Then, 135 common targets were imported into the STRING database to construct the PPI network and analyzed visually with Cytoscape3.7.1 (Fig. 2C). According to the ranking of degree values, the top five targets were tumor protein P53 (TP53), protein kinase B1 (Akt1), tumor necrosis factor (TNF), vascular endothelial growth factor A (VEGFA), and interleukin 6 (IL-6). Drug–disease common targets was subjected to KEGG enrichment analysis using the Metascape database. This analysis showed that the included pathways were those in cancer, prostate cancer, endocrine resistance, PI3K/Akt signaling pathway, and proteoglycans in cancer among others (Fig. 2D).

Table 3.

Active ingredients of Gentianella acuta (Michx.) Hulten.

NO. Ingredient Molecular Formula Molecular Weight
Ga1 Norswertianolin C19H18O11 422.3
Ga2 Swertianolin C20H20O11 436.4
Ga3 Veratriloside C21H22O11 450.4
Ga4 1,3,5,8-Tetrahydroxyxanthone C13H8O6 260.2
Ga5 Mangiferin C19H18O11 422.3
Ga6 Bellidifolin C14H10O6 274.22
Ga7 Isoswertianolin C20H20O11 436.4
Ga8 Isoorientin C21H20O11 448.4
Ga9 Demethylbellidifolin C13H8O6 260.2
Ga10 Luteolin C15H10O6 286.24
Ga11 Isovitexin C21H20O10 432.4
Ga12 Swertiapuniside C26H30O16 598.5
Ga13 Gentiopicroside C16H20O9 356.32
Ga14 Loganic acid C16H24O10 376.3
Ga15 Secologanin C17H24O10 388.4
Ga16 Secoxyloganin C17H24O11 404.4
Ga17 Corymbiferin C15H12O7 304.25
Ga18 Triptexanthoside A C19H18O11 422.3
Ga19 Bellidifolin-8-O-glucoside C20H20O11 436.4
Ga20 Triptexanthoside C C21H22O12 466.4
Ga21 Swertiabisxanthone-I C26H14O12 518.4
Ga22 Sweroside C16H22O9 358.34
Ga23 Decentapicrin C C23H26O11 478.4
Ga24 Decentapicrin A C23H26O11 478.4
Ga25 7-Ketologanin C17H24O10 388.4
Ga26 1,7-dihydroxy-3,4-dimethoxyxanthone C15H12O6 288.25
Ga27 Secologanol C17H26O10 390.4
Ga28 Eustomoside C16H22O11 390.34
Ga29 Corymbiferin-1-O-glucoside C21H22O12 466.4
Ga30 1,3,5-Trihydroxyxanthone C13H8O5 244.2
Ga31 Secologanoside C16H22O11 390.34
Ga32 Acanthoside D C34H46O18 742.7
Ga33 Cantharidin C10H12O4 196.2
Ga34 Hyperin C21H20O12 464.4
Ga35 Cinnamic acid C9H8O2 148.16
Ga36 7-O-Methylmangiferin C20H20O11 436.4
Ga37 Swertiamarin C16H22O10 374.34

Fig. 2.

Fig. 2

Network pharmacology prediction of the G. acuta treatment for ischemic heart disease. (A) Venny of drugs and disease (210 drug targets and 4064 disease targets). (B) Drug-active component–target network. The composition of G. acuta is shown in blue (37 in total); relevant targets are indicated in purple (135 in total). (C) Core target protein interaction network. The targets are arranged according to degree value, and the outermost target has a high degree value. (D) KEGG enrichment analysis.

3.3. Molecular docking

Four genes, TP53, Akt1, TNF, and GSK-3β, were selected from the PI3K-Akt signaling pathway and PPI network. Docking results are shown in Table 4. The lower the free energy of the binding between a ligand and a receptor, the more stable the binding conformation and greater the possibility of action. The results showed that bellidifolin had high affinity to TP53, Akt1, TNF, and GSK-3β. After docking results were imported into PyMOL v2.4.1, the software conducts visual analysis. The docking mode of the compound and target is shown in Fig. 3. The structure of the compound and interacting amino acids is represented via a stick diagram in which amino acids are represented in pink, and interconnections by hydrogen bonds are indicated by black dotted lines. The name of the connected amino acid and hydrogen bond distance are also marked in Fig. 3. The results showed that the binding energy of bellidifolin to the targets was less than − 5 kcal·mol-1, indicating that bellidifolin had a high affinity to the targets.

