Skip to main content
Bioscience Reports logoLink to Bioscience Reports
. 2022 Dec 12;42(12):BSR20221395. doi: 10.1042/BSR20221395

Chronic allergic asthma alters m6A epitranscriptomic tagging of mRNAs and lncRNAs in the lung

Xiuqin Ni 1,2,*,, Xing Li 3,*, Bing Hu 2, Li Wang 2
PMCID: PMC9744720  PMID: 36250525

Abstract

To evaluate the role of m6A methylation of mRNAs and long non-coding RNAs (lncRNAs) in chronic allergic asthma. Transcriptome-wide N6-methyladenosine (m6A) changes in BALB/c mice were profiled using immunoprecipitated methylated RNAs with microarrays in lung with chronic allergic asthma. Gene ontology (GO) and KEGG analyses were conducted. Target genes were verified by methylated RNA immunoprecipitation and real-time polymerase chain reaction (PCR). Specifically, the mRNA levels of m6A writers (METTL3, METTL14, and WTAP), and readers and erasers (FTO and ALKBH5) were estimated by real-time PCR analysis, using the SYBR-green method. IL17RB mRNA was also evaluated by PCR. Hematoxylin and eosin (H&E) staining showed that the airway and lung tissues in mice in the asthma group had extensive infiltration of inflammatory cells around the bronchioles, blood vessels, and alveoli. The lungs of those allergic asthma mice showed altered m6A epitranscriptome, whereby 1369 mRNAs and 176 lncRNAs were hypermethylated, and 197 mRNAs and 30 lncRNAs were hypomethylated (>1.5-fold vs control). Also, compared with the control group, IL17RB mRNA in lung of the asthmatic group was significantly hypermethylated (P<0.01). In the asthma group, the mRNA and the protein level of METTL14 (the key methyltransferase) and ALKBH5 (the major demethyltransferase) were significantly decreased compared with the control group (P<0.01). Chronic allergic asthma alters the lung m6A epitranscriptome, suggesting functional implications in the pathophysiology of refractory asthma. Data support methylated IL17RB mRNA possibly becoming a new therapeutic target for chronic allergic asthma.

Keywords: allergic asthma, epitranscriptome, IL17RB, lung, N6-methyladenosine

Introduction

Allergic asthma is characterized by a series of immune regulatory events and molecular events. This includes helper T cell 1 (Th1)/helper T cell 2 (Th2) imbalance, helper T cell 17 (Th17)/regulatory T cell (Treg) imbalance, inflammation, phenotypic transformation, and more [1,2]. In addition, diverse post-transcriptional regulators of RNAs involving various classes of noncoding RNAs, RNA-binding proteins (RBPs), and epitranscriptomic modifications can finely regulate immunologic and pathophysiological changes associated with allergic asthma [3,4]. Long non-coding RNA (lncRNA) promotes the proliferation and migration of airway smooth muscle cells, airway inflammation, and Th2 inflammatory response in asthma [4–7]. Moreover, exposure to environmental toxins is closely related to the differentially N6-methyladenosine (m6A)-methylated modification in mRNAs, which is part of the immunomodulatory process [7].

Recently, many studies have discovered that RNAs could undergo more than 100 types of post-transcriptional modifications, which are defined as epitranscriptomic changes [8,9]. Among these modifications, m6A RNA methylation is the most prevalent [10], and can play a biological role in two ways. First, it can change the structure of local RNA, allowing it to enhance RNA–protein interactions. Second, the recruited specific protein binds to the m6A-modified site.

Studies have confirmed that m6A modification plays a role in the transcription, translation, and degradation of mRNA [11,12]. The m6A modification is mainly located in RRACH motifs, which refers to R as a purine base, A as adenine, C as cytosine, and H as a non-guanine base. In mammals, modification occurs by a methyltransferase complex (dedicated writers) consisting of METTL3, METTL14, WTAP, and other components. This modification can be reversed by the demethylases (dedicated erasers) FTO and ALKBH5 [13–15]. Studies have reported that m6A methylation modification may affect an array of life processes, such as sperm development, development of immunity, UV-induced DNA damage response, tumorigenesis or metastasis, stem cell renewal, fat differentiation, biological rhythms, cell development and differentiation, and cell division [16–18]. Thus, studies clearly indicate that changes to core genes are sensitive to the function of m6A modulation, which can cause epigenetic changes.

Studies have also shown that the increased m6A methylation of transcripts is related to inflammation and immune regulation. Other findings indicate that YTHDF2, an m6A reader can regulate the LPS-induced inflammatory response [19]. Differential levels of m6A-methylated mRNAs after stroke can regulate biological processes including inflammation, apoptosis, and transcriptional regulation [9]. Also, m6A methylation of transcripts has an effect on the adaptive immune response by acting on the stability of innate immune molecules [20]. Moreover, a paper by Han et al. proposed that m6A methylation of mRNAs in dendritic cells can control antitumor immunity [21]. There are additional findings, namely that m6A modification can promote pulmonary fibrosis [22], and may be involved in immunoregulation [7]. Currently, however, our knowledge of the role of m6A modifications in allergic asthma remains limited. As a result, we aimed to explore m6A modification of mRNAs and lncRNAs in lung tissues of mice with allergic asthma, which might reveal a new pathophysiological mechanism, and possibly a new therapeutic target for allergic asthma.

