ABSTRACT
Persistent infections with high-risk human papillomaviruses (HR-HPV) from the genus alpha are established risk factors for the development of anogenital and oropharyngeal cancers. In contrast, HPV from the genus beta have been implicated in the development of cutaneous squamous cell cancer (cSCC) in epidermodysplasia verruciformis (EV) patients and organ transplant recipients. Keratinocytes are the in vivo target cells for HPV, but keratinocyte models to investigate the replication and oncogenic activities of beta-HPV genomes have not been established. A recent study revealed, that beta-HPV49 immortalizes normal human keratinocytes (NHK) only, when the viral E8^E2 repressor (E8−) is inactivated (T. M. Rehm, E. Straub, T. Iftner, and F. Stubenrauch, Proc Natl Acad Sci U S A 119:e2118930119, 2022, https://doi.org/10.1073/pnas.2118930119). We now demonstrate that beta-HPV8 and HPV38 wild-type or E8− genomes are unable to immortalize NHK. Nevertheless, HPV8 and HPV38 express E6 and E7 oncogenes and other transcripts in transfected NHK. Inactivation of the conserved E1 and E2 replication genes reduces viral transcription, whereas E8− genomes display enhanced viral transcription, suggesting that beta-HPV genomes replicate in NHK. Furthermore, growth of HPV8- or HPV38-transfected NHK in organotypic cultures, which are routinely used to analyze the productive replication cycle of HR-HPV, induces transcripts encoding the L1 capsid gene, suggesting that the productive cycle is initiated. In addition, transcription patterns in HPV8 organotypic cultures and in an HPV8-positive lesion from an EV patient show similarities. Taken together, these data indicate that NHK are a suitable system to analyze beta-HPV8 and HPV38 replication.
IMPORTANCE High-risk HPV, from the genus alpha, can cause anogenital or oropharyngeal malignancies. The oncogenic properties of high-risk HPV are important for their differentiation-dependent replication in human keratinocytes, the natural target cell for HPV. HPV from the genus beta have been implicated in the development of cutaneous squamous cell cancer in epidermodysplasia verruciformis (EV) patients and organ transplant recipients. Currently, the replication cycle of beta-HPV has not been studied in human keratinocytes. We now provide evidence that beta-HPV8 and 38 are transcriptionally active in human keratinocytes. Inactivation of the viral E8^E2 repressor protein greatly increases genome replication and transcription of the E6 and E7 oncogenes, but surprisingly, this does not result in immortalization of keratinocytes. Differentiation of HPV8- or HPV38-transfected keratinocytes in organotypic cultures induces transcripts encoding the L1 capsid gene, suggesting that productive replication is initiated. This indicates that human keratinocytes are suited as a model to investigate beta-HPV replication.
KEYWORDS: HPV38, HPV8, beta-human papillomavirus, epidermodysplasia verruciformis, gene expression
INTRODUCTION
Human papillomaviruses (HPV) are a large family of cancer-associated viruses with currently 229 classified types (https://www.hpvcenter.se/human_reference_clones/) that are grouped into five genera: alpha-, beta-, gamma-, mu-, and nu-papillomaviruses (PV).
Research has been dominated by the study of high-risk HPV (HR-HPV) (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 58, and 59) that cause persistent infections, which can lead to cancers at different body sites like the cervix uteri, anus, larynx, oropharynx, oral cavity, penis, vulva, and vagina. This results in 630,000 new cancer cases every year (1).
Beta-HPV mainly cause asymptomatic infections at cutaneous sites in the general population (2, 3) but have been suggested to be involved in the development of cutaneous squamous cell cancer (cSCC) in conjunction with UV exposure in patients suffering from the rare genodermatosis epidermodysplasia verruciformis (EV) and organ transplant recipients (OTR) with long-lasting immunosuppression (2–5). EV patients have defects in the TMC6, TMC8, or CIB1 genes and the encoded proteins have been shown to form a complex that has been hypothesized to restrict beta-HPV replication in keratinocytes (6, 7).
Interestingly, the contribution of beta-HPV to cSCC appears to be different in EV and OTR patients, as cSCCs in EV patients maintain high levels of replicating viral genomes and express viral proteins, whereas cSCC in OTR patients display less than one viral genome per cancer cell and rarely express viral transcripts (5, 8–12). This indicates that beta-HPV may contribute to the maintenance of cSCC in EV but not in OTR patients.
