Skip to main content
PMC home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2022 Nov 10;88(23):e01222-22. doi: 10.1128/aem.01222-22

Nitric Oxide Signaling for Aerial Mycelium Formation in Streptomyces coelicolor A3(2) M145

Sota Honma a, Shinsaku Ito a, Shunsuke Yajima a, Yasuyuki Sasaki a,✉
Editor: Ning-Yi Zhoub
PMCID: PMC9746327  PMID: 36354316

ABSTRACT

Nitric oxide (NO) is a well-known signaling molecule in various organisms. Streptomyces undergoes complex morphological differentiation, similar to that of fungi. A recent study revealed a nitrogen oxide metabolic cycle that forms NO in Streptomyces coelicolor A3(2) M145. Further, endogenously produced NO serves as a signaling molecule. Here, we report that endogenously produced NO regulates cyclic 3′,5′-diguanylate (c-di-GMP) levels and controls aerial mycelium formation through the c-di-GMP-binding transcriptional regulator BldD in S. coelicolor A3(2) M145. These observations provide important insights into the mechanisms regulating morphological differentiation. This is the first study to demonstrate a link between NO and c-di-GMP in S. coelicolor A3(2) M145. Morphological differentiation is closely linked to the initiation of secondary metabolism in actinomycetes. Thus, the NO signaling-based regulation of aerial mycelium formation has potential applications in the fermentation industry employing useful actinomycetes.

IMPORTANCE Eukaryotic and prokaryotic cells utilize nitric oxide (NO) to regulate physiological functions. Besides its role as a producer of different bioactive substances, Streptomyces is suggested to be involved in mycelial development regulated by endogenously produced NO. However, the regulatory mechanisms are unclear. In this study, we proposed that NO signaling is involved in aerial mycelium formation in S. coelicolor A3(2) M145. NO serves as a signaling molecule for the regulation of intracellular cyclic 3′,5′-diguanylate (c-di-GMP) levels, resulting in aerial mycelium formation controlled by a c-di-GMP receptor, BldD. As the abundant production of valuable secondary metabolites is closely related to the initiation of morphological differentiation in Streptomyces, NO may provide value for application in industrial fermentation by serving as a tool for regulating secondary metabolism.

KEYWORDS: nitric oxide, signal transduction, morphological differentiation, actinomycete, actinomycetes

INTRODUCTION

Streptomyces, a prolific producer of secondary metabolites, is a genus of Gram-positive bacteria belonging to the phylum Actinobacteria. The life cycle of these bacteria is associated with complex morphological differentiation, similar to that of fungi (1). After germination, these bacteria grow as branching hyphae that form vegetative mycelia. During the late vegetative phase, reproductive growth is initiated and a hydrophobic aerial mycelium is produced. The aerial mycelium undergoes several steps leading to the formation of spores at the hyphal tips. Morphological differentiation starts almost simultaneously with the production of secondary metabolites in actinomycetes (1, 2). Understanding the regulatory mechanisms of morphological differentiation is imperative to efficiently improve the industrial production of secondary metabolites, such as antibiotics (3), antiparasitic agents (4), anticancer agents (5), and immunosuppressants (6).

Most characterized bld genes, such as bldA, bldB, bldC, bldD, bldF, bldG, bldH, bldI, bldJ, and bldM, encode essential transcriptional regulators for aerial mycelium formation, which regulate the expression of key genes associated with development (7). The complex extracellular signaling cascade has been suggested to regulate the aerial mycelium formation by these bld genes. BldD is a repressor of bldM expression in Streptomyces species (8, 9). Recent studies have revealed that BldD is a receptor for the well-known second messenger cyclic 3′,5′-diguanylate (c-di-GMP) in Streptomyces and its DNA-binding activity is controlled in an intracellular c-di-GMP level-dependent manner (8, 9). This property allows BldD to induce vegetative growth and mycelium formation at high and low levels of c-di-GMP levels, respectively (8). BldM is an atypical response regulator that is not phosphorylated in vitro or in vivo, regulating the expression of several genes involved in morphological differentiation (10).

Nitric oxide (NO) is an unstable free-radical molecule that is highly lipophilic and easily oxidized into nitrite (NO2−) or even nitrate (NO3−) (11). NO-mediated signaling mechanisms are well known among various organisms, including mammals, plants, and bacteria (11–13). For example, mammals utilize NO generated by nitric oxide synthase (NOS) to modulate vasodilation and inhibit platelet aggregation. This gas also regulates the metabolism of vitamin B6 and amino acids in plants (11, 12, 14). In bacterial cells, NO regulates many biological processes, such as symbiosis, biofilm formation, and quorum sensing, via heme-containing proteins (15–17).

Other studies suggest that the NOS-independent metabolic cycle of NO is generated by nitric oxide dioxygenase, flavohemoglobin (Fhb), and membrane-bound nitrate reductase (Nar) in Streptomyces coelicolor A3(2) M145 (18). Endogenous NO production is strictly controlled through Nar expression via the DevS/R two-component system (DevS/R-TCS) containing NO-susceptible heme (18). A recent study found that endogenously produced NO regulates antibiotic production via the DevS/R-TCS (19). Thus, the NO produced via this cycle may serve as an important signaling molecule for metabolic regulation in S. coelicolor A3(2). The deletion of narG, G2, and G3 (Δnar) lacking NO production ability results in the development of a precocious aerial mycelium, and the phenotype of the Δnar strain is complemented by the application of NO2− as the NO generator (18). However, the regulatory mechanism of aerial mycelium formation by nitrogen oxides has not been elucidated.

Here, we suggest that endogenous NO regulates aerial mycelium formation via the transcriptional activity of BldD in S. coelicolor A3(2) M145. NO modulated the intracellular levels of c-di-GMP, resulting in enhanced BldD DNA-binding activity, and then suppressed the expression of bldM. To our knowledge, this is the first report of an NO-mediated regulatory mechanism for morphological differentiation in Streptomyces.

RESULTS

NO is repressed during aerial mycelium formation in S. coelicolor A3(2) M145.