Materials and methods

Ovalbumin-sensitized and challenged for allergic asthma model

Twelve BALB/c mice were provided by the Laboratory Animal Research Center in Beijing, China. The mice (6- to 8-week-old, female) were housed in pathogen-free conditions, and were randomized into two groups: the control group and the asthma group. Ovalbumin (OVA)-sensitized and challenge protocols for the chronic model of asthma were carried out according to the methods described by Daubeuf et al. [23], Vieira et al. [24], and Penton et al. [25] with a minor modification. Briefly, the mice in the asthma group were sensitized with 0.01% OVA by intraperitoneal injection on Days 0 and 7, and were subsequently challenged with 2.5% OVA aerosols three times weekly for 7 weeks. The mice in the control group were injected and challenged with PBS. The animals were executed by cervical dislocation 24 h after the last OVA or PBS exposure. All animal experiments and manipulation procedures were done in Harbin Medical University-Daqing and approved by the Ethics Committee for Animal Use and Care at the Institute of Education of Harbin Medical University-Daqing, China.

Hematoxylin and eosin staining

The left lung lobe was fixed with 4% paraformaldehyde, then routinely embedded in paraffin and sectioned (5 µm) for hematoxylin and eosin (H&E) staining. The slides were observed by microscope.

m6A immunoprecipitation

Total RNA (3 μg) and m6A spike-in control mixture were added to IP buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.1% NP40, 40 U/μL RNase inhibitor) containing 2 μg anti-m6A rabbit polyclonal antibody (Synaptic Systems). The reaction was incubated with head-over-tail rotation at 4°C for 2 h. Dynabeads™ M-280 sheep antirabbit IgG beads per sample were blocked with freshly prepared 0.5% BSA at 4°C for 2 h, washed three times with IP buffer, and then resuspended in the total RNA-antibody mixture prepared above. The RNA binding to the m6A-antibody beads was carried out with head-over-tail rotation at 4°C for 2 h. The beads were then washed three times with IP buffer, and twice with wash buffer (50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 0.1% NP40, 40 U/μL RNase Inhibitor). The enriched RNA was eluted with elution buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 0.05% SDS, 40 U Proteinase K) at 50°C for 1 h. The RNA was extracted by acid phenol–chloroform and ethanol precipitation.

Labeling and microarray hybridization

The immunoprecipitated RNA samples from the control and asthma groups (n=3 each) were labeled with Cy5 fluorescent dye using a Super RNA Labeling Kit (Arraystar), and purified using an RNeasy Mini Kit. Cy5-labeled cRNAs were fragmented and hybridized to a mouse m6A-mRNA and lncRNA epitranscriptomic microarray (8×60K, Arraystar) containing 48161 mRNA and 8393 lncRNA degenerate probes. The hybridized arrays were washed, fixed, and scanned using an Agilent Scanner G2505C.

Microarray data analysis

Agilent Feature Extraction software (version 11.0.1.1) was used to analyze acquired array images. Raw intensities of immunoprecipitated RNAs were normalized with an average log2-scaled spike-in RNA control. Differentially m6A-methylated RNAs between the control and asthma groups were identified by filtering with the fold-change and statistical significance (P-value) thresholds. A cutoff of 1.5-fold (P<0.05) was used to identify the differentially m6A-methylated RNAs in asthma samples as compared with control. Hierarchical clustering was performed using R software. Gene ontology (GO) analysis was performed using the topGO package in the R environment for statistical computing and graphics. Pathway analysis was calculated by the Fisher’s exact test.

Real-time polymerase chain reaction

Total RNA (1.5 µg) was reverse transcribed to cDNA with a High Capacity RNA to cDNA Kit (Applied Biosystems). The mRNA levels of m6A writers (METTL3, METTL14, and WTAP), readers and erasers (FTO and ALKBH5) were estimated by real-time polymerase chain reaction (PCR) analysis with the SYBR-green method. IL17RB mRNA was also evaluated by PCR. For methylated RNA immunoprecipitation-quantitative PCR (MeRIP-qRT-PCR) analysis of differentially methylated RNAs, 3 µL immunoprecipitated RNA, or 1 µL input RNA was converted into cDNA and amplified with gene-specific primers for mRNAs (CCL11, TNF, CCL2, CXCL1, CCL8, IL17RB, and IL5). The primers used in the present study are presented in Tables 1 and 2.

Table 1. Sequences of primers used for qRT-PCR analysis of mRNA levels.