Beta-HPV research has focused mainly on the activities of the oncoproteins E6 and E7, which have been investigated by overexpression in cultured human keratinocytes or the skin of transgenic mice. This has revealed that beta-HPV E7 proteins share the ability to interact with members of the retinoblastoma protein family with HR-HPV E7 proteins (13–15). HPV5 and 38 E7 have been shown to reduce the amounts of pRB protein similar to HPV16 E7, but the underlying mechanism has not been elucidated (13, 15, 16). In contrast, HPV49, 75, and 76 E7 proteins increase pRB levels and promote hyperphosphorylation of pRB (14, 17). A highly conserved function of beta-HPV E6 proteins is their ability to interact and inactivate MAML1, a transcriptional coactivator in the Notch signal transduction pathway, and this is thought to prevent the differentiation of keratinocytes (18–20). Another conserved function of beta HPV E6 is the evasion of UV-induced apoptosis (21–24). In addition, beta-HPV5, 8, and 38 E6 proteins have been shown to interfere with homologous recombination and nonhomologous end-joining (NHEJ) DNA repair pathways (25–28). Transgenic mice revealed that HPV8 E6 is sufficient for papilloma induction of which a small number progressed to SCCs (29). In contrast, transgenic mice expressing HPV38 E6 and E7 only developed tumors when irradiated with UV and mice expressing HPV49 E6 and E7 only when treated with 4-nitroquinoline 1-oxide (30, 31). Chronic UV irradiation of HPV38 E6/E7 transgenic mice induces a large number of UV-induced DNA mutations, and their pattern closely resembles that of human cSCC (32). This has led to the model that beta-HPV E6 expression enforces mutations upon UV exposure, which promote progression to cSCC. Interestingly, retroviral expression of HPV38, HPV49, HPV75, or HPV76 E6 and E7 immortalizes normal human keratinocytes (NHK), whereas HPV8 E6 and E7 only have weak activity (13–15, 17, 33, 34). This correlates with the binding of E6 to p53 since HPV38, 49, 75, and 76 E6 bind p53, whereas HPV8 E6 does not (14, 17, 35–37). HPV49, 75, and 76 interact with the E3 ubiquitin ligase E6-AP, which leads to the proteasomal degradation of p53 comparable to HR-HPV, whereas HPV38 E6 stabilizes p53 and alters its activities by other mechanisms (14, 17, 34, 38).
HPV have adapted their replication cycle to the differentiation state of infected keratinocytes, and this is best understood for HR-HPV. HPV infect keratinocytes in the basal layer and establish a persistent infection. Upon cell division, infected cells can enter the suprabasal layer and express keratinocyte differentiation markers. Through the activities of HR-HPV E6 and E7, infected cells re-enter the cell cycle to initiate DNA replication and activate DNA damage response (DDR) pathways (39, 40). Both pathways are required for productive HR-HPV replication (39, 40). In addition, keratinocyte differentiation is required to activate the HR-HPV late promoter residing in the E7 gene and for viral genome amplification (39). This results in the transcription of spliced E1^E4 and E4^L1 mRNAs and consequently in the expression of E4 and L1 proteins in the upper layers of the infected epithelium. Finally, amplified genomes are packaged into L1/L2 capsids giving rise to infectious virions. Beta-HPV also display a differentiation-dependent replication cycle as shown by in situ RNA hybridization for a benign HPV5-positive lesion from an EV patient (41). Furthermore, the differentiation-dependent expression of E4 and L1 proteins, viral genome amplification, as well as cell cycle markers have been described in lesions from EV and OTR patients, suggesting that the overall strategy for productive replication is conserved among HR-HPV and beta-HPV (9–11). However, transcript analyses have indicated that beta-HPV have additional transcription start sites in the upstream regulatory region (URR) and E6 compared to HR-HPV (41–44). The URR promoter has been initially suggested to be a late promoter due to its ability to express L1 transcripts, but in situ RNA hybridization studies have not provided evidence for an increased expression in suprabasal layers of an EV lesion (41, 44). The existence of individual promoters for E6 and E7 would allow for a separate transcriptional regulation of both oncoproteins instead of posttranscriptional regulation by splicing in the case of HR-HPV.
Many of the oncogenic activities of HR-HPV E6 and E7 proteins are required to facilitate viral replication in differentiating epithelium. In contrast, the contribution of oncogenic activities of beta-HPV E6 and E7 and risk factors for cSCC development to viral replication have not been explored. Up to now, the U2OS osteosarcoma cell line has been used to investigate replication and transcription properties of beta-HPV5 and 8 (43, 45). However, no viral genome amplification or other markers of the productive replication cycle were observed, indicating that critical factors for productive beta-HPV replication might be absent (45). We have recently described that beta-HPV49 is transcribed and replicated in NHK for several days, but despite encoding immortalizing E6 and E7 proteins, HPV49 only becomes immortalization competent when the viral E8^E2 repressor protein is inactivated (46). The viral E8^E2 protein is highly conserved among PV, and its inactivation results in greatly increased gene expression and genome replication of HR-HPV16 and 31, beta-HPV8 and 49, HPV1 as well as Mus musculus PV1 (MmuPV1) in undifferentiated keratinocytes (46–50). Based on these findings, we analyzed HPV8 and HPV38 immortalization, transcription, and replication properties in NHK. Our results indicate that the inactivation of E8^E2 also leads to increased expression of viral transcripts including E6 and E7, but neither HPV8 nor 38 wild type (wt) or E8− genomes can immortalize NHK. Transcription analyses of transiently transfected NHK reveal that different viral transcripts expressed in undifferentiated keratinocytes and that the expression of E4^L1 transcripts is further increased in organotypic cultures. Furthermore, transcript patterns of transient HPV8 organotypic cultures and an HPV8-positive wart-like lesion from an EV patient resemble each other, suggesting that NHK can be used to investigate the beta-HPV replication in vitro.