In our previous study, the Δnar strain, with decreased NO production ability, exhibited a precocious aerial mycelium formation compared to that of the wild-type strain, as shown in Fig. 1A. In addition, little difference was found between the M145 and Δnar strains in wet weights and colony sizes (Fig. 1B and C). These results suggested that NO negatively regulates aerial mycelium formation in S. coelicolor A3(2) M145. To investigate the effect of NO on aerial mycelium formation, the Δnar strains were cultured on two different NO generator-enriched solid media containing NO2− or NOC18. After cultivation for 168 h on yeast extract-malt extract (YEME)-glutamine (gln) solid medium containing 100 μM NO2− and 10 μM NOC18, M145 showed little change in aerial mycelium formation (Fig. 1D). However, the presence of NO generators in the growth medium of the Δnar strain abolished precocious development of aerial mycelia (Fig. 1D). These results suggest that NO controls aerial mycelial development in S. coelicolor A3(2) M145.

FIG 1.

FIG 1

Open in a new tab

The Δnar strain of S. coelicolor A3(2) M145 exhibits precocious aerial mycelium development. (A) Culture of S. coelicolor M145 and derived Δnar mutant on YEME-gln solid medium cultured for the indicated time at 30°C. Scale bars, 5 mm. (B) Culture of S. coelicolor M145 and derived Δnar mutant on YEME-gln solid medium cultured for the indicated time at 30°C. Solid line, M145 strain; dashed line, Δnar strain. Mean values and standard deviations from three independent experiments are shown (Student’s t test). (C) Culture of S. coelicolor M145 and derived Δnar mutant on YEME-gln solid medium cultured for the indicated time at 30°C. Solid line, M145 strain; dashed line, Δnar strain. Mean values and standard deviations from three independent experiments are shown (Student’s t test). (D) Culture of S. coelicolor M145 and derived Δnar mutant on YEME-gln solid medium containing 100 μM NO2− or 10 μM NOC18 cultured for 168 h at 30°C.

NO regulates the expression of the bldM gene in S. coelicolor A3(2) M145.

We investigated the time-dependent expression levels of bld genes, which are essential for aerial mycelium formation in Streptomyces. Although the Δnar strain exhibited an increase in the expression levels of bldG at 96 and 120 h compared to the M145 strain, the expression levels at other time points showed little difference, similar to those of bldB (Fig. 2A). In contrast, the Δnar strain showed a significant increase in the transcript levels of bldM at most time points in culture compared to the M145 strain (Fig. 2A). This result suggested that NO plays a major negative role in the expression of bldM. To verify the effect of NO on the expression of bldM, the Δnar strain was cultured on a solid medium containing two NO generators, NO2− and NOC18, and the expression levels of bldM were examined. Both NO donors decreased bldM transcript levels (Fig. 2B). Moreover, a quadruple deletion mutant involving the narG, G2, G3, and bldM genes (Δnar ΔbldM) resulted in the abolition of precocious aerial mycelium formation of the Δnar strain (Fig. 2C). We prepared the M145 strain harboring a bldM overexpression vector (OEbldM) (Fig. 2D) and investigated the effect of bldM expression on phenotypes. After 168 h of culture on a YEME-gln solid medium containing thiostrepton as an inducer, the M145 strain containing pIJ8600 (EV) did not develop aerial mycelia, whereas the OEbldM strain did (Fig. 2E). This demonstrated that bldM expression critically affects aerial mycelium formation under these conditions. The bldM-overexpressing strain formed aerial mycelium independent of the presence of NO generators that negated precocious aerial mycelium formation in the Δnar strain, as shown in Fig. 1B and 2E. These results suggested that the expression of bldM was repressed by high intracellular NO levels. NO levels should be decreased to allow aerial mycelium formation in S. coelicolor A3(2) M145. BldM is an atypical response regulator that is not phosphorylated in vitro or in vivo (10). In addition, no gene encoding histidine kinase was found in the vicinity of bldM. These findings suggested that aerial mycelium formation is promoted by the expression level of BldM, consistent with the results shown in Fig. 2.

FIG 2.

FIG 2

Open in a new tab

Nitric oxide regulates bldM gene transcriptions in S. coelicolor A3(2) M145. (A) Determination of the expression levels of the bldB, bldG, and bldM genes by RT-qPCR in M145 (black bars) and Δnar (white bars) strains cultured for the indicated times. Mean values and standard deviations from three independent experiments are shown (six independent experiments for the bldM gene only). ***, P < 0.001; **, P < 0.01; *, P < 0.05 (Student’s t test). (B) Determination of the expression levels of bldM gene by RT-qPCR in the Δnar strain cultured for 120 h at 30°C in YEME-gln solid medium containing 100 μM NO2− or 10 μM NOC18. Mean values and standard deviations from three independent experiments are shown. *, P < 0.05 (Dunnett’s test). (C) Culture of S. coelicolor M145 and derived ΔbldM, Δnar, and Δnar ΔbldM strains cultured for the indicated times at 30°C in YEME-gln solid medium. Scale bars, 2 mm. (D) Determination of the expression level of bldM by RT-qPCR in EV and OEbldM strains cultured for 48 h at 30°C in YEME-gln solid medium containing 3 μM thiostrepton. cDNA from each strain was subjected to qPCR to verify the expression level of the bldM gene. Mean values and standard deviations from three independent experiments are shown. *, P < 0.05 (Student’s t test). (E) Culture of EV and OEbldM strains cultured for 168 h at 30°C in YEME-gln solid medium containing 100 μM NO2− or 10 μM NOC18. Thiostrepton (3 μM) was used as an inducer for the overexpression of bldM. Scale bars, 5 mm.

NO regulates the DNA-binding activity of BldD in S. coelicolor A3(2) M145.

The BldD homolog SVEN_1089 binds c-di-GMP via Arg114, Asp116, Arg125, and Asp128 in Streptomyces venezuelae (8), resulting in dimer formation and enhanced transcriptional activity (8). Arg114, Asp116, Arg125, and Asp128 were confirmed in BldD of S. coelicolor using ClustalW sequence alignments, suggesting that BldD exhibits c-di-GMP-binding activity (Fig. 3A). To investigate the effects of c-di-GMP on BldD-binding ability, we performed an electrophoretic mobility shift assay (EMSA) using recombinant BldD and a Cy5-labeled upstream region of bldM (Cy5bldMp). BldD delayed mobility of the Cy5bldMp fragments, and greater retardation of the BldD-Cy5bldMp complex bands was observed in the presence of c-di-GMP (Fig. 3B). This result suggested that BldD binds to c-di-GMP, forms a dimer in S. coelicolor A3(2) M145, as in SVEN_1089, and regulates its transcriptional activity (8, 20, 21).