Name Sequence Product size (bp)
CCL11 F:5′ TGCTTGATTCCTTCTCTTTCCT 3′ 228
R:5′ TTACTCCTAACTCGTCCCATTGT 3′
TNF F:5′ TCTACTGAACTTCGGGGTGAT 3′ 83
R:5′ TCTGGGCCATAGAACTGATGA 3′
CCL2 F:5′ CCTGCTGTTCACAGTTGC 3′ 110
R:5′ TCATTGGGATCATCTTGC 3′
CXCL1 F:5′ ACCCAAACCGAAGTCATAGCC 3′ 169
R:5′ AGAAGCCAGCGTTCACCAGA 3′
CCL8 F:5′ GTGCTGAAAAGCTACGAGAGAAT 3′ 223
R:5′ CCTGGAGAAGATTAGGGGAGA 3′
IL17RB F:5′ AAGGAAGGAGCACGAAGACG 3′ 109
R:5′ CGACAGACGGTGTGATGGAA 3′
IL5 F:5′ CTCCTCAACTCCCTGCTACTCTC 3′ 194
R:5′ TGTGGCTGGCTCTCATTCAC 3′

Table 2. Sequences of primers used for MeRIP-qRT-PCR analysis of m6A methylation levels.

Name Sequence Product size (bp)
GAPDH F:5′CACTGAGCAAGAGAGGCCCTAT3′ 144
R:5′GCAGCGAACTTTATTGATGGTATT3′
METTL3 F:5′ CGGACACGTGGAGCTCTATC3′ 153
R:5′ GCACGGGACTATCACTACGG3′
METTL14 F:5′ ACCTCCTCCCAAGTCCAAGT3′ 123
R:5′ CCACCTCTCTCTCCTCGGAA3′
WTAP F:5′ GTGTGGCCCAACTGAGATCA3′ 206
R:5′ CACCACAGCTTTCTCGAGGT3′
ALKBH5 F:5′ GGGACAGAGGAGCTCAGGTA3′ 193
R:5′ TGGAGAGCTGCTGACAGTTG3′
FTO F:5′ AGCCCCTGGGTCTCCATAAT 3′ 174
R:5′ AGCACTCAACGCTACTGCTT 3′
IL17RB F:5'GAGAGTGAAGGTGCGGTGGTT3′ 131
R:5′CGTCTGTTGTCATCTGGAGGG3′

Western blotting

Protein were extracted from lung tissues with RIPA lysis buffer obtained from Beyotime in China. Protein quantification was done with Enhanced BCA Protein Assay Kit (Beyotime). Equal amounts of lysate proteins were separated by using SDS-PAGE and transferred to nitrocellulose membranes. After blocking in 5% nonfat milk, the membranes were incubated with the primary antibodies against METTL3 (Cat. No. ab195352, 1:1000 dilution), METTL14 (Cat. No. A8530, 1:500 dilution), WTAP (Cat. No. A8530, 1:500 dilution), FTO (Cat. No. ab280081, 1:1000 dilution), ALKBH5 (Cat. No. ab195377, 1:1000 dilution), β-actin (1:1000; Santa Cruz Biotechnology) overnight at 4°C, followed by a 1 h incuabation with secondary HRP antibodies at a room temperature. All protein blots were visualized using enhanced chemiluminescence reagents (GE Healthcare Life Sciences) and exposure to X-ray.

Statistical analysis

GraphPad Prism 5.0 software was used in the analysis.

Results

m6A modification profiles in lungs of allergic asthma mice

H&E staining showed the pathologic changes of chronic allergic asthma. Specifically, it detected that the airway and lung tissues in mice of the control group had normal smooth bronchial and alveolar structures, and no inflammatory cell infiltration. In contrast, the airway and lung tissues in mice of the asthma group showed extensive infiltration of inflammatory cells around the bronchioles, blood vessels, and alveoli. The airway mucosa had obvious edema, with bronchiolar wall thickening causing luminal stenosis. This finding indicated the successful establishment of the asthmatic model (Figure 1A).

Figure 1. Chronic allergic asthma significantly alters the lung m6A epitranscriptome.

Figure 1

(A) Pathological changes in lung of chronic allergic asthma model. Obvious bronchiolar stenosis can be seen in the asthmatic model group, and the bronchiolar and lung tissues show obvious inflammation and inflammatory cell infiltration (Original magnification: left column ×100, middle column ×200, right column ×400). (B) Assessment of MeRIP quality. The identical methylated RNA immunoprecipitation enrichment of positive and negative spike-in controls was observed via normalizing % (MeRIP/Input) of the positive with negative controls for the asthma and control groups. Data are mean ± SEM (n=3). *P<0.05 compared with the control by the Mann–Whitney U test. Volcano plots for (C) mRNAs and (D) lncRNAs. m6A hypermethylated (red dots) and hypomethylated (blue dots) in the asthma group over the control group (n=3). The green threshold lines are set at 1.5-fold (P<0.05) between the asthma and control. Abbreviations: MeRIP, methylated RNA immunoprecipitation; Neg, negative; Pos, positive.

The immunoprecipitated m6A-methylated RNAs isolated from the lung of mice were profiled in both the asthma and control groups. By assessment of MeRIP quality, the identical methylated RNA immunoprecipitation enrichment of positive and negative spike-in controls was observed in both groups, indicating the rigor of the technique (Figure 1B). Using a microarray with probes for 56554 RNAs (48161 mRNA and 8393 lncRNA), the methylated RNAs microarray profiling showed that 1772 transcripts (1566 mRNAs and 206 lncRNAs) were differentially m6A methylated between the asthma and control groups (fold-change >1.5, P<0.05; n=3/group). The data showed that 87.2% of the transcripts (1369 mRNAs and 176 lncRNAs) were significantly hypermethylated, and only 12.8% of the transcripts (197 mRNAs and 30 lncRNAs) were significantly hypomethylated in the asthma group compared with the control group (Figure 1C,D). The top 20 altered m6A quantities are listed in Tables 3 and 4.