Table 4.

Molecular docking affinity.

Compound Binding energy/ (kcal·mol-1)
Akt1 TNF GSK-3β TP53
Bellidifolin -8.2 -8.3 -8.2 -5.1

Fig. 3.

Fig. 3

Docking mode diagram of the core compound and target molecules (The pink structure represents bellidifolin. Attached to the pink structure are amino acids.).

3.4. Establishment of H2O2-induced cell injury model

As shown in Fig. 4, compared with that in the control group, the groups treated with 50, 100, 200, 300, and 400 μM H2O2 showed a dose-dependent increase in the proportion of damaged cells (P < 0.05). After peroxidation for 1, 2, and 3 h, the group treated with 400 µM H2O2 showed the highest cell death, whereas about 50% of the cells survived after 3 h of treatment with 300 µM H2O2. Therefore, 300 µM H2O2 and a treatment time of 3 h were selected as the optimal conditions for establishing the H2O2-induced injury model.

Fig. 4.

Fig. 4

Establishment of the H2O2 model. ***P < 0.001 compared with the control group (means ± SD, n = 3).

Cells grown for 24 h were incubated with 20, 40, and 80 μM bellidifolin for an additional 12 h and subsequently treated with H2O2 to induce oxidative stress. As shown in Fig. 5, after H2O2 treatment, the cell index (CI) of the model and bellidifolin groups was significantly lower than that of the control group, and the CI of the bellidifolin groups increased in a dose-dependent manner compared with that of the H2O2 intervention groups.

Fig. 5.

Fig. 5

Effect of bellidifolin on H9c2 cells evaluated by using RTCA (means ± SD, n = 3).

3.5. Cell viability assay

MTT assay results revealed that bellidifolin had no toxicity at 20, 40, and 80 μM with treatment times of up to 24 h, and the survival rates of the different groups did not differ significantly from that of the control group (P > 0.05). As shown in Fig. 6, compared with that of the control group, the survival rate of H9c2 cells in the H2O2 intervention group was significantly reduced (P < 0.05). The cell viability in bellidifolin groups and H2O2 intervention group was lower than that in control group, while the cell viability in bellidifolin groups was significantly higher than that in H2O2 intervention group (P < 0.05). And the cell viability also increased with the increase of belllidifolin concentration. Because the bellidifolin concentrations used were lower than toxic levels, bellidifolin toxicity was ruled out as the possible cause of the reduced cell viability in the bellidifolin groups relative to that in the control group.

Fig. 6.

Fig. 6

Effect of bellidifolin on the viability of H9c2 cells (means ± SD, n = 3). ***P < 0.001, **P < 0.01 compared with the control group; ###P < 0.001, ##P < 0.01, #P < 0.05 compared with H2O2.

3.6. Effect of bellidifolin on the antioxidant enzyme activities

To analyze whether bellidifolin could alleviate the oxidative stress in H9c2 cells, we assayed the activities of SOD, AST, CK, GSH-px, and LDH. Compared with that in the control group, the H2O2 intervention group showed significant differences in enzyme activities, indicating that the model was successfully established (P < 0.05). As shown in Fig. 7A, B, and C, the LDH, AST, and CK levels were lower in the bellidifolin groups than in the H2O2 intervention group (P < 0.05). Furthermore, the activities of SOD and GSH-Px (Fig. 7D and E) were substantially increased in the bellidifolin groups compared with those in the H2O2 intervention group (P < 0.05). These results demonstrated the strong in vitro antioxidant activity of bellidifolin against H2O2-induced oxidative damage.

Fig. 7.

Fig. 7

Effect of bellidifolin on the activities of the antioxidant enzymes (means ± SD, n = 3). ***P < 0.001 compared with the control group; ###P < 0.001, ##P < 0.01, #P < 0.05 compared with H2O2.