RESULTS
HPV8 or HPV38 wt or E8− genomes do not immortalize NHK.
We recently observed that the inactivation of the E8^E2 repressor (E8−) in the HPV49 genome is necessary to immortalize NHK. To investigate whether other beta-HPV genomes can immortalize NHK and whether this is modulated by the presence of E8^E2, we used HPV8, which belongs to the beta1 species, and HPV38, which belongs to the beta2 species and encodes immortalizing E6 and E7 genes. We generated an HPV38 E8− genome by mutation of the predicted start codon from ATG to ACG, which is silent in the overlapping E1 gene identical to HPV49 or used an HPV8 E8− genome that over-replicates in NHK upon transient transfection (47). Recircularized wt or E8− genomes were cotransfected with a selection marker plasmid into NHK from three different donors as previously described (46). The HPV49 E8− genome, used as a positive control, resulted in drug-resistant colonies that could be expanded into stable cell lines as expected. Interestingly, neither HPV8 nor 38 wt or E8− genomes gave rise to drug-resistant colonies that could be passaged further (Table 1). The results for HPV8 are consistent with the lack of robust immortalization activity for E6 and E7 (15). However, the results for HPV38 are surprising, as coexpression of E6 and E7 from recombinant retroviruses has been shown to immortalize NHK (13, 34). A summary of the NHK immortalization capabilities of retrovirally expressed E6 and E7 and of HPV8, 38, and 49 genomes is shown in Table 2.
TABLE 1.
NHK immortalization assays using different HPV genomesa
| HPV genome | Donor 1 | Donor 2 | Donor 3 |
|---|---|---|---|
| HPV49 E8− | + | + | + |
| HPV8 wt | − | − | − |
| HPV8 E8− | − | − | − |
| HPV38 wt | − | − | − |
| HPV38 E8− | − | − | − |
−, negative; +, positive.
TABLE 2.
Comparison of immortalization properties of different beta-HPV in NHKa
| Species | Type | Retroviral E6/E7 expression | Wt genome | E8− genome | Reference(s)/information source |
|---|---|---|---|---|---|
| Beta-1 | HPV8 | − | − | − | 15; Table 1 |
| Beta-2 | HPV38 | + | − | − | 13, 14, 34; Table 1 |
| Beta-3 | HPV49 | + | − | + | 14, 17, 46 |
−, negative; +, positive.
HPV8 and 38 express different spliced mRNAs in transfected NHK for several days.
To understand whether HPV8 and 38 are transcriptionally active in cultured NHK, quantitative PCR (qPCR) assays for six predicted or experimentally validated splice junctions were established (URR^E2, URR^E4, E1^E2, E1^E4, E8^E2N, and E8^E2) (Fig. 1). RNA was isolated from HPV8 or 38 wt transfected NHK 3 days, 6 days, and 9 days posttransfection (p.t.) and subjected to reverse transcriptase quantitative PCR (RT-qPCR) analysis (Fig. 1A). Sequencing of amplification products confirmed all predicted splice junctions (Fig. 1B). Quantification of the different splice junctions revealed that the most abundant HPV8 transcript at all time points was E1^E4 (Fig. 1A). Conversely, HPV8 URR^E2 was the second most abundant transcript 3 days p.t. but became the least abundant transcript 6 and 9 days p.t. HPV8 URR^E4 was the third most abundant transcript 3 days p.t. and became the second most abundant 6 and 9 days p.t. HPV8 E1^E2 was the fourth most abundant transcript 3 and 6 days p.t. and the third 9 days p.t. HPV8 E8^E2 was the fifth most abundant transcript 3 days p.t. but became the third most abundant transcript 6 and 9 days p.t. HPV8 E8^E2N was expressed at very low levels at all time points. In contrast to HPV8, the relative abundances of HPV38 transcripts displayed very little changes at all time points. The most abundant one was E1^E4, followed by URR^E4, E1^E2, URR^E2, E8^E2, and E8^E2N, with the exception of URR^E4 and E1^E4, which ranked 1 and 2 at 3 days p.t. In general, levels of all transcripts declined over time. Taken together, these data indicate that HPV8 and 38 are transcriptionally active and express different spliced transcripts in cultured NHK for several days.