Table 3. The top 20 differently expressed m6A-methylated mRNA with allergic asthma.

Gene name Fold-change Regulation Locus Strand P-value
Rnase2a 126.3905758 Up chr14:51255262-51256112:- - 1.57095 × 10-5
Clca1 77.88635836 Up chr3:145003817-145032776:- - 0.023637391
Ptgdr 39.34120279 Up chr14:44851235-44859375:- - 8.93974 × 10-6
Cd209e 37.49292175 Up chr8:3847965-3854309:- - 0.001287945
RP23-101F14.3 37.08413836 Up chr2:122637915-122641085:+ + 0.000144605
Slc22a29 35.85665903 Up chr19:8160165-8218899:- - 0.031886612
Arg1 28.62280631 Up chr10:24915221-24927484:- - 1.03858 × 10-5
Slc26a4 25.93901282 Up chr12:31519827-31559969:- - 9.68448 × 10-5
Chil4 25.72891127 Up chr3:106201490-106219507:- - 0.000393617
Gcnt3 24.00909968 Up chr9:70031496-70038088:- - 0.000826165
Fabp1 10.38350125 Down chr6:71199827-71205023:+ + 8.66167 × 10-5
Fpr1 4.399144107 Down chr17:17876471-17883940:- - 0.000753326
Apold1 3.458800416 Down chr6:134981718-134986836:+ + 0.003328392
Zc3h18 3.396808743 Down chr8:122411325-122416248:+ + 0.025575942
Tbc1d4 3.16324158 Down chr14:101462974-101609191:- - 0.029726563
Hist1h3d 3.040476346 Down chr13:23575763-23577011:+ + 0.001746882
Zfp287 3.029790124 Down chr11:62721580-62728671:- - 0.017421449
Dnajc28 2.924521477 Down chr16:91614257-91618999:- - 0.033642474
Tmem252 2.915554082 Down chr19:24674008-24679661:+ + 0.020814451
Gemin8 2.736589715 Down chrX:166178402-166180792:+ + 0.018761716

Table 4. The top 20 differently expressed m6A-methylated lncRNA with allergic asthma.

Gene name Fold change Regulation Locus Strand P-value
RP23-71C23.1 21.57256849 Up chr12:106131978-106145400:- - 0.004054933
Fgf18 15.18458121 Up chr11:33116978-33147400:- - 0.000353985
Ntmt1 13.30815266 Up chr2:30807994-30816642:+ + 0.015777808
4930542D17Rik 10.32573787 Up chr16:50590503-50654166:+ + 0.009903069
RP24-118B12.1 9.651769053 Up chr5:33293614-33311150:- - 0.005818338
RP23-309A11.2 7.531065684 Up chr12:103895897-103898784:+ + 0.004853991
RP24-226D9.3 6.601355773 Up chr6:89269511-89285725:- - 8.00499 × 10-5
Saa3 5.657239913 Up chr7:46711999-46713749:- - 0.000933919
Nfyc 5.646882555 Up chr4:120757954-120762175:- - 0.009958198
RP23-272P19.8 4.952742877 Up chr16:19212660-19236776:- - 0.013246835
RP24-182L3.1 3.282208743 Down chr16:13463636-13468755:- - 0.028717785
Brox 2.969035563 Down chr1:183290843-183297256:- - 0.02378089
RP24-95P4.2 2.657611174 Down chr1:57200645-57214993:- - 0.023973675
RP23-334L22.1 2.382843798 Down chr12:117602039-117603763:+ + 0.029132554
RP23-157H17.2 2.327912227 Down chr9:74847983-74852873:+ + 0.042861024
RP23-132N23.1 2.292898301 Down chr2:25141797-25145396:- - 0.042042913
RP23-436D9.1 2.254236114 Down chr11:18467479-18493255:- - 0.000207255
RP24-496C22.4 1.967449237 Down chr5:44700876-44706890:- - 0.034964827
Gm17276 1.936717635 Down chr17:32113429-32141839:+ + 0.018099091
RP23-153M14.4 1.888809851 Down chr4:127035681-127049398:+ + 0.040218634

GO analysis and pathway analysis of differentially methylated mRNA

The physiological and pathological significance of m6A modification in allergic asthma were explored by GO analysis and KEGG pathway analysis. GO analysis illustrated that the up-regulated genes in allergic asthma were significantly associated with the immune system process and its regulation (ontology: biological process), cell and cell part (ontology: cellular component), and binding and protein binding (ontology: molecular function) (Figure 2A). The down-regulated genes were significantly associated with negative regulation of biological and cellular processes (ontology: biological process), intracellular and intracellular part (ontology: cellular component), and binding and protein binding (ontology: molecular function) (Figure 2B). Pathway analysis showed that up-regulated genes in the allergic asthma were significantly associated with cytokine–cytokine receptor interaction and rheumatoid arthritis (Figure 3A,B). The down-regulated genes were significantly associated with neuroactive ligand–receptor interaction and drug metabolism-cytochrome P450 (Figure 3C,D). All GO and pathway significant P-values were less 0.05.