3.7. Bellidifolin protected H9c2 cells from H2O2-induced apoptosis

We used the Annexin V-PI method to analyze the effects of bellidifolin on the apoptosis of H9c2 cells. As shown in Fig. 8, the exposure of H9c2 cells to H2O2 (300 µM) for 3 h induced the apoptosis of approximately 47.75% of cells. Pretreatment with bellidifolin at different concentrations decreased the proportion of apoptotic cells in a dose-dependent manner (P < 0.05), suggesting that bellidifolin could protect H9c2 cells from H2O2-induced apoptosis.

Fig. 8.

Fig. 8

Bellidifolin protected H9c2 cells from H2O2-induced apoptosis (means ± SD, n = 3). ***P < 0.001 compared with the control group; ###P < 0.001 compared with H2O2.

3.8. RNA-seq transcriptome analysis of H9c2 cells treated with bellidifolin

Cellular RNA was extracted from the H2O2 intervention group (H2O2-treated, n = 3), bellidifolin groups (H2O2 and bellidifolin 20, 40, and 80 μM treatment, n = 3), and control group. Model-3 and bellidifolin-1 had poor repeatability and belong to outlier groups. Thus, they were removed during analysis. In DEGs, the genes between the H2O2 intervention group (M) and the bellidifolin groups (A) showed 69 DEGs, including 20 upregulated and 49 downregulated genes. Between the H2O2 intervention group (M) and control group (C), there are 828 DEGs, including 161 upregulated and 667 downregulated genes, were identified. Seventeen genes overlapped, as shown by the Venn diagram in Fig. 9A. According to the enrichment of differential genes, 37 related signaling pathways were found in M vs. A and 175 in M vs. C, including 31 identical signaling pathways. The enrichment analysis of the first 20 of the 31 pathways is shown in Fig. 9B. The pathways associated with cardiomyocytes or oxidative stress included adrenergic signaling in cardiomyocytes, cardiac muscle contraction, AMP-activated protein kinase (AMPK) signaling pathway, cyclic adenosine monophosphate (cAMP) signaling pathway and PI3K/Akt signaling pathway. The volcano plots of M vs. A GO analysis is shown in Fig. 9C. The enriched BP of the targets were mainly associated with cellular component organization or biogenesis and positive regulation. CC were mainly distributed in organelles and supramolecular fiber. For the enriched MF, target proteins were mainly associated with binding and enzyme regulatory activities.

Fig. 9.

Fig. 9

Transcriptomic analysis of bellidifolin-treated H2O2-induced H9c2 cells.

(A) KEGG enrichment analysis of DGEs of M vs. C and M vs. A. (B) DEGs Venn diagram. Different colors represent various combinations of comparisons. (C) GO enrichment analysis of DGEs of M vs. A.

3.9. Effect of bellidifolin on GSK-3β and Akt in H2O2-induced H9c2 cells

The mRNA levels of Akt and GSK-3β and the protein levels of p-Akt1, Akt1, and GSK-3β were detected through qRT-PCR and western blot, respectively, to investigate the changes in the PI3K-Akt signal pathway. As shown in Fig. 10A and B, the mRNA levels of GSK-3β and Akt significantly decreased in the bellidifolin groups compared with those in the H2O2 intervention group, and significant differences were observed among the groups. The protein expression levels of GSK-3β and p-Akt1/Akt1 significantly decreased in bellidifolin groups. (Fig. 10C, D, and E).

Fig. 10.

Fig. 10

Expression of GSK-3β and Akt. (A), (B): Validation of RNA-seq data by qRT-PCR. (C), (D), (E): Validation of protein expression by western blot. (means ± SD, n = 3). ***P < 0.001, **P < 0.01 compared with the control group; ###P < 0.001, ##P < 0.01, #P < 0.05 compared with H2O2.

4. Discussion

The pathogenesis of cardiovascular disease is complex [26], and cardiomyocyte injury is the pathophysiological basis of various cardiovascular diseases [13], [27]. The occurrence of ischemic heart disease is due to the excessive oxygen consumption of myocardium [28] or excessive blood viscosity [29], [30], which leads to insufficient blood supply and oxygen supply to cardiomyocytes, necrosis of cardiomyocytes or the damage of myocardial blood supply and oxygen supply function, which leads to the accumulation of reactive oxygen free radicals in vivo [31]. Oxidative stress plays an important role in the development and progression of ischemic heart disease. Oxidative stress is caused by an imbalance in oxidative and antioxidant effects, thereby producing large amounts of oxidized intermediate products. ROS include superoxide anion (•O2-), hydroxyl radical (•OH), and H2O2. Excessive ROS production in cardiomyocytes can damage the mitochondria, stimulate the mitochondria to release cytochrome C, and activate caspase family members, such as caspase-9 and caspase-3, eventually leading to cell death via apoptosis [32], [33]·H2O2 intervention is mostly used to generate an appropriate model for in vitro cytotoxicity studies and can partially simulate the heart pathophysiological process of the observed damage in vivo [34]. Therefore, we established H2O2-induced H9c2 cells in vitro.