FIG 3.

FIG 3

Open in a new tab

BldD binds c-di-GMP in S. coelicolor A3(2) M145. (A) Alignment of the amino acid sequence of BldD with SVEN_1089 in S. venezuelae using ClustalW. The putative c-di-GMP binding sites are highlighted by red letters. (B) BldD binds the promoter region of the bldM gene in vitro. EMSA was performed using DNA fragments harboring the predicted binding site upstream of the bldM gene. In this experiment, 0.73 nmol of BldD was used. To perform the competition assay, a 200-fold amount of unlabeled probe was used as competitor DNA, and a 200-fold amount of the unlabeled oligonucleotide was used as nonspecific DNA.

Since bldM expression is known to be under the negative control of BldD (22), NO-dependent bldM expression (Fig. 2) suggested that NO might affect bldD expression or its DNA binding. We compared the levels of time-dependent expression of bldD in the M145 and Δnar strains and found that they were similar in the two strains except at 48 h (Fig. 4A). NO had little effect on the expression of bldD (Fig. 4B). Therefore, we investigated the effect of NO on the binding ability of BldD in vivo. To this end, DNA fragments interacting with 3×FLAG-tagged BldD in M145 and Δnar strains expressing the 3×FLAG-tagged BldD protein were extracted using chromatin immunoprecipitation (ChIP), and these fragments were used to investigate the expression levels of the promoter region of bldM (bldMp) by quantitative real-time PCR (RT-qPCR) in these strains. Since both the M145 and Δnar strains exhibited higher expression levels of bldM after 120 h of culture, we confirmed the interaction between BldD and bldMp at that time point and demonstrated a reduced interaction of 3×FLAG-tagged BldD with bldMp in the Δnar bldD-FLAG strain compared to that in the M145/bldD-FLAG strain (Fig. 4C). However, the presence of two NO generators, NO2− and NOC18, enhanced this interaction between 3×FLAG-tagged BldD and bldMp in the Δnar bldD-FLAG strain (Fig. 4D). This indicated that NO regulates interactions between BldD and bldMp. This also indirectly suggested a link between NO and c-di-GMP since c-di-GMP is known to be an allosteric activator of BldD (4).

FIG 4.

FIG 4

Open in a new tab

Nitric oxide regulates the DNA-binding activity of BldD in S. coelicolor A3(2) M145. (A) Determination of the expression levels of the bldD gene, by RT-qPCR, in S. coelicolor A3(2) M145 (black bars) and Δnar mutant (white bars) strains cultured for the indicated times. Mean values and standard deviations from three independent experiments are shown. ***, P < 0.001; *, P < 0.05 (Student’s t test). (B) Determination of the expression levels of bldD by RT-qPCR in the Δnar mutant strain cultured for 48 h at 30°C on YEME-gln solid medium (white bars) or the same medium containing 100 μM NO2− or 10 μM NOC18 (gray bars). Mean values and standard deviations from three independent experiments are shown. ns, not significant (Dunnett’s test). (C) Determination of the expression levels of bldMp by RT-qPCR in S. coelicolor A3(2) M145 (black bars) and Δnar mutant (white bars) expressing 3×FLAG-tagged BldD protein and cultured for 120 h at 30°C on YEME-gln solid medium. DNA fragments interacting with 3×FLAG-tagged BldD in M145 and Δnar strains expressing 3×FLAG-tagged BldD protein were purified using chromatin immunoprecipitation (ChIP). M145 (dotted bar) and Δnar mutant (striped bar) strains were used as negative controls. Mean values and standard deviations from five independent experiments are shown. **, P < 0.01 (Student’s t test). (D) Determination of the expression levels of bldMp by RT-qPCR in the Δnar mutant expressing the 3×FLAG-tagged BldD protein and cultured for 120 h at 30°C on YEME-gln solid medium (striped white bar) or the same medium containing 100 μM NO2− or 10 μM NOC18 (striped gray bars) using DNA fragments interacting with 3×FLAG-tagged BldD purified by ChIP. The Δnar strain (white bar) was used as a negative control. Mean values and standard deviations from three independent experiments are shown. *, P < 0.05 (Student’s t test).

NO affects the intracellular c-di-GMP levels in S. coelicolor A3(2) M145.

To investigate the effect of NO on intracellular c-di-GMP levels, we compared the levels between the M145 and Δnar mutant strains. Our study revealed lower c-di-GMP levels in the Δnar strain at different time points throughout cell culture than in the M145 strain (Fig. 5A). Interestingly, the two NO generators, NO2− and NOC18, increased the intracellular c-di-GMP levels in the Δnar strain (Fig. 5B). These results suggested that endogenously produced NO regulates intracellular c-di-GMP levels in S. coelicolor A3(2) M145 cells. In Streptomyces, diguanylate acid cyclase (DGC) is known to generate c-di-GMP from GTP, whereas phosphodiesterase (PDE) decomposes c-di-GMP into the linear dinucleotide pGpG (23, 24). Therefore, we investigated the expression levels of the genes encoding the DGC89, SCO4281 (CdgB), and the c-di-GMP PDEs SCO0928 (RmdA) and SCO5495 (RmdB) in S. coelicolor A3(2) M145. However, the expression levels of these genes were not significantly different between the M145 and Δnar strains during culture (data not shown). Since these findings further suggested that CdgB, RmdA, and RmdB play a critical role in c-di-GMP production and degradation of S. coelicolor A3(2) M145 (23, 24), the endogenously produced NO may be involved in the enzymatic activity of DGCs and PDEs.

FIG 5.

FIG 5

Open in a new tab

Nitric oxide regulates intracellular levels of cyclic di-GMP in S. coelicolor A3(2) M145. (A) Quantification of c-di-GMP levels using a cyclic di-GMP ELISA kit from Cayman Chemical in crude extracts of S. coelicolor A3(2) M145 (black bars) and Δnar mutant (white bars) strains cultured for the indicated times. Mean values and standard deviations from three independent experiments are shown. ***, P < 0.001; **, P < 0.01; *, P < 0.05 (Student’s t test). (B) Quantification of c-di-GMP levels in crude extracts of the Δnar strain cultured in the absence (white bar) or presence (gray bars) of 100 μM NO2− or 10 μM NOC18. Mean values and standard deviations from three independent experiments are shown. *, P < 0.05 (Dunnett’s test).