FIG 1.
(A) qPCR analysis of HPV8 or HPV38 wt genome transfected into NHK after 3, 6, and 9 days p.t. of NHK. PGK1 was used as a reference transcript. Data are derived from four independent experiments using cells from different donors. (B) Transcript maps of HPV8 and HPV38. The genome is represented in a linear fashion. Shown are the upstream regulatory region (URR), the early genes (E1 to E8) and the late genes L1 and L2. Nucleotide positions in the table refer to the last exon nucleotide for splice donors (D) and the first exon nucleotide for splice acceptors (A). Transcripts identified by qPCR and sequencing are indicated as gray bars. The putative extension of these transcripts to the early polyadenylation site is indicated by dashed lines. (C) Nucleotide positions of splice donors and acceptors of HPV8 and 38. The positions of splice donors refer to the last nucleotide in the exon and of splice acceptors to the first nucleotide of the exon.
Inactivation of E1, E2, or E8^E2 influences HPV8 and 38 gene expression.
In addition to E8^E2 (E8−), the E1 (E1−), E2 (E2−), E6 (E6−), and E7 (E7−) genes were also inactivated by mutation of the respective ATG start codons without changing the amino acid sequence of overlapping genes. HPV8 wt and mutant genomes were transfected in NHK from four different donors, and spliced transcripts were quantified 3, 6, and 9 days p.t. by qPCR (Fig. 2). E8− genomes displayed significantly increased gene expression of all transcripts at at least one time point with the exception of E8^E2N. This behavior of E8− genomes is consistent with increased replication properties and the transcriptional phenotype of HPV49 E8− in NHK (Fig. 2) (46). For example, E8− genomes displayed 5-fold 3 days p.t., 27-fold 6 days p.t., and 103-fold 9 days p.t. increased expression of E1^E4 compared to that of the wt, and this relative increase is due to both an increase from E8− genomes and a decrease from wt genomes over time. E1− and E2− genomes displayed significantly reduced E1^E4 transcripts and E2− genomes additionally reduced E1^E2 and E8^E2 transcripts at some time points. Since E1 and E2 are conserved HPV replication proteins, the reduction of E1^E4 transcripts from both E1− and E2− genomes is most likely due to reduced replication of the wt genomes and suggests that HPV8 wt genomes replicate in NHK. Interestingly, E7− genomes showed significantly reduced expression of URR^E4, E1^E4, and E1^E2 transcripts 3 days p.t. but not at later time points. In contrast, E6− genomes had no transcriptional phenotype.
FIG 2.
qPCR analyses of spliced HPV8 transcripts expressed 3, 6, and 9 days p.t. of NHK with HPV8 wt E1−, E2−, E6−, E7−, or E8− genomes. PGK1 was used as a reference transcript. Experiment was repeated four times independently with cells from different donors. Error bars indicate the standard error of the mean (SEM). Statistical significance was determined using a ratio-paired t test using the wt as a reference (*, P < 0.05; **, P < 0.01).
For HPV38, we first validated the replication phenotype of the E8− genome after transient transfection into NHK and Southern blot analysis of DpnI-digested DNA. Comparable to HPV8 and HPV49 E8− (46, 47), HPV38 E8− genomes displayed a prominent, replicated genome band 6 days p.t. that was absent from HPV38 wt transfected cells (Fig. 3A). These data confirm that HPV38 E8− genomes replicate to much higher levels than wt genomes. Consistent with an increased genome replication, the majority of viral transcripts was expressed significantly higher from E8− genomes (Fig. 3B). However, the increases in E1^E4 transcripts from E8− genomes compared to those of the wt were lower both 6 days (5-fold) and 9 days (25-fold) p.t. compared to those of HPV8 (Fig. 2 and Fig. 3B) indicating differences between HPV8 and 38. Similar to HPV8, E1− and E2− genomes displayed significantly reduced expression of several viral transcripts, suggesting that also HPV38 wt genomes replicate to some extent, but this is below the detection level of Southern blotting (Fig. 3A). Comparable to HPV8, E6− genomes did not demonstrate a transcriptional phenotype, and E7− showed only significantly decreased E1^E2 transcripts 3 days p.t.
FIG 3.
(A) Southern blot analysis of low-molecular weight DNA, harvested 6 days p.t. of NHK transiently transfected with HPV38 wt and E8− genomes. The DNA was digested with DpnI to remove nonreplicated input DNA and the single-cutter Eco105I to linearize the viral genome. As a marker (M), 100 pg linearized HPV38 genome was used. The arrow indicates the position of replicated genomes. (B) qPCR analyses of spliced HPV38 transcripts expressed 3, 6, and 9 days p.t. of NHK with HPV38 wt E1−, E2−, E6−, E7−, or E8− genomes. PGK1 was used as a reference transcript. The experiment was repeated four times independently using cells from different donors. Errors bars indicate the SEM. Statistical significance was determined using a ratio-paired t test using the wt as a reference (*, P < 0.05; **, P < 0.01; ***, P < 0.001).