The effects of G. acuta on ischemic heart disease have been comprehensively studied from chemical and pharmacological perspectives. In this study, 12 compounds, including the xanthone compound bellidifolin, in G. acuta were identified through LC-MS and compared with the literature records. According to previous studies [35], [36], [37], xanthone compounds have significant antioxidant effects. As a representative xanthone compound, bellidifolin was verified to have significant antioxidant properties in our previous experimental study [38]. In addition, the results of network pharmacological analysis showed that bellidifolin ranked highly for the treatment of ischemic heart disease. Therefore, the antioxidant mechanism of bellidifolin was studied in detail. Bellidifolin pretreatment significantly reduced the degree of myocardial injury, reduced cytotoxicity, and increased cell survival in H2O2-induced in vitro models. The combination of the common pathways enriched by M vs. A and M vs. C in RNA-seq and analyzed through network pharmacology showed that the PI3K-Akt signal pathway is the key mechanistic pathway through which bellidifolin acted against the oxidative stress of cardiomyocytes. The level of myocardial enzyme activity in serum is related to the amount of myocardial cell necrosis. At present, the increased activities of LDH,CK, and AST in serum are often used as early diagnostic indicators of myocardial ischemia [39]. In this study, compared with that in the H2O2 intervention group, the bellidifolin groups had significantly increased SOD and GSH-Px activities in cardiomyocytes after H2O2 treatment. Furthermore, the LDH, AST, and CK levels were lower in the bellidifolin groups than in the H2O2 intervention group, indicating that bellidifolin can significantly reduce the toxic effects on H9c2 cardiomyocytes in a H2O2-induced state.

PI3K-Akt signaling pathway is a key signaling cascade that plays a protective role in myocardial ischemia–reperfusion injury in vivo and in vitro. Akt overexpression is detrimental to the heart [40], and ROS can activate Akt through angiotensin II [41], [42]. As a serine/threonine protein kinase, Akt can cooperate with phosphoinositide-dependent protein kinase 1/2 (PDPK1/2) to promote the binding of phosphatidylinositol triphosphate (PIP3) with itself and the transfer of Akt from the cytoplasm to the plasma membrane [43]. At the same time, the phosphorylation of Akt at Ser473 and Thr308 activates the Akt protein kinase activity. GSK-3β is an important signaling protein located downstream of the Akt pathway, activated Akt activates GSK-3β. The Akt-related pathway can induce the phosphorylation of Ser9 of GSK-3β, thereby inactivating GSK-3β, activating downstream target molecules, reducing the myocardial infarction area, inhibiting myocardial cell apoptosis, and protecting the heart [44], [45]. In the present study, the p-Akt1/Akt1 ratio and GSK-3β expression significantly increased in the H2O2 intervention group. The p-Akt1/Akt1 ratio and GSK-3β expression decreased after bellidifolin treatment, indicating that p-Akt1/Akt1 and GSK-3β are related to H2O2-induced cardiomyocyte toxicity, and bellidifolin protection of H2O2-induced H9c2 cells may be associated with the PI3K-Akt signaling pathway. However, a PI3K-Akt pathway inhibitor was not used in this study to block this pathway, and the exact link should be confirmed in further studies.