DISCUSSION

Although previous studies have suggested that identified signaling molecules, such as bacterial hormones and c-di-GMP, regulate complex morphological differentiation in Streptomyces (23, 25, 26), the regulatory mechanisms involved remain unclear. A recent study found that endogenously produced NO regulates antibiotic production (19), suggesting that NO serves as a novel signaling molecule in Streptomyces. This study proposes that intracellular NO regulates aerial mycelium formation by regulation of c-di-GMP levels in S. coelicolor A3(2) M145 (Fig. 6). To the best of our knowledge, this is the first study to link endogenous NO and morphological differentiation in S. coelicolor A3(2) M145.

FIG 6.

FIG 6

Open in a new tab

Proposed model of aerial mycelium formation mechanism by NO signaling in Streptomyces coelicolor A3(2) M145. Endogenously produced NO is involved in the regulation of c-di-GMP production. BldD directly regulates the expression of the bldM gene in an intracellular c-di-GMP level-dependent manner, similar to SVEN_1089 (BldD homolog) of Streptomyces venezuelae.

Furthermore, we revealed that NO downregulates the expression of bldM (Fig. 2B), a gene known to positively affect aerial mycelium formation (10), via a BldD-dependent regulatory process. Such regulatory processes might also involve WhiB-like (Wbl) proteins in addition to BldD. Indeed, Wbl proteins bearing the [4Fe-4S] cluster containing four invariant cysteine residues play a critical role in the regulation of morphological differentiation in actinomycetes (27). These proteins are possibly activated due to the oxidation of [4Fe-4S] clusters by O2 and NO (27). Wbls reportedly regulate morphological differentiation based on NO signaling in Streptomyces (27); it remains unclear whether NO binds to the iron-sulfur clusters of Wbls and regulates their activity in vivo. Further research surrounding the mechanisms underlying the regulatory effect of NO on the Bld cascade and Wbl proteins may provide novel insights into actinobacterial development.

S. coelicolor A3(2) M145 strictly regulates intracellular NO levels through both a NO-sensitive TCS, DevS/R, and a NO-sensing transcriptional regulator, NsrR (18, 28). These systems are important for NO signaling in S. coelicolor A3(2) M145. Thus, further studies on the link between NO homeostasis systems and NO signaling for aerial mycelium formation are required.

Our study suggested that NO upregulates intracellular c-di-GMP levels, resulting in enhanced binding activity of BldD based on dimerization on interaction with c-di-GMP (Fig. 3 and 4). A previous study demonstrated that both c-di-GMP PDE and DGC activities are regulated by a response regulator, which is activated by autophosphorylated cognate sensor kinase through NO sensor protein (16). In addition, both the c-di-GMP PDE and DGC activities are reported to be directly regulated by NO-bound H-NOX (16, 29). Interestingly, heme-containing c-di-GMP PDE and DGC readily bind to gases such as O2, CO, and NO through heme, and then the activities of these enzymes are altered (17, 30, 31). These results suggest that NO directly regulates the c-di-GMP PDE and DGC activities. Since the c-di-GMP PDE and DGC of Streptomyces also interact with heme through the PAS9 domain (24, 32), NO may directly regulate c-di-GMP PDE and DGC activities.

Our recent study revealed that intracellular NO levels increase in a time-dependent manner until midculture and then decrease in S. coelicolor A3(2) M145 culture (19). Decreasing NO levels might trigger the initiation of aerial mycelium formation in this strain. Thus, NO can be considered a signaling molecule. Since morphological differentiation and antibiotic production are intimately linked in Streptomyces (22), manipulating NO levels might constitute a valuable tool to enhance antibiotic production.

Although a link between NO and c-di-GMP signaling in bacterial cells has been reported for various bacteria (33–36), the study of NO-c-di-GMP signaling pathways in actinomycetes is still in its infancy. Our findings suggested that NO signaling is involved in intracellular c-di-GMP-dependent development in Streptomyces. These findings expand our understanding of NO-controlled processes in Streptomyces and suggest that further research concerning NO signaling will benefit antibiotic production.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions.

In this study, the experiments were performed as previously described (19). The strains used in the present study are listed in Table 1. The strains were cultured at 30°C in mannitol-soya flour-agar (MS solid medium: 2% agar, 2% mannitol, and 2% soya flour), which was used for spore maturation. YEME-gln solid medium (1% glucose, 2% agar, 0.3% malt extract, 0.5% Bacto peptone, 0.3% yeast extract, and 50 mM l-glutamine; pH 7.2) was used to grow vegetative cells. NO easily diffuses and affects the strains incubated in the same incubator. To avoid this effect, all nar deletion mutants and strains cultured on the NO generator enrichment medium were incubated in different incubators. The temperature in each incubator was measured using a thermometer. Escherichia coli DH5α (TaKaRa, Shiga, Japan) was used as a host for routine cloning. The media, culture conditions, and DNA manipulations for E. coli and Streptomyces culture employed were as described by Kieser et al. and Green and Sambrook (37, 38). Gene disruption experiments were performed according to the REDIRECT PCR-targeting method (39). Plasmids and cosmids were demethylated using E. coli HST04 Δdam Δdcm (TaKaRa). The primers used in this study are listed in Table 2. Cosmids and plasmids were kindly provided by H. Takano (Nihon University, Japan).

TABLE 1.

S. coelicolor A3(2) strains used in this study

Strain Genotype or characteristic Reference
M145 (wild type) SCP1− SCP2− 20
Δnar mutant M145 SCO6535::hyg SCO0216::scar SCO4947::scar (removing narGG2G3) 20
Δnar ΔbldM mutant M145 SCO6535::hyg SCO0216::scar SCO4947::scar SCO1587::aac(3)IV (removing narGG2G3/bldM) This study
ΔbldM mutant M145 SCO1587::aac(3)IV (removing bldM) This study
EV M145 pIJ8600 This study
OEbldM M145 pIJSCO1587 (overexpressing bldM) This study
M145/bldD-FLAG M145 pKU460-SCO1489-FLAG (complementing bldD-FLAG) This study
Δnar bldD-FLAG M145 SCO6535::hyg SCO0216::scar SCO4947::scar pKUSCO1489-FLAG (complementing bldD-FLAG) This study
Open in a new tab

TABLE 2.