Figure 2. Altered m6A-modified transcripts contribute to the pathophysiology of allergic asthma.

Figure 2

(A) GO enrichment of up-regulation m6A transcripts. (B) GO enrichment of down-regulation m6A transcripts. DE genes refer to differentially expressed genes.

Figure 3. The top modified transcripts of altered m6A relating to the pathophysiology of allergic asthma.

Figure 3

The top ten significantly enriched pathways of up-regulation m6A transcripts by KEGG analysis (A,B). The top ten significantly enriched pathways of down-regulation m6A transcripts (C,D). DE genes refer to differentially expressed genes.

METTL14 and ALKBH5 were down-regulated in lung of mice with allergic asthma

Five major enzymes responsible for m6A modification (METTL3, METTL14, WTAP, FTO, and ALKBH5) were tested for mRNA and protein levels in lung (Figure 4A–C). In the asthma group, mRNA level of METTL14, the key methyltransferase responsible for m6A modifications, was significantly decreased compared with the control group (P=0.032). ALKBH5, the major demethyltransferase, was also significantly decreased (P=0.001). METTL14 and ALBHK5 are also down-regulated at protein level in the group of chronic allergic asthma. While METTL3, WTAP, and the other major demethyltransferases (FTO) were not significantly dysregulated in mRNA or protein level.

Figure 4. Expression of METTL3, METTL14, FTO, WTAP, ALKBH5, METTL14.

Figure 4

(A) Quantitative real-time PCR for METTL3, METTL14, FTO, WTAP, ALKBH5, METTL14 level in mRNA. METTL14 (P=0.032) of and ALKBH5 (P=0.001) were down-regulated in lung of allergic asthma compared with the control group. Results are shown as fold-change of control. Data are expressed as mean ± SD. Data were analyzed using the Mann–Whitney U test. *P<0.05 or **P<0.01 versus control group (n=3). (B) Western blotting for METTL3, METTL14, FTO, WTAP, ALKBH5, METTL14 level in protein. (C) Optical density values for the protein expression relative to β-actin. Data are expressed as mean ± SD. **P<0.01 versus control group (n=6). Abbreviation: SD: standard deviation.

Selection and verification of target genes in m6A modification profiles

As ALKBH5 was significantly decreased (P=0.001), we selected the target genes in the increased m6A-methylated profile. Thirty-nine hypermethylated mRNAs were common to the cytokine–cytokine receptor interaction pathway (KEGG analysis data) and to immune and inflammatory chemokine-related biological processes (GO analysis data) (Figure 5A). Seven hypermethylated (CCL11, TNF, IL5, CCL2, CXCL1, CCL8, IL17RB) mRNAs (>twofold compared with control) were finally selected, as their mRNAs have been clearly reported as being associated with asthma [26–31]. We validated the seven hypermethylated genes by methylated RNA immunoprecipitation and real-time PCR. The results demonstrated that IL17RB mRNA was hypermethylated in lung of the asthmatic group in comparison with the control group (Figure 5B). Moreover, we demonstrated that IL17RB mRNA level in lung in the asthma group was also higher than that of the control group (Figure 5C).

Figure 5. Selection and verification of target genes in m6A modification profiles.

Figure 5

(A) 39 m6A-hypermethylated mRNA coexpressed in interaction of cytokine–cytokine receptor interaction pathway (KEGG analysis data) and immune, inflammation, chemokine (GO analysis data), respectively. (B) Seven target mRNAs of m6A-hypermethylated were detected by quantitative real-time PCR. IL17RB mRNA was hypermethylated in lung of asthmatic group in comparion with that in control group. Data are expressed as mean ± SD. Data were analyzed using the Mann–Whitney U test. **P<0.01 versus control group (n=3). (C) IL17RB mRNA level in lung of asthmatic group was significantly increased in comparion with that in control group. Data are expressed as mean ± SD. Data were analyzed using the Mann–Whitney U test. **P<0.01 versus control group (n=3). Abbreviation: SD: standard deviation.

Discussion

Many studies have recognized that m6A modifications are related in various diseases, including tumor, metabolism, cardiac ischemia, stroke, lung fibrosis, high level PM2.5 exposure, and diabetes [7,9,22,32–34]. However, the role of this newly emerging layer of epigenetics in allergic asthma has not been clarified. The present study sought to evaluate the m6A methylation level in mRNAs and lncRNAs in lung tissue of mice with allergic asthma. We experimented with the chronic model of allergic asthma in mice, then performed transcriptome-wide m6A profiles by immunoprecipitated methylated RNAs with microarrays. The results showed that 1369 mRNAs and 176 lncRNAs were hypermethylated, and 197 mRNAs and 30 lncRNAs were hypomethylated (>1.5-fold compared with control) in lung of mice with allergic asthma. This suggests that chronic allergic asthma could alter m6A-modified transcripts, and potentially play a role in pathophysiologic processes of asthma, and find a new therapeutic target. Recent evidence demonstrates that m6A can induce structural changes to RNAs, thus regulating their accessibility to RBPs [35]. This also indicates that m6A methylation in lncRNAs may lead to their disrupted scaffolding function in allergic asthma.

GO and KEGG pathway analyses were performed to explore the potential functions of altered m6A-modified transcripts. KEGG pathways analysis showed that cytokine-cytokine receptor interaction, including chemokines, class I/II helical cytokines, IL17-like cytokines, TNF family, and TGF-β family exhibited increased m6A methylation, while it was decreased in neuroactive ligand–receptor interaction. Chemokines, IL17-like cytokines, and TNF family are known to regulate airway inflammation of asthma [26,30,31]. Interestingly, GO analysis revealed that immune response, defense response, and inflammatory response were the major biological processes modulated by the differentially m6A-methylated mRNAs in lung of mice with allergic asthma. Currently, drugs used for asthma therapy can relieve inflammation, but in clinical studies, none of them could inhibit airway wall remodeling [36].

The mechanism of airway wall remodeling is not well understood, yet it has been reported that the interaction between the environment and epigenetic events may play a key role in refractory asthma [37]. M6A modification can be modulated by cardiac function during remodeling, and by exposure to environmental toxins. This implies that m6A modification may contribute to immunity, inflammation, or structure remodeling in asthma. Further study is required, however, to determine the precise mechanism by which m6A modification affects pathophysiologic processes of allergic asthma.

M6A is a highly dynamic epitranscriptomic modification that regulates mRNA splicing, export, localization, translation, and stability [11,12]. Expression of METTL3, METTL14, WTAP, and FTO and ALKBH5 is associated with PM2.5 exposure and lung tumors [7,38]. We determined the level of METTL3, METTL14, WTAP, and FTO, ALKBH5 in mRNA and in protein. The m6A writers METTL14 and the m6A eraser ALKBH5 are decreased significantly both in mRNA and protein level in lung of mice with allergic asthma compared with control. These findings indicate that METTL14 and ALKBH5 may contribute to allergic asthma. Next, we anchored the increased m6A methylation data according to the P-value (ALKBH5, P<0.01). Of the seven target genes of m6A hypermethylation we tested, IL17RB mRNA was hypermethylated in lung of the asthmatic group in comparison with the control group. IL-17RB activation can regulate gene expression responsible for the inflammatory and remodeling in asthma by the JNK, MAPK, NF-κB pathways [31]. Thus, the m6A methylation of IL17RB mRNA, regulated by demethylase ALKBH5, may play an important role in the pathogenesis of allergic asthma, and might be a new therapeutic target. Moreover, the precise functions of METTL14, ALKBH5, and m6A methylation of IL17RB mRNA and lncRNAs in asthma need to be further elucidated.

Abbreviations

DE

differentially expressed

GO

gene ontology

H&E

hematoxylin and eosin

lncRNA

long noncoding RNA

m6A

N6-methyladenosine

MeRIP-qRT-PCR

methylated RNA immunoprecipitation-quantitative polymerase chain reaction

OVA

ovalbumin

RBP

RNA-binding protein

Th1

helper T cell 1

Th17

helper T cell 17

Th2

helper T cell 2

Treg

regulatory T cell

Data Availability

The author agree on sharing the present study’s data and its deposit in public repositories. See microarray data in https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE205471

Competing Interests

The authors declare that there are no competing interests associated with the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China [grant numbers 81200011].

CRediT Author Contribution

Xiuqin Ni: Funding acquisition, Project administration, Writing—review & editing. Xing Li: Formal Analysis, Writing—original draft. Bing Hu: Formal Analysis, Methodology. Li Wang: Methodology.

References

  • 1.Hu B., Feng X., Wang L., Song Y. and Ni X. (2018) 5-BDBD ameliorates an OVA-induced allergic asthma by the reduction of Th2 cytokines production. Iran. J. Basic Med. Sci. 21, 364–369 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wang L., Feng X., Hu B., Xia Q., Ni X. and Song Y. (2018) P2X4R promotes airway remodeling by acting on the phenotype switching of bronchial smooth muscle cells in rats. Purinergic Signal. 14, 433–442 10.1007/s11302-018-9625-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Stumm C.L., Halcsik E., Landgraf R.G., Camara N.O., Sogayar M.C. and Jancar S. (2014) Lung remodeling in a mouse model of asthma involves a balance between TGF-beta1 and BMP-7. PloS ONE 9, e95959 10.1371/journal.pone.0095959 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Liu X., Zhang Y., Jiang H., Jiang N. and Gao J. (2019) Integrative analysis of the contribution of mRNAs and long noncoding RNAs to the pathogenesis of asthma. Mol. Med. Rep. 20, 2617–2624 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lin J., Feng X., Zhang J. and Tong Z. (2019) Long noncoding RNA TUG1 promotes airway smooth muscle cells proliferation and migration via sponging miR-590-5p/FGF1 in asthma. Am. J. Transl. Res. 11, 3159–3166 [PMC free article] [PubMed] [Google Scholar]
  • 6.Zhu Y., Mao D., Gao W., Han G. and Hu H. (2019) Analysis of lncRNA expression in patients with eosinophilic and neutrophilic asthma focusing on LNC_000127. Front. Genet. 10, 141 10.3389/fgene.2019.00141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cayir A., Barrow T.M., Guo L. and Byun H.M. (2019) Exposure to environmental toxicants reduces global N6-methyladenosine RNA methylation and alters expression of RNA methylation modulator genes. Environ. Res. 175, 228–234 10.1016/j.envres.2019.05.011 [DOI] [PubMed] [Google Scholar]
  • 8.Gilbert W.V., Bell T.A. and Schaening C. (2016) Messenger RNA modifications: form, distribution, and function. Science 352, 1408–1412 10.1126/science.aad8711 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chokkalla A.K., Mehta S.L., Kim T., Chelluboina B., Kim J. and Vemuganti R. (2019) Transient focal ischemia significantly alters the m(6)A epitranscriptomic tagging of RNAs in the brain. Stroke 50, 2912–2921 10.1161/STROKEAHA.119.026433 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wei C.M., Gershowitz A. and Moss B. (1975) Methylated nucleotides block 5' terminus of HeLa cell messenger RNA. Cell 4, 379–386 10.1016/0092-8674(75)90158-0 [DOI] [PubMed] [Google Scholar]
  • 11.Widagdo J. and Anggono V. (2018) The m6A-epitranscriptomic signature in neurobiology: from neurodevelopment to brain plasticity. J. Neurochem. 147, 137–152 10.1111/jnc.14481 [DOI] [PubMed] [Google Scholar]
  • 12.Dominissini D., Moshitch-Moshkovitz S., Schwartz S., Salmon-Divon M., Ungar L., Osenberg S.et al. (2012) Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 485, 201–206 10.1038/nature11112 [DOI] [PubMed] [Google Scholar]
  • 13.Meyer K.D. and Jaffrey S.R. (2017) Rethinking m(6)A readers, writers, and erasers. Annu. Rev. Cell Dev. Biol. 33, 319–342 10.1146/annurev-cellbio-100616-060758 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Li F., Kennedy S., Hajian T., Gibson E., Seitova A., Chao Xuet al. (2016) A radioactivity-based assay for screening human m6A-RNA methyltransferase, METTL3-METTL14 complex, and demethylase ALKBH5. J. Biomol. Screen. 21, 290–297 10.1177/1087057115623264 [DOI] [PubMed] [Google Scholar]
  • 15.Fu Y., Dominissini D., Rechavi G. and He C. (2014) Gene expression regulation mediated through reversible m(6)A RNA methylation. Nat. Rev. Genet. 15, 293–306 10.1038/nrg3724 [DOI] [PubMed] [Google Scholar]
  • 16.Zheng G., Dahl J.A., Niu Y., Fedorcsak P., Huang C.-M., Li C.J.et al. (2013) ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Mol. Cell 49, 18–29 10.1016/j.molcel.2012.10.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Xu K., Yang Y., Feng G.H., Sun B.F., Chen J.Q., Li Y.F.et al. (2017) Mettl3-mediated m(6)A regulates spermatogonial differentiation and meiosis initiation. Cell Res. 27, 1100–1114 10.1038/cr.2017.100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lin S., Choe J., Du P., Triboulet R. and Gregory R.I. (2016) The m(6)A methyltransferase METTL3 promotes translation in human cancer cells. Mol. Cell 62, 335–345 10.1016/j.molcel.2016.03.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yu R., Li Q., Feng Z., Cai L. and Xu Q. (2019) m6A reader YTHDF2 regulates LPS-induced inflammatory response. Int. J. Mol. Sci. 20, 1323 10.3390/ijms20061323 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Williams G.D., Gokhale N.S. and Horner S.M. (2019) Regulation of viral infection by the RNA modification N6-methyladenosine. Annu. Rev. Virol. 6, 235–253 10.1146/annurev-virology-092818-015559 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Han D., Liu J., Chen C., Dong L., Liu Y., Chang R.et al. (2019) Anti-tumour immunity controlled through mRNA m(6)A methylation and YTHDF1 in dendritic cells. Nature 566, 270–274 10.1038/s41586-019-0916-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Han B., Chu C., Su X., Zhang N., Zhou L., Zhang M.et al. (2020) N(6)-methyladenosine-dependent primary microRNA-126 processing activated PI3K-AKT-mTOR pathway drove the development of pulmonary fibrosis induced by nanoscale carbon black particles in rats. Nanotoxicology 14, 1–20 10.1080/17435390.2019.1661041 [DOI] [PubMed] [Google Scholar]
  • 23.Daubeuf F. and Frossard N. (2014) Eosinophils and the ovalbumin mouse model of asthma. Methods Mol. Biol. 1178, 283–293 10.1007/978-1-4939-1016-8_24 [DOI] [PubMed] [Google Scholar]
  • 24.Vieira R.P., Toledo A.C., Ferreira S.C., Santos A.B., Medeiros M.C., Hage M.et al. (2011) Airway epithelium mediates the anti-inflammatory effects of exercise on asthma. Respir. Physiol. Neurobiol. 175, 383–389 10.1016/j.resp.2011.01.002 [DOI] [PubMed] [Google Scholar]
  • 25.Penton P.C., Wang X., Amatullah H., Cooper J., Godri K., North M.L.et al. (2013) Spleen tyrosine kinase inhibition attenuates airway hyperresponsiveness and pollution-induced enhanced airway response in a chronic mouse model of asthma. J. Allergy Clin. Immunol. 131, 512e511–510-520e511-510 10.1016/j.jaci.2012.07.039 [DOI] [PubMed] [Google Scholar]
  • 26.Hurrell B.P., Galle-Treger L., Jahani P.S., Soroosh P. and Akbari O. (2019) TNFR2 signaling enhances ILC2 survival, function, and induction of airway hyperreactivity. Cell Rep. 29, 4509e4505–4524e4505 10.1016/j.celrep.2019.11.102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Wang X.Z., Zhang H.H., Qian Y.L. and Tang L.F. (2019) Sonic hedgehog (Shh) and CC chemokine ligand 2 signaling pathways in asthma. J. Chin. Med. Assoc. 82, 343–350 10.1097/JCMA.0000000000000094 [DOI] [PubMed] [Google Scholar]
  • 28.Hanashiro J., Muraosa Y., Toyotome T., Hirose K., Watanabe A. and Kamei K. (2019) Schizophyllum commune induces IL-17-mediated neutrophilic airway inflammation in OVA-induced asthma model mice. Sci. Rep. 9, 19321 10.1038/s41598-019-55836-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Cerqueira J.V., Meira C.S., Santos E.S., França L.S., Vasconcelos J.F., Nonaka C.K.et al. (2019) Anti-inflammatory activity of SintMed65, an N-acylhydrazone derivative, in a mouse model of allergic airway inflammation. Int. Immunopharmacol. 75, 105735 10.1016/j.intimp.2019.105735 [DOI] [PubMed] [Google Scholar]
  • 30.Gratchev A., Kzhyshkowska J., Duperrier K., Utikal J., Velten F.W. and Goerdt S. (2004) The receptor for interleukin-17E is induced by Th2 cytokines in antigen-presenting cells. Scand. J. Immunol. 60, 233–237 10.1111/j.0300-9475.2004.01443.x [DOI] [PubMed] [Google Scholar]
  • 31.Wong C.K., Cheung P.F., Ip W.K. and Lam C.W. (2005) Interleukin-25-induced chemokines and interleukin-6 release from eosinophils is mediated by p38 mitogen-activated protein kinase, c-Jun N-terminal kinase, and nuclear factor-kappaB. Am. J. Respir. Cell Mol. Biol. 33, 186–194 10.1165/rcmb.2005-0034OC [DOI] [PubMed] [Google Scholar]
  • 32.Wanna-Udom S., Terashima M., Lyu H., Ishimura A., Takino T., Sakari M.et al. (2020) The m6A methyltransferase METTL3 contributes to transforming growth factor-beta-induced epithelial-mesenchymal transition of lung cancer cells through the regulation of JUNB. Biochem. Biophys. Res. Commun. 524, 150–155 10.1016/j.bbrc.2020.01.042 [DOI] [PubMed] [Google Scholar]
  • 33.Pan T. (2013) N6-methyl-adenosine modification in messenger and long non-coding RNA. Trends Biochem. Sci 38, 204–209 10.1016/j.tibs.2012.12.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Mathiyalagan P., Adamiak M., Mayourian J., Sassi Y., Liang Y., Agarwal N.et al. (2019) FTO-dependent N(6)-methyladenosine regulates cardiac function during remodeling and repair. Circulation 139, 518–532 10.1161/CIRCULATIONAHA.118.033794 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Liu N., Zhou K.I., Parisien M., Dai Q., Diatchenko L. and Pan T. (2017) N6-methyladenosine alters RNA structure to regulate binding of a low-complexity protein. Nucleic. Acids. Res. 45, 6051–6063 10.1093/nar/gkx141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Fang L., Sun Q. and Roth M. (2020) Immunologic and non-immunologic mechanisms leading to airway remodeling in asthma. Int. J. Mol. Sci. 21, 757 10.3390/ijms21030757 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yang I.V., Lozupone C.A. and Schwartz D.A. (2017) The environment, epigenome, and asthma. J. Allergy Clin. Immunol. 140, 14–23 10.1016/j.jaci.2017.05.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Li L.J., Fan Y.G., Leng R.X., Pan H.F. and Ye D.Q. (2018) Potential link between m(6)A modification and systemic lupus erythematosus. Mol. Immunol. 93, 55–63 10.1016/j.molimm.2017.11.009 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The author agree on sharing the present study’s data and its deposit in public repositories. See microarray data in https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE205471


Articles from Bioscience Reports are provided here courtesy of Portland Press Ltd

RESOURCES