5. Conclusions

Edible medicinal plants contain various active ingredients which have a wide range of application prospects, and generally have the characteristics of low toxicity because of their edible properties. Many edible medicinal plant extracts, derivatives, and analogs have been developed and used to regulate health. Edible medicinal plants should be widely studied to determine the active components and mechanism of action, identify their safety and efficacy. G. acuta as an edible medicinal plant is commonly used in Mongolian and Tibetan medicine to make tea as a tonic for heart protection. However, its main active components and mechanism are unclear. This study provides strong evidence of the in vitro protective effects of bellidifolin on myocardial injury and explains its potential protective mechanisms. The results of our rigorous experiments and analysis showed that bellidifolin possesses potent antioxidant effects and functions by activating the PI3K-Akt signal pathway to improve the antioxidant capacity, inhibit cardiomyocyte apoptosis, and prevent cytotoxicity. These findings support the development of clinical application of bellidifolin for the treatment of ischemic heart disease and provide a basis for the development of novel medicines. However, further research in vivo should be performed to support these results.

CRediT authorship contribution statement

Siqi Li: Conceptualization, Writing − original draft, Writing − review & editing. Congying Huang: Conceptualization, Writing − original draft, Writing − review & editing. Xing Li: Methodology, Writing − review & editing. Xiangxi Meng: Writing − review & editing. Rong Wen: Writing − review & editing. Minhui Li: Supervision, Project administration, Funding acquisition. Chunhong Zhang: Supervision, Project administration. Xiaodong Zhang: Supervision, Project administration.

Funding

This work was supported by the National Key Research and Development Program of China (2021YFE0190100).

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

We thank the editors and reviewers for their effort and appreciate the journal for the opportunity to collaborate.

Conflict of Interest

The authors declare no conflicts of interest.

Contributor Information

Xiaodong Zhang, Email: nmmc2006@163.com.

Chunhong Zhang, Email: zchlhh@126.com.

Minhui Li, Email: prof_liminhui@yeah.net.

Data availability

The authors are unable or have chosen not to specify which data has been used.