Synthetic oligonucleotides used in this study

Primer name Sequence (5′→3′) Purpose
hrdB F GCATGCTCTTCCTGGACCTCAT qPCR
hrdB R TGGAGAACTTGTAGCCCTTGGTGTA qPCR
bldB F AGCGGGTGGAGATCGCCTAT qPCR
bldB R GCGCACCCAGGACGAAAG qPCR
bldG F GACATGGAGGGCGTGGACTT qPCR
bldG R TGAGAATGCGCTCCTGGTTG qPCR
bldM F ACTCCCCGCTTGCCCGAGA qPCR
bldM R CCCAGCGGCGGACTTC qPCR
bldD F CTCCACGGTGTCGAGGAGAAG qPCR
bldD R CCGTAGAAGTCCGCCAGCTC qPCR
bldMp F GACGACACACAGCCCCGTAA qPCR
bldMp R AGCCTCCAGGCTGGTACGAA qPCR
rmdA F GACTTCGGCACCGGCTACTC qPCR
rmdA R GGGAACTGCTGCATGCTCTG qPCR
rmdB F TCCAAGCGGGACTCCAACA qPCR
rmdB R CGGACCTTGGGCTGGTAGTG qPCR
cdgB F TGGGGCGACCTGATCTTCAT qPCR
cdgB R TGCCACTCGTCCTCGAAGC qPCR
Cy5bldMp F GCACCGCGTTCGCCTTCCGGAT EMSA
Cy5bldMp R GGCCGTCCTCCGCAGCAGCTCTTGC EMSA
exp bldD F CATATGTCCAGCGAATACGCCAAACA Overexpression
exp bldD R GAATTCTCAGAGCTCGTCGTGG Overexpression
exp bldM F CATATGACTTCCGTCCTCGTCTGCGAC Overexpression
exp bldM R GGATCCCTAGCGGACCAGGCCCCACCG Overexpression
comp bldD-FLAG F AAGCTTACGAAACGGACCCCCTTCTCCGCCTCACGGGACGGACCTTAA Complementation
comp bldD-FLAG R GAATTCTCACTACTTGTCATCGTCATCCTTGTAATCGATGTCATGATCTTTGTAGTCGAGCTCGTCGTGGGACGCCACCGCGCG Complementation
ΔbldM F GCTCAACGTGACGCGCAAGAGCTGCGGAGGACGGCCATGATTCCGGGGATCCGTCGACC Disruption
ΔbldM R ACGGGCCCTTTCGGACTCCCTCGCACGGGGGCGCTCCTATGTAGGCTGGAGCTGCTTC Disruption
Open in a new tab

Construction of the mutants and complementation.

This experiment was performed similarly to our previous study (19). Briefly, the open reading frames in the chromosomes were replaced with drug resistance cassettes using REDIRECT PCR. Each drug resistance cassette flanked by the flippase recognition target (FRT) regions was amplified by PCR using Gflex DNA polymerase (TaKaRa). The primer sets used are listed in Table 2. To obtain a target gene disruption mutant cosmid using the λRed system, amplified cassettes were introduced into E. coli BW25113/pIJ790 harboring a cosmid containing the target gene (Table 2). The resulting construct was confirmed by PCR and a nonmethylating cosmid was obtained using E. coli HST04 Δdam Δdcm (TaKaRa). Each mutant cosmid was introduced into S. coelicolor A3(2) M145 or its derivatives via protoplast transformation. Drug-resistant recombinants were screened and recombination success was confirmed by PCR using appropriate primer sets and complementation testing. The inducible expression plasmid pIJbldM was used in this study (40). The integration plasmid pKUbldD-FLAG, used for ChIP-qPCR, was prepared in this study (41).

Biomass assay.

Spores were inoculated onto YEME-gln solid medium at an interval of 2 cm (a total of nine spots) with a toothpick. After culturing at 30°C, all cells were collected, and wet weights were determined using an electronic balance. Colony sizes were measured as the diameter of the central colony using a caliper.

Isolation of total RNA and RT-qPCR.

Total RNA isolation and quantitative real-time PCR (RT-qPCR) were performed according to the protocol described by Honma et al. (19). Total RNA was isolated from each strain using the ReliaPrep RNA cell miniprep system (Promega, Madison, WI, USA). cDNA was generated using ReverTra Ace RT-qPCR master mix with genomic DNA (gDNA) remover (TOYOBO, Osaka, Japan) and used for RT-qPCR. The primers used in the present study for RT-qPCR are listed in Table 2. RT-qPCR was performed using a thermal cycler Dice real-time system (TaKaRa, Shiga, Japan). The PCR mixture (total, 20 μL) contained 0.1 μg of generated cDNA, 10 pmol of an appropriate primer set (Table 2), and SYBR KOD (TOYOBO, Osaka, Japan). Data were then normalized to the expression levels of hrdB, a housekeeping gene encoding the sigma factor (42).

Overexpression and purification of recombinant proteins in E. coli.

Recombinant proteins were overexpressed and purified as described previously (19). Briefly, the region of the bldD gene was amplified from the genomic DNA of S. coelicolor A3(2) M145 with Gflex DNA polymerase (TaKaRa) using the primer sets listed in Table 2. DNA fragments were digested with NdeI (TaKaRa) and EcoRI (TaKaRa) and cloned into the corresponding sites of pET28b. The plasmids obtained were then transformed into E. coli Rosetta 2 (DE3) cells to overexpress BldD proteins with a His6-tagged N terminus. The resulting transformants were cultivated in a lysogeny broth medium supplemented with 50 μg/mL of kanamycin at 37°C until an optical density (at 600 nm) of 0.6 was achieved. To induce the expression of BldD proteins, isopropyl β-d-thiogalactopyranoside (IPTG) was added at a final concentration of 1 mM, and the transgenic organisms were cultivated for 20 h at 16°C. The harvested cells were collected by centrifugation at 8,000 × g for 5 min. The collected cells were resuspended in Tris buffer (20 mM Tris-HCl [pH 8.0], 10% glycerol, 20 mM imidazole, and 300 mM NaCl) and disrupted by sonication on ice. The soluble fraction containing His6-tagged BldD was obtained by centrifugation at 78,000 × g for 45 min, and His6-tagged BldD was purified on a nickel-nitrilotriacetic acid (Ni-NTA) agarose column (Qiagen, Hilden, Germany).

EMSA.