HPV8 and 38 wt and E8− genomes express E6 and E7 transcripts.
Immortalization of NHK requires the expression of HPV E6 and E7. We therefore analyzed E6 and E7 transcription from HPV8 and 38 wt and E8− genomes. To distinguish E6 and E7 transcripts from transfected input genomes, polyA+ RNA was enriched and subjected to RT-qPCR analysis (Fig. 4A). HPV8 and 38 genomes express E6 transcripts at similar levels that slightly decline from 3 days to 9 days p.t. (Fig. 4A). HPV8 E8− genomes express significantly more E6 at all time points (3.5- to 12.2-fold) than the wt. Expression increases from 3 days to 6 days p.t. and stays constant in contrast to the wt (Fig. 4A). HPV38 E8− genomes only express at 6 days and 9 days p.t. more E6 than the wt, but this difference is not statistically significant. Comparable to HPV8 E8−, E6 levels do not decline over time. HPV8 and 38 wt genomes express E7 transcripts that decline 3- to 4-fold from 3 days to 9 days p.t. (Fig. 4A). In contrast to E6, HPV38 wt transfected cells express 2- to 3-fold higher E7 transcripts than HPV8 wt. HPV8 E8− genomes express significantly more E7 transcripts than the wt at all time points (4.3- to 20.1-fold increase), and E7 expression is stable over time similar to other transcripts (Fig. 2 and 4A). E7 levels from HPV38 E8− genomes increase over time but are only significantly higher than the wt 9 days p.t. (Fig. 4A). Generally, the amounts of E6 transcripts are lower from both wt and E8− genomes than E7 transcripts, which may indicate that E6 and E7 transcripts are derived from separate promoters. To understand whether the E6 and E7 transcript levels correlate with immortalization, we compared E6 and E7 transcript levels from E8− genomes (Fig. 4B). This analysis indicated that HPV8 E8− produces the highest amounts of E6 at all time points, whereas HPV38 and 49 E8− express similar levels 6 and 9 days p.t. E7 levels from E8− genomes are different 3 days p.t. but are similar 9 days p.t. These data suggest that the lack of immortalization by HPV38 wt and E8− genomes is not due to a failure of E6 and E7 expression. Furthermore, the comparison reveals that the amounts of E6 and E7 are similar from HPV38 and HPV49 E8− genomes, suggesting that the lack of immortalization cannot be explained by different E6 and E7 transcript levels.
FIG 4.
(A) qPCR analysis of HPV8 and HPV38 E6 and E7 transcripts in polyA-enriched RNA in NHK from four different donors transfected independently (3, 6, and 9 days) with wt or E8- genomes. Error bars indicate the SEM. PGK1 was used as a reference transcript. Statistical significance was determined using a ratio-paired t test using the wt as a reference (*, P < 0.05; **, P < 0.01; ***, P < 0.001). (B) Comparison of qPCR analyses of HPV8, 38, and 49 E6 and E7 transcripts in polyA-enriched RNA from NHK transfected with E8− genomes. PGK1 was used as a reference transcript. Error bars indicate the SEM.
Beta-HPV transcription in organotypic cell cultures.
The productive HR-HPV replication cycle can be induced by growth of stable cell lines with extrachromosomal viral genomes in organotypic cultures (51). Recent studies have also indicated that late viral proteins are induced in organotypic cultures in HPV16 quasivirus-infected NHK (52), suggesting that cell lines stably maintaining replicating HPV genomes are not necessary to investigate the productive replication cycle. We therefore tested if NHK transiently transfected with recircularized HPV16 genomes induce spliced late viral transcripts E1^E4 and E4^L1 upon growth in organotypic cultures. Transfected NHK were grown for 4 to 5 days p.t. as monolayer cultures and harvested as an undifferentiated control or transferred on organotypic cultures and harvested 16 days after exposure to air. RNA analyses revealed an average 322-fold induction of the keratinocyte differentiation marker KRT10, a significant 275-fold induction of E1^E4 transcripts, and a >1,000-fold induction of E4^L1 transcripts showing a trend (P = 0.17) in organotypic cultures (Fig. 5), confirming that the productive HPV16 replication cycle can be induced in transiently transfected NHK grown in organotypic cultures.
FIG 5.
qPCR analysis of organotypic raft cultures (3D) consisting of NHK transiently transfected with HPV16, HPV8, or HPV38 wt genomes and corresponding monolayer cells (2D). Data are derived from three (HPV16), five (HPV38), or six (HPV8) independent transfections using cells from different donors. PGK1 was used as a reference transcript. In addition to the viral transcripts, the keratinocyte differentiation marker KRT10 (keratin 10) was determined and is expressed relative to cells maintained in monolayer (2D) culture. Statistical significance was determined using a ratio-paired t test using monolayer cultures as a reference (*, P < 0.05; **, P < 0.01).