References

  • 1.Mensah G.A., Roth G.A., Fuster V. The global burden of cardiovascular diseases and risk factors: 2020 and beyond. J. Am. Coll. Cardiol. 2019;74:2529–2532. doi: 10.1016/j.jacc.2019.10.009. [DOI] [PubMed] [Google Scholar]
  • 2.Lennon R.P., Claussen K.A., Kuersteiner K.A. State of the heart: An overview of the disease burden of cardiovascular disease from an epidemiologic perspective. Prim. Care. 2018;45:1–15. doi: 10.1016/j.pop.2017.11.001. [DOI] [PubMed] [Google Scholar]
  • 3.Leong D.P., Joseph P.G., McKee M., Anand S.S., Teo K.K., Schwalm J.D., Yusuf S. Reducing the global burden of cardiovascular disease, Part 2: prevention and treatment of cardiovascular disease. Circ. Res. 2017;121:695–710. doi: 10.1161/CIRCRESAHA.117.311849. [DOI] [PubMed] [Google Scholar]
  • 4.Zhang X., Hu C., Kong C.Y., Song P., Tang Q.Z. Fndc5 alleviates oxidative stress and cardiomyocyte apoptosis in doxorubicin-induced cardiotoxicity via activating akt. Cell. Death. Differ. 2019;27:1. doi: 10.1038/s41418-019-0372-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kuang Y.Y., Zhang Y.Z., Xiao Z., Xu L.J., Wang P., Ma Q.L. Protective effect of dimethyl fumarate on oxidative damage and signaling in cardiomyocytes. Mol. Med. Rep. 2020;22:2783–2790. doi: 10.3892/mmr.2020.11342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Mukthamba P., Srinivasan K. Hypolipidemic influence of dietary fenugreek (Trigonella foenum-graecum) seeds and garlic (Allium sativum) in experimental myocardial infarction. Food. Funct. 2015;6:3117–3125. doi: 10.1039/c5fo00240k. [DOI] [PubMed] [Google Scholar]
  • 7.Sifuentes-Franco S., Pacheco-Moisés F.P., Rodríguez-Carrizalez A.D., Miranda-Díaz A.G. The role of oxidative stress, mitochondrial function, and autophagy in diabetic polyneuropathy. J. Diabetes. Res. 2017 doi: 10.1155/2017/1673081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bhat A.H., Dar K.B., Anees S., Zargar M.A., Masood A., Sofi M.A., Ganie S.A. Oxidative stress, mitochondrial dysfunction and neurodegenerative diseases; a mechanistic insight. Biomed. Pharmacother. 2015;74:101–110. doi: 10.1016/j.biopha.2015.07.025. [DOI] [PubMed] [Google Scholar]
  • 9.Xu T., Ding W., Ji X.Y., Ao X., Liu Y., Yu W.P., Wang J.X. Oxidative stress in cell death and cardiovascular diseases. Oxid. Med. Cell. Longev. 2019;4 doi: 10.1155/2019/9030563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Boshra V., Atwa A. Effect of cerebrolysin on oxidative stress-induced apoptosis in an experimental rat model of myocardial ischemia. Physiol. Int. 2016;103:310–320. doi: 10.1556/2060.103.2016.3.2. [DOI] [PubMed] [Google Scholar]
  • 11.Zhang D.H., Li Y.F., Heims-Waldron D., Bezzerides V., Guatimosim S., Guo Y.X., Gu F., Zhou P.Z., Lin Z.Q., Ma Q., Liu J.M., Wang D.Z., Pu W.T. Mitochondrial cardiomyopathy caused by elevated reactive oxygen species and impaired cardiomyocyte proliferation. Circ. Res. 2018;122:74–87. doi: 10.1161/CIRCRESAHA.117.311349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zhao R.Z., Wang X.B., Jiang S., Ru N.Y., Jiao B., Wang Y.Y., Yu Z.B. Elevated ROS depress mitochondrial oxygen utilization efficiency in cardiomyocytes during acute hypoxia. Pflug. Arch. 2020;472:1619–1630. doi: 10.1007/s00424-020-02463-5. [DOI] [PubMed] [Google Scholar]
  • 13.Zhang L., Liu Y., Li J.Y., Li L.Z., Zhang Y.L., Gong H.Y., Cui Y. Protective effect of rosamultin against H2O2 -induced oxidative stress and apoptosis in H9c2 cardiomyocytes. Oxid. Med. Cell. Longev. 2018 doi: 10.1155/2018/8415610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kunapuli S., Rosanio S., Schwarz E.R. "How do cardiomyocytes die?" Apoptosis and autophagic cell death in cardiac myocytes. J. Card. Fail. 2006;12:381–391. doi: 10.1016/j.cardfail.2006.02.002. [DOI] [PubMed] [Google Scholar]
  • 15.Yang B., Zheng C.Y., Yu H.C., Zhang R., Zhao C., Cai S.L. Cardio-protective effects of salvianolic acid B on oxygen and glucose deprivation (OGD)-treated H9c2 cells. Artif. Cells. 2019;47:2274–2281. doi: 10.1080/21691401.2019.1621885. [DOI] [PubMed] [Google Scholar]