The electrophoretic mobility shift assay (EMSA) was performed according to the protocol described by Sumi et al. (43). DNA fragments containing the promoter region (500 bp) of the bldM gene were amplified with TaKaRa Taq (TaKaRa); the primer sets used are listed in Table 2. The resulting PCR amplicons were cloned into the pMD19 T vector. To prepare probes labeled with Cy5 at the 5′ end, the cloned DNA fragments were amplified by PCR with Gflex using the primer sets listed in Table 2. Thirty nanograms of the Cy5-labeled probe was mixed with 0 to 0.73 nmol of recombinant BldD and then incubated for 1 h at 30°C in a reaction buffer (10 mM Tris-HCl [pH 7.2], 1 mM EDTA, 50 mM NaCl, and 10% glycerol) containing 1 mM dithiothreitol. Specific DNA-protein complexes were separated from the free probes by electrophoresis on a native 6% polyacrylamide gel. To perform the competition assay in EMSA, 200-fold amounts each of unlabeled oligonucleotides and unlabeled probes were used as nonspecific DNA and competitor DNA, respectively. Cy5 fluorescence was visualized by using an ATTO illuminator.

Chromatin immunoprecipitation and qPCR.

ChIP-qPCR was performed according to the protocols described previously by us (19). After cell collection in a 1.5-mL tube, cross-linking of DNA-protein was performed with formaldehyde at a final concentration of 1% for 15 min at 25°C with occasional shaking. The cross-linking reaction was stopped by adding glycine at a final concentration of 125 mM at 25°C for 5 min. After termination of cross-linking, the cells were rinsed thrice with 1 mL of cold TBS buffer (20 mM Tris-HCl [pH 7.4] and 150 mM NaCl). The rinsed cells were lysed with a Multi-beads Shocker (Yasui Kikai, Osaka, Japan), followed by the addition of 200 μL of lysis buffer (50 mM HEPES-KOH [pH 7.5], 40 mM NaCl, 1 mM EDTA, 1% Triton X-100, and 0.1% sodium deoxycholate) at 4°C. The protein concentration in the cell homogenate was determined using a Pierce bicinchoninic acid (BCA) protein assay kit (Thermo, Waltham, MA, USA). The concentration of each protein was adjusted to 0.2 or 0.4 mg/mL for 500 μL of cold lysis buffer. Twenty microliters of protein G Sepharose Fast Flow (GE Healthcare, Chicago, IL, USA) equilibrated with cold lysis buffer was added to the solution to remove any nonspecific binding of DNA to the resin. The mixture was then rotated at 4°C for 1 h. After the beads were removed by centrifugation at 15,000 × g for 1 min at 4°C, 5 μg of anti-FLAG antibody (Sigma-Aldrich, St. Louis, MO, USA) was added to the lysate and rotated at 4°C for 16 h. After the antigen-antibody reaction, 20 μL of equilibrated beads was added to the solution, and the reaction mixture was rotated at 4°C for 1 h. Then, the supernatant was removed by centrifugation at 15,000 × g for 1 min, and the beads were rinsed with 1 mL of lysis buffer by rotation at 25°C for 5 min. The washing steps were sequentially repeated using wash 1 buffer (lysis buffer containing 500 mM NaCl), wash 2 buffer (10 mM Tris-HCl [pH 8.0], 1 mM EDTA, 250 mM lithium chloride, 0.5% sodium deoxycholate, and 0.5% NP-40), and Tris-EDTA (TE) buffer (10 mM Tris-HCl [pH 8.0] and 1 mM EDTA). After washing, the beads were incubated with 100 μL of TE buffer containing 20 μg of RNase A (Nacalai Tesque, Kyoto, Japan) at 37°C for 30 min. The incubated beads were rinsed with TE buffer and the buffer was removed by centrifugation at 15,000 × g for 1 min. The cross-linked complex was eluted with 250 μL of elution buffer (1% SDS and 0.1 M sodium bicarbonate) at 25°C for 15 min with occasional tapping, and the supernatant was collected by centrifugation at 15,000 × g for 1 min. This step was repeated and the supernatant was collected. Thereafter, 20 μL of 5 M NaCl was added to the eluted samples, and the mixture was incubated at 65°C for 5 h. One-tenth of the total cell extract was back-extracted to obtain the input DNA quantity. After ethanol precipitation and washing with cold 70% ethanol, the pellet was dissolved in 100 μL of TE buffer and then in 100 μL of 2× proteinase K buffer (20 mM Tris-HCl, 1% SDS, and 10 mM EDTA), containing 20 μg of proteinase K, at 50°C for 30 min. The mixture was then extracted twice with phenol-chloroform-isoamyl alcohol. qPCR was performed on a thermal cycler Dice real-time system (TaKaRa) and reacted with Thunderbird SYBR qPCR mix (Toyobo). For quantification, a standard curve was prepared using S. coelicolor genomic DNA diluted several times (1 to 1 × 10−5). The recovery of each immunoprecipitated DNA relative to the input DNA was calculated.

Quantitative determination of c-di-GMP.

Bacterial cells were grown on YEME-gln solid medium and pelleted by centrifugation at 13,000 × g for 5 min. The supernatant was removed and the cell pellet was resuspended in 500 μL of acetonitrile– methanol–Milli-Q water (40:20:20). The cells were lysed using a Bioruptor (COSMO BIO, Tokyo, Japan) for 15 min (30 s on, 30 s off), and the supernatant was collected by centrifugation at 13,000 × g for 5 min. The supernatant was removed using a vacuum concentrator for 1.5 h, and the pellet was dissolved in 200 μL of Milli-Q water. A cyclic di-GMP enzyme-linked immunosorbent assay (ELISA) kit (Cayman Chemical, Ann Arbor, MI, USA) was used to determine c-di-GMP levels.

ACKNOWLEDGMENTS

This work was supported, in part, by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (JSPS) to Y.S. (C; grant number 20K05811) and by grants from the Japan Science and Technology Agency (JST) Support for Pioneering Research Initiated by the Next Generation to S.H. (Tokyo University of Agriculture, grant number JPMJSP2122) and from the Research Project of the Tokyo University of Agriculture to Y.S.

Contributor Information

Yasuyuki Sasaki, Email: y1sasaki@nodai.ac.jp.

Ning-Yi Zhou, Shanghai Jiao Tong University.