Transcript analyses of an HPV8-positive biopsy from an EV patient have indicated that two different splice donors in E4 can be used to generate E4^L1 transcripts (E4^L1, E4b^L1) (Fig. 1C) (44). The respective cloned cDNAs were obtained by gene synthesis, and qPCR primer pairs were established. RNA was isolated from NHK transfected with HPV8 genomes either grown in monolayer culture or grown in organotypic cultures for 16 days and analyzed. This revealed a 650-fold induction of KRT10 similar to HPV16-transfected cells (Fig. 5). All viral transcripts detected in undifferentiated cultures were also present in organotypic cultures. In addition, E4^L1 and E4b^L1 could be detected in undifferentiated and organotypic cultures with E4b^L1 being more abundant. Both transcripts increased 14-fold and 7-fold, respectively, but this was only significant for E4b^L1 (Fig. 5). URR^E2 transcripts also increased 10-fold, but this was not significant. No changes were observed for E1^E4, E1^E2, URR^E4, E8^E2, and E8^E2N transcripts (Fig. 5).
Primers in E4 and L1 allowed the detection of a single spliced RNA species in HPV38-transfected cells grown in undifferentiated and organotypic cultures. Cloning and sequencing of the amplicon identified the 3′-border of the E4 exon at nucleotide (nt) 3475 and the 5′-border of the L1 exon at nt 5661 (Fig. 1C). KRT10 levels increased 530-fold in organotypic cultures, indicating comparable differentiation levels as in HPV8- and HPV16-transfected NHK (Fig. 5). Surprisingly, E1^E4, E1^E2, URR^E4, and URR^E2 transcript levels were decreased in organotypic cultures, and this was significant for E1^E4 and URR^E4 (Fig. 5). In contrast, E4^L1 levels increased 5.1-fold, but this did not reach statistical significance. E8^E2N levels and E8^E2 levels decreased. Taken together, these data indicate E4^L1 transcripts are induced in HPV8 and HPV38-transfected NHK grown in organotypic cultures, whereas E1^E4 transcripts are unchanged or decrease, which is different from HPV16.
We then analyzed HPV8 transcription in a verruca plana-like lesion of an EV patient. Hematoxylin and eosin (H&E) staining showed a plump acanthotic epidermis with an overlying orthohyperkeratotic corneal layer. Here, the typical EV changes were seen with swollen, enlarged keratinocytes of the apical stratum spinosum as well as the stratum granulosum. The cells showed a pale blue-gray, broad cytoplasm with keratohyalin granules of different sizes (Fig. 6).
FIG 6.

(A) H&E staining of the paraffin-embedded lesion (right) is a zoom-in of the image on the left. The arrow indicates a cell in the apical stratum spinosum with EV-typical cytopathic effect. Scale bars are as follows: (left) 500 μm, (right) 100 μm. (B) qPCR analysis of RNA from a HPV8-positive lesion of an EV patient. PGK1 was used as a reference transcript.
RNA was isolated and analyzed by qPCR. E1^E4, E1^E2, URR^E4, E8^E2, E4^L1, and E4b^L1 transcripts, but no URR^E2 and E8^E2N transcripts, could be detected (Fig. 6B). E1^E4 was the most abundant transcript, followed by URR^E4, E8^E2, E4b^L1, E4^L1, and E1^E2 transcripts. The relative expression of E1^E4, URR^E4, E4^L1, E4b^L1, E1^E2, and E8^E2N transcripts is similar between in vivo and organotypic cultures, whereas URR^E2 is highly expressed in organotypic cultures but is absent in the EV lesion, and the E8^E2 transcript is highly expressed in vivo but of very low abundance in organotypic cultures. In summary, these data indicate that the HPV8 pattern in organotypic cultures of transfected NHK resembles partially the pattern detected in an EV patient.
DISCUSSION
Beta-HPV have been suspected to contribute to the development of cSCC in EV and OTR patients. The analysis of HR-HPV genomes in human keratinocytes has revealed that some of the oncogenic activities of the E6 and E7 oncoproteins are required for virus replication in undifferentiated and, mainly, in differentiated keratinocytes. In contrast, the replication of beta-HPV genomes has not been investigated in human keratinocytes. Previous studies have shown that HPV5 and 8 can be stably maintained as episomes over several cell passages in the U2OS osteosarcoma cell line (45). Transcript mapping studies have indicated that HPV5 uses five different promoters and several conserved splice donor and acceptor sites in U2OS cells, consistent with findings for other human and animal PV (43). However, no spliced transcripts derived from the URR were reported that have been previously described in HPV5- and 8-positive lesions from EV patients (41, 44). This suggests that the U2OS cell line does not fully support all aspects of beta-HPV replication.