  • 16.Teixidor-Toneu I., Jordan F.M., Hawkins J.A. Comparative phylogenetic methods and the cultural evolution of medicinal plant use. Nat. Plants. 2018;4:754–761. doi: 10.1038/s41477-018-0226-6. [DOI] [PubMed] [Google Scholar]
  • 17.Malik S. Biotechnology and production of anti-cancer compounds. Springe Int. Publ. AG. 2017:1–38. [Google Scholar]
  • 18.Abdelghffar E.A., Obaid W.A., Elgamal A.M., Daoud R., Sobeh M., El Raey M.A. Pea (Pisum sativum) peel extract attenuates DOX-induced oxidative myocardial injury. Biomed. Pharmacother. 2021;143 doi: 10.1016/j.biopha.2021.112120. [DOI] [PubMed] [Google Scholar]
  • 19.Bai J.Q., Wang X.P., Du S.B., Wang P.F., Wang Y.H., Quan L., Xie Y.D. Study on the protective effects of danshen-honghua herb pair (DHHP) on myocardial ischaemia/reperfusion injury (MIRI) and potential mechanisms based on apoptosis and mitochondria. Pharm. Biol. 2021;59:335–346. doi: 10.1080/13880209.2021.1893346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Marmitt D.J., Bitencourt S., da Silva G.R., Rempel C., Goettert M.I. Traditional plants with antioxidant properties in clinical trials-A systematic review. Phytother. Res. 2021;35(10):5647–5667. doi: 10.1002/ptr.7202. [DOI] [PubMed] [Google Scholar]
  • 21.Guo K., Liu Y.C., Liu Y., Zhang H., Li W.Y., Shi Q.M., Li X.N., Zeng F., Li S.H. Immunosuppressive gentianellane-type sesterterpenoids from the traditional Uighur medicine Gentianella turkestanorum. Phytochemistry. 2021;187 doi: 10.1016/j.phytochem.2021.112780. [DOI] [PubMed] [Google Scholar]
  • 22.Li J., Zhang W.Z., Tian H.Z., Zuo J., Hu X.Y. Research progress in chemical constituents and pharmacological action of Gentianella acuta. Guid J. Tradit. Chin. Med. Pharm. 2019;25:98–107. [Google Scholar]
  • 23.Wang Z.B., Wu Q., Yu Y., Yang C.J., Jiang H., Wang Q.H., Yang B.Y., Kuang H.X. Determination and pharmacokinetic study of four xanthones in rat plasma after oral administration of Gentianella acuta extract by uhplc–esi–ms/ms. J. Ethnopharmacol. 2015;74:261–269. doi: 10.1016/j.jep.2015.08.023. [DOI] [PubMed] [Google Scholar]
  • 24.Lv L.J., Wang Y.F., Yan T., Han H.R., Li M.H. Preparation of swertianolin from Gentianella acuta and its effects on arrhythmia induced by aconitine in mice. Chin. J. N. Drugs Clin. Remedies. 2019 [Google Scholar]
  • 25.Wang Z.B., Wu G.S., Liu H., Xing N., Sun Y.P., Zhai Y.D., Yang B.Y., Kong A.T., Kuang H.X., Wang Q.H. Cardioprotective effect of the xanthones from Gentianella acuta against myocardial ischemia/reperfusion injury in isolated rat heart. Biomed. Pharmacother. 2017;93:626–635. doi: 10.1016/j.biopha.2017.06.068. [DOI] [PubMed] [Google Scholar]
  • 26.Frangogiannis N.G. Pathophysiology of myocardial infarction. Compr. Physiol. 2015;5:1841–1875. doi: 10.1002/cphy.c150006. [DOI] [PubMed] [Google Scholar]
  • 27.Heallen T.R., Kadow Z.A., Kim J.H., Wang J., Martin J.F. Stimulating cardiogenesis as a treatment for heart failure. Circ. Res. 2019;124:1647–1657. doi: 10.1161/CIRCRESAHA.118.313573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Semenza G.L. Hypoxia-inducible factor 1 and cardiovascular disease. Annu. Rev. Physiol. 2014;76:39–56. doi: 10.1146/annurev-physiol-021113-170322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sweetnam P.M., Thomas H.F., Yarnell J.W., Beswick A.D., Baker I.A., Elwood P.C. Fibrinogen, viscosity and the 10-year incidence of ischaemic heart disease. Eur. Heart J. 1996;17:1814–1820. doi: 10.1093/oxfordjournals.eurheartj.a014797. [DOI] [PubMed] [Google Scholar]
  • 30.Yarnell J.W., Baker I.A., Sweetnam P.M., Bainton D., O’Brien J.R., Whitehead P.J., Elwood P.C. Fibrinogen, viscosity, and white blood cell count are major risk factors for ischemic heart disease. The Caerphilly and Speedwell collaborative heart disease studies. Circulation. 1991;83:836–844. doi: 10.1161/01.cir.83.3.836. [DOI] [PubMed] [Google Scholar]
  • 31.Leng J., Wang Z., Fu C.L., Zhang J., Ren S., Hu J.N., Jiang S., Wang Y.P., Chen C., Li W. NF-κB and AMPK/PI3K/Akt signaling pathways are involved in the protective effects of Platycodon grandiflorum saponins against acetaminophen-induced acute hepatotoxicity in mice. Phytother. Res. 2018;32:2235–2246. doi: 10.1002/ptr.6160. [DOI] [PubMed] [Google Scholar]
  • 32.Rajendran P., Nandakumar N., Rengarajan T., Palaniswami R., Gnanadhas E.N., Lakshminarasaiah U. Antioxidants and human diseases. Clin. Chim. Acta. 2014;436:332–347. doi: 10.1016/j.cca.2014.06.004. [DOI] [PubMed] [Google Scholar]
  • 33.Gao X., Jiang Y.H., Xu Q., Liu F., Pang X.N., Wang M.J., Li Q., Li Z.C. 4-Hydroxyderricin promotes apoptosis and cell cycle arrest through regulating PI3K/AKT/mTOR pathway in hepatocellular cells. Foods. 2021;10:2036. doi: 10.3390/foods10092036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sun G.Z., Ye N., Dai D.X., Chen Y.T., Li C., Sun Y.X. The protective role of the TOPK/PBK pathway in myocardial ischemia/reperfusion and H2O2-induced injury in H9c2 cardiomyocytes. Int. J. Mol. Sci. 2016;17 doi: 10.3390/ijms17030267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Wei Y., Su X.L., Xu T.L. Research Progress of Gentianella. Modernization of Traditional Chinese Medicine and Materia Materia-World Science and Technology. 2020;8:2975–2991. [Google Scholar]
  • 36.Pang Y.H., Guan W., Hu X.Y., Gao Y.Y., Li J. Research advance on chemical constituents and pharmacological effects of Gentianella acuta. Chin. Tradit. Herb. Drugs. 2018;49:5468–5476. [Google Scholar]
  • 37.Wang Q.Q., Yin X., Zhou L.H., Wang H. New advances in studies on cardioprotective effects of luteolin. Chin. J. Mod. Med. 2020;30:57–60. [Google Scholar]
  • 38.Ren K., Gong X., Zhang R.F., Zhang Y. Protective effect of bellidifolin on H2O2-induced H9c2 cardiomyocyte injury. J. Med. Pharm. Chin. Minor. 2020;26:31–35. [Google Scholar]
  • 39.Wu Y.Q., Wang H.J., Feng S.J., Yuan F., Li H.F., Feng Q., Hou A.J. Protective effect of silibinin on oxidative stress injury of H9c2 cardiomyocytes induced by H2O2. Drugs. Clin. 2015;30:503–508. [Google Scholar]
  • 40.Condorelli G., Drusco A., Stassi G., Bellacosa A., Roncarati R., Iaccarino G., Russo M.A., Gu Y., Dalton N., Chung C., Latronico M.V., Napoli C., Sadoshima J., Croce C.M., Ross J. Akt induces enhanced myocardial contractility and cell size in vivo in transgenic mice. Proc. Natl. Acad. Sci. 2002;99:12333–12338. doi: 10.1073/pnas.172376399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Takahashi T., Taniguchi T., Konishi H., Kikkawa U., Ishikawa Y., Yokoyama M. Activation of Akt/protein kinase B after stimulation with angiotensin II in vascular smooth muscle cells. Am. J. Physiol. 1999;276:H1927–H1934. doi: 10.1152/ajpheart.1999.276.6.H1927. [DOI] [PubMed] [Google Scholar]
  • 42.Ushio-Fukai M., Alexander R.W., Akers M., Yin Q., Fujio Y., Walsh K., Griendling K.K. Reactive oxygen species mediate the activation of Akt/protein kinase B by angiotensin II in vascular smooth muscle cells. J. Biol. Chem. 1999;274:22699–22704. doi: 10.1074/jbc.274.32.22699. [DOI] [PubMed] [Google Scholar]
  • 43.Zhang K.Q., Dai Z., Li Y.P. Analysis on tetrandrine activating Akt/GSK-3b signal pathway for protecting myocardial I/R rats. J. N. Chin. Med. 2018;50:12–17. [Google Scholar]
  • 44.Li J.Y., Ruffenach G., Kararigas G., Cunningham C.M., Motayagheni N., Barakai N., Umar S., Regitz-Zagrosek V., Eghbali M. Intralipid protects the heart in late pregnancy against ischemia/reperfusion injury via Caveolin2/STAT3/GSK-3β pathway. J. Mol. Cell. Cardiol. 2017;102:108–116. doi: 10.1016/j.yjmcc.2016.11.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Cheng Y.Y., Xia Z.Y., Han Y.F., Rong J.H. Plant natural product formononetin protects rat cardiomyocyte H9c2 cells against oxygen glucose deprivation and reoxygenation via inhibiting ROS formation and promoting GSK-3β phosphorylation. Oxid. Med. Cell Longev. 2016;2016 doi: 10.1155/2016/2060874. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The authors are unable or have chosen not to specify which data has been used.


Articles from Toxicology Reports are provided here courtesy of Elsevier

RESOURCES