REFERENCES

  • 1.Jakimowicz D, van Wezel GP. 2012. Cell division and DNA segregation in Streptomyces: how to build a septum in the middle of nowhere? Mol Microbiol 85:393–404. 10.1111/j.1365-2958.2012.08107.x. [DOI] [PubMed] [Google Scholar]
  • 2.van Wezel GP, van der Meulen J, Kawamoto S, Luiten RG, Koerten HK, Kraal B. 2000. ssgA is essential for sporulation of Streptomyces coelicolor A3(2) and affects hyphal development by stimulating septum formation. J Bacteriol 182:5653–5662. 10.1128/JB.182.20.5653-5662.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Chen Y, Smanski MJ, Shen B. 2010. Improvement of secondary metabolite production in Streptomyces by manipulating pathway regulation. Appl Microbiol Biotechnol 86:19–25. 10.1007/s00253-009-2428-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ikeda H, Omura S. 1995. Control of avermectin biosynthesis in Streptomyces avermitilis for the selective production of a useful component. J Antibiot (Tokyo) 48:549–562. 10.7164/antibiotics.48.549. [DOI] [PubMed] [Google Scholar]
  • 5.Noomnual S, Thasana N, Sungkeeree P, Mongkolsuk S, Loprasert S. 2016. Streptanoate, a new anticancer butanoate from Streptomyces sp. DC3. J Antibiot (Tokyo) 69:124–127. 10.1038/ja.2015.95. [DOI] [PubMed] [Google Scholar]
  • 6.Kino T, Hatanaka H, Hashimoto M, Nishiyama M, Goto T, Okuhara M, Kohsaka M, Aoki H, Imanaka H. 1987. FK-506, a novel immunosuppressant isolated from a Streptomyces. I. Fermentation, isolation, and physico-chemical and biological characteristics. J Antibiot (Tokyo) 40:1249–1255. 10.7164/antibiotics.40.1249. [DOI] [PubMed] [Google Scholar]
  • 7.Flärdh K, Buttner MJ. 2009. Streptomyces morphogenetics: dissecting differentiation in a filamentous bacterium. Nat Rev Microbiol 7:36–49. 10.1038/nrmicro1968. [DOI] [PubMed] [Google Scholar]
  • 8.Tschowri N, Schumacher MA, Schlimpert S, Chinnam NB, Findlay KC, Brennan RG, Buttner MJ. 2014. Tetrameric c-di-GMP mediates effective transcription factor dimerization to control Streptomyces development. Cell 158:1136–1147. 10.1016/j.cell.2014.07.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Yan H, Lu X, Sun D, Zhuang S, Chen Q, Chen Z, Li J, Wen Y. 2020. BldD, a master developmental repressor, activates antibiotic production in two Streptomyces species. Mol Microbiol 113:123–142. 10.1111/mmi.14405. [DOI] [PubMed] [Google Scholar]
  • 10.Molle V, Buttner MJ. 2000. Different alleles of the response regulator gene bldM arrest Streptomyces coelicolor development at distinct stages. Mol Microbiol 36:1265–1278. 10.1046/j.1365-2958.2000.01977.x. [DOI] [PubMed] [Google Scholar]
  • 11.Rajendran S, Shen X, Glawe J, Kolluru GK, Kevil CG. 2019. Nitric oxide and hydrogen sulfide regulation of ischemic vascular growth and remodeling. Compr Physiol 9:1213–1247. 10.1002/cphy.c180026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gupta KJ, Kaladhar VC, Fitzpatrick TB, Fernie AR, Møller IM, Loake GJ. 2022. Nitric oxide regulation of plant metabolism. Mol Plant 15:228–242. 10.1016/j.molp.2021.12.012. [DOI] [PubMed] [Google Scholar]
  • 13.Choi G, Kim D, Im H, Choi SH. 2021. A nitric oxide-responsive transcriptional regulator NsrR cooperates with Lrp and CRP to tightly control the hmpA gene in Vibrio vulnificus. Front Microbiol 12:681196. 10.3389/fmicb.2021.681196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Willoughby SR, Stewart S, Holmes AS, Chirkov YY, Horowitz JD. 2005. Platelet nitric oxide responsiveness: a novel prognostic marker in acute coronary syndromes. Arterioscler Thromb Vasc Biol 25:2661–2666. 10.1161/01.ATV.0000193622.77294.57. [DOI] [PubMed] [Google Scholar]
  • 15.Heckler I, Boon EM. 2019. Insights into nitric oxide modulated quorum sensing pathways. Front Microbiol 10:2174. 10.3389/fmicb.2019.02174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Williams DE, Boon EM. 2019. Towards understanding the molecular basis of nitric oxide-regulated group behaviors in pathogenic bacteria. J Innate Immun 11:205–215. 10.1159/000494740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Nisbett LM, Boon EM. 2016. Nitric oxide regulation of H-NOX signaling pathways in bacteria. Biochemistry 55:4873–4884. 10.1021/acs.biochem.6b00754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Sasaki Y, Oguchi H, Kobayashi T, Kusama S, Sugiura R, Moriya K, Hirata T, Yukioka Y, Takaya N, Yajima S, Ito S, Okada K, Ohsawa K, Ikeda H, Takano H, Ueda K, Shoun H. 2016. Nitrogen oxide cycle regulates nitric oxide levels and bacterial cell signaling. Sci Rep 6:22038. 10.1038/srep22038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Honma S, Ito S, Yajima S, Sasaki Y. 2021. Nitric oxide signaling for actinorhodin production in Streptomyces coelicolor A3(2) via the DevS/R two-component system. Appl Environ Microbiol 87:e00480-21. 10.1128/AEM.00480-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Elliot MA, Locke TR, Galibois CM, Leskiw BK. 2003. BldD from Streptomyces coelicolor is a non-essential global regulator that binds its own promoter as a dimer. FEMS Microbiol Lett 225:35–40. 10.1016/S0378-1097(03)00474-9. [DOI] [PubMed] [Google Scholar]
  • 21.Tschowri N. 2016. Cyclic dinucleotide-controlled regulatory pathways in Streptomyces species. J Bacteriol 198:47–54. 10.1128/JB.00423-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.den Hengst CD, Tran NT, Bibb MJ, Chandra G, Leskiw BK, Buttner MJ. 2010. Genes essential for morphological development and antibiotic production in Streptomyces coelicolor are targets of BldD during vegetative growth. Mol Microbiol 78:361–379. 10.1111/j.1365-2958.2010.07338.x. [DOI] [PubMed] [Google Scholar]