We have recently reported that beta-HPV49 is expressed in NHK but does not give rise to immortalized keratinocytes despite encoding immortalizing E6 and E7 (46). Inactivation of HPV49 E8^E2 (E8−) resulted in greatly increased genome replication and E6 and E7 expression in short-term assays and also enabled the generation of immortalized keratinocytes maintaining high levels of extrachromosomal viral DNA (46). We have now extended our analysis to HPV8, a beta1 HPV often found in benign and malignant lesions of EV patients, and HPV38, a beta2-HPV encoding immortalizing E6 and E7 genes (13, 14). Comparable to HPV49, HPV8 and 38 express several spliced transcripts at different amounts for several days. Furthermore, disruption of E1 or E2 diminishes viral gene expression. Since E1 and E2 are conserved viral replication proteins, this most likely indicates that the reduced viral gene expression is caused by an inability to replicate the viral genomes. Comparable to HPV49 and other PV (46–49, 53), the inactivation of E8^E2 in HPV8 and 38, leads to increased genome replication and gene expression including the E6 and E7 genes. This suggests that E8^E2 is a crucial negative regulator of E6 and E7 and that changes of E8^E2 activity might contribute to the oncogenic effects of beta-HPV in vivo. Nevertheless, neither the HPV8 wt nor the E8− genome was able to immortalize NHK. This is consistent with weak immortalizing activity of overexpressed HPV8 E6 and E7 (15). HPV8 E2 has also been described as an oncogene in a transgenic mouse model (54). However, our data do not support the idea that E2 alone or in combination with E6 and E7 facilitates immortalization of NHK, as E2 encoding transcripts (E1^E2, URR^E2, and E8^E2N) as well as E6 and E7 transcripts are present in wt and at increased amounts in E8− transfected cells. Surprisingly, also the HPV38 wt or the E8− genome did not immortalize keratinocytes despite such activity of the E6 and E7 oncoproteins upon retroviral expression (13, 34). Based on our previous study (46), beta-HPV E6 and E7 levels expressed from wt genomes may not be sufficient for immortalization, but surprisingly, the HPV38 E8− genome, displaying E6 and E7 RNA levels comparable to those of HPV49 E8−, also did not immortalize. It is still possible, although similar RNA levels are present, that lower amounts of HPV38 E6 and E7 proteins than their HPV49 counterparts are expressed and thus are insufficient for immortalization. When comparing the amounts of other transcripts, we noted that HPV49 E8− but not wt genomes express higher E1^E4 and E1^E2 transcript levels than the respective HPV8 and 38 genomes in transient assays (Fig. 1–3) (46). The biological significance is unclear, but it is possible that E1^E2 transcripts contribute to E2 protein levels, which in turn may be relevant for the long-term extrachromosomal maintenance of HPV49 E8− genomes due to the conserved replication and viral genome partitioning activities of E2. Previous work indicated that HPV49 E8− genomes have to be maintained as extrachromosomal elements in order to immortalize keratinocytes (46). However, HPV31 E8− genomes cannot be maintained as episomes in keratinocytes for unknown reasons (48, 49). A similar phenotype of HPV38 E8− genomes could explain their inability to immortalize. Nevertheless, the lack of immortalization by HPV38 wt and E8− genomes also indicates that the viral genomes do not efficiently integrate into host chromosomes in a way to produce E6 and E7 levels sufficient for immortalization. This is similar to findings for HPV49 wt genomes but differs significantly from HR-HPV genomes in tissue culture and in vivo (46, 55). These findings further strengthen the notion that fundamental differences between beta-HPV and HR-HPV exist.
Keratinocyte differentiation is required to complete the replication cycle of HR-HPV. Immunofluorescence and RNA in situ hybridization analyses have provided evidence that beta-HPV also display a differentiation-dependent viral life cycle in skin lesions of EV patients and OTR (9–11, 41). However, a detailed understanding of these processes is missing. RNA analyses of HPV8-, 38-, and 49-transfected monolayer NHK cultures reveal that conserved splice donor sites in the URR at the beginning of E1 and at the end of the E8 gene region are used that are linked to conserved spliced acceptor sites at the beginning of E2 and within the E2/E4 region. With the exception of the URR exon, the other exon/intron borders are highly conserved among all investigated PV (https://pave.niaid.nih.gov/). A comparable URR exon is not expressed by HR-HPV but has been observed in HPV5- and 8-positive biopsies in vivo and warts induced by animal viruses such as bovine PV1, cottontail rabbit PV, and MmuPV1 (41, 44, 56–58). Our data indicate that the URR^E4 transcript is highly abundant in undifferentiated NHK, pointing to an important role at early stages of the viral life cycle. Assuming that the URR^E4 transcript extends to the conserved early polyadenylation site in L2 in undifferentiated NHK, its coding potential and function is unclear as the URR exon does not provide in-frame start codons for E4 or E2, and beta-HPV do not encode an E5 gene between E4 and the early polyadenylation site.
In our hands, HPV8 and 38 genomes do not immortalize keratinocytes, and thus stable cell lines maintaining replicating viral genomes could not be obtained. We therefore grew transiently transfected NHK in organotypic cultures to induce keratinocyte differentiation and the productive viral cycle. As a proof-of-concept, we used NHKs transfected with HPV16 and were able to show that spliced E1^E4 and E4^L1 transcripts are greatly induced in organotypic cultures. This is consistent with the activation of the differentiation-dependent viral late promoter P670 in the E7 gene, which is regarded as a hallmark of the productive replication cycle and infection experiments with HPV16 quasivirions (39, 52). Unexpectedly, despite a similar induction of the keratinocyte differentiation marker KRT10, E1^E4 transcripts were not further induced in transient HPV8 and were even reduced in transient HPV38 organotypic cultures. The E1^E4 splice junction is required to provide a start codon for the translation of E4 proteins and therefore the differentiation-dependent expression of E4 proteins is thought to be mainly due to the transcriptional induction of E1^E4 RNA. However, it is possible that the differentiation-dependent E4 protein expression of beta-HPV involves posttranscriptional control mechanisms. URR^E4 transcripts are only slightly induced or are reduced in transient HPV8 or HPV38 organotypic cultures, respectively. This is consistent with in situ RNA hybridization patterns of an HPV5-positive lesion of an EV patient and suggests that the responsible promoter in the URR is not strongly regulated by differentiation (41). This further indicates that NHK are a valid model system to study beta-HPV replication. Consistent with findings for HR-HPV, spliced E4^L1 transcripts are induced in transient HPV8 and 38 organotypic cultures, which indicates that the productive cycle has been initiated, but the extent of induction is much lower than for HPV16. The transient HPV8 organotypic cultures resemble an HPV8-positive wart-like lesion of an EV patient with respect to the relative amounts of E1^E4, E1^E2, URR^E4, E4^L1, and E4b^L1 transcripts, also underscoring the idea that NHK are a suitable system for beta-HPV. However, significant differences were also noted as follows: the relative amount of URR^E2 was much higher and that of E8^E2 much lower in organotypic cultures than in the lesion. It is difficult to interpret these differences, as productive beta-HPV lesions have only been described for EV patients and OTR but not in the normal population, and our interpretation relies on the analysis of a single lesion due to the rarity of these patients. Nevertheless, an interesting hypothesis that can now be tested is that the EV genotype contributes to these differences in viral transcript patterns. In summary, this study suggests that transiently transfected NHK are a suitable system to explore the replication cycle of beta-HPV and its modulation by risk factors for cSCC. A disadvantage of this system is that bulk analyses of the host cell transcriptome and proteome are not feasible, as only a minor portion of the cells will take up recircularized viral genomes. However, technical advancements such as single cell RNA sequencing and quasivirus infections with reported infection rates of 20% to 50% in NHK for HPV16 (52) could be adapted to beta-HPV to overcome these limitations.
MATERIALS AND METHODS
Cell culture.
NHK were isolated from human foreskin and maintained as previously described (46). The patients were informed and gave their consent after routine circumcision. This was approved by the ethics committee of the medical faculty of the University Tuebingen (6199/2018BO2) and performed according to the principles of the Declaration of Helsinki. Immortalization and transient transfection assays using recircularized HPV8 or 38 genome assays were carried out as previously described (46). Briefly, for immortalization assays, NHK were transfected in 60-mm dishes in keratinocyte serum-free medium (Gibco, Thermo Fisher) with 4 μg recircularized HPV genomes and 1 μg pSV2-neo plasmid using Fugene HD (Promega) and split the next day onto mitomycin C-treated neomycin-resistant NIH 3T3 J2 fibroblasts in complete E medium (46). Cells were selected with G418 (150 μg/mL) for 8 to 10 days. For transient transfection experiments, 8 × 104 NHK were seeded into 6-well dishes, transfected the next day with 1 μg recircularized HPV genomes, and 24 h later, cells were split on mitomycin C-treated NIH 3T3 J2 in complete E medium.
Organotypic cell culture.
NHK (1 × 105) were seeded in 6-well plates in supplemented keratinocyte serum-free medium (Gibco, Thermo Fisher). Cells were transfected as described above, and cells were trypsinized 48 h later, suspended in complete E medium (46), and seeded on a collagen (Corning Collagen I; Thermo Fisher; rat tail) plug containing NIH3T3-J2 fibroblast cells. The plugs were assembled in Nunc polycarbonate cell culture inserts (Thermo Fisher). Forty-eight hours later, organotypic cultures were exposed to the air-liquid