  • 23.Tran NT, Den Hengst CD, Gomez-Escribano JP, Buttner MJ. 2011. Identification and characterization of CdgB, a diguanylate cyclase involved in developmental processes in Streptomyces coelicolor. J Bacteriol 193:3100–3108. 10.1128/JB.01460-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hull TD, Ryu MH, Sullivan MJ, Johnson RC, Klena NT, Geiger RM, Gomelsky M, Bennett JA. 2012. Cyclic di-GMP phosphodiesterases RmdA and RmdB are involved in regulating colony morphology and development in Streptomyces coelicolor. J Bacteriol 194:4642–4651. 10.1128/JB.00157-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Haist J, Neumann SA, Al-Bassam MM, Lindenberg S, Elliot MA, Tschowri N. 2020. Specialized and shared functions of diguanylate cyclases and phosphodiesterases in Streptomyces development. Mol Microbiol 114:808–822. 10.1111/mmi.14581. [DOI] [PubMed] [Google Scholar]
  • 26.Ohnishi Y, Yamazaki H, Kato JY, Tomono A, Horinouchi S. 2005. AdpA, a central transcriptional regulator in the A-factor regulatory cascade that leads to morphological development and secondary metabolism in Streptomyces griseus. Biosci Biotechnol Biochem 69:431–439. 10.1271/bbb.69.431. [DOI] [PubMed] [Google Scholar]
  • 27.Bush MJ. 2018. The actinobacterial WhiB-like (Wbl) family of transcription factors. Mol Microbiol 110:663–676. 10.1111/mmi.14117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Crack JC, Svistunenko DA, Munnoch J, Thomson AJ, Hutchings MI, Brun NE. 2016. Differentiated, prompter-specific response of [4Fe-4S] NsrR DNA binding to reaction with nitric oxide. J Biol Chem 291:8663–8672. 10.1074/jbc.M115.693192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Williams DE, Nisbett LM, Bacon B, Boon E. 2018. Bacterial heme-based sensors of nitric oxide. Antioxid Redox Signal 29:1872–1887. 10.1089/ars.2017.7235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Chang AL, Tuckerman JR, Gonzalez G, Mayer R, Weinhouse H, Volman G, Amikam D, Benziman M, Gilles-Gonzalez MA. 2001. Phosphodiesterase A1, a regulator of cellulose synthesis in Acetobacter xylinum, is a heme-based sensor. Biochemistry 40:3420–3426. 10.1021/bi0100236. [DOI] [PubMed] [Google Scholar]
  • 31.Kitanishi K, Kobayashi K, Kawamura Y, Ishigami I, Ogura T, Nakajima K, Igarashi J, Tanaka A, Shimizu T. 2010. Important role of Tyr43 at the putative distal side in the oxygen recognition and stability of the Fe(II)-O2 complex of YddV, a globin-coupled heme-based oxygen sensor diguanylate cyclase. Biochemistry 49:10381–10393. 10.1021/bi100733q. [DOI] [PubMed] [Google Scholar]
  • 32.Nuzzo D, Makitrynskyy R, Tsypik O, Bechthold A. 2020. Cyclic di-GMP cyclase SSFG_02181 from Streptomyces ghanaensis ATCC14672 regulates antibiotic biosynthesis and morphological differentiation in streptomycetes. Sci Rep 10:12021. 10.1038/s41598-020-68856-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Arora DP, Hossain S, Xu Y, Boon EM. 2015. Nitric oxide regulation of bacterial biofilms. Biochemistry 54:3717–3728. 10.1021/bi501476n. [DOI] [PubMed] [Google Scholar]
  • 34.Bedrunka P, Olbrisch F, Rüger M, Zehner S, Frankenberg-Dinkel N. 2018. Nitric oxide controls c-di-GMP turnover in Dinoroseobacter shibae. Microbiology (Reading) 164:1405–1415. 10.1099/mic.0.000714. [DOI] [PubMed] [Google Scholar]
  • 35.Rinaldo S, Giardina G, Mantoni F, Paone A, Cutruzzola F. 2018. Beyond nitrogen metabolism: nitric oxide, cyclic-di-GMP and bacterial biofilms. FEMS Microbiol Lett 365:fny029. 10.1093/femsle/fny029. [DOI] [PubMed] [Google Scholar]
  • 36.Carlson HK, Vance RE, Marletta MA. 2010. H-NOX regulation of c-di-GMP metabolism and biofilm formation in Legionella pneumophila. Mol Microbiol 77:930–942. 10.1111/j.1365-2958.2010.07259.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA. 2000. Practical Streptomyces genetics. The John Innes Foundation, Norwich, United Kingdom. [Google Scholar]
  • 38.Green MR, Sambrook J. 2012. Molecular cloning: a laboratory manual, 4th ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
  • 39.Gust B, Challis GL, Fowler K, Kieser T, Chater KF. 2003. PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc Natl Acad Sci USA 100:1541–1546. 10.1073/pnas.0337542100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Sun J, Kelemen GH, Fernandez-Abalos JM, Bibb MJ. 1999. Green fluorescent protein as a reporter for spatial and temporal gene expression in Streptomyces coelicolor A3(2). Microbiology (Reading) 145:2221–2227. 10.1099/00221287-145-9-2221. [DOI] [PubMed] [Google Scholar]
  • 41.Komatsu M, Uchiyama T, Omura S, Cane DE, Ikeda H. 2010. Genome-minimized Streptomyces host for the heterologous expression of secondary metabolism. Proc Natl Acad Sci USA 107:2646–2651. 10.1073/pnas.0914833107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Aigle B, Wietzorrek A, Takano E, Bibb MJ. 2000. A single amino acid substitution in region 1.2 of the principal sigma factor of Streptomyces coelicolor A3(2) results in pleiotropic loss of antibiotic production. Mol Microbiol 37:995–1004. 10.1046/j.1365-2958.2000.02022.x. [DOI] [PubMed] [Google Scholar]
  • 43.Sumi S, Suzuki Y, Matsuki T, Yamamoto T, Tsuruta Y, Mise K, Kawamura T, Ito Y, Shimada Y, Watanabe E, Watanabe S, Toriyabe M, Takano Shiratori H, Ueda K, Takano H. 2019. Light-inducible carotenoid production controlled by a MarR-type regulator in Corynebacterium glutamicum. Sci Rep 9:13136. 10.1038/s41598-019-49384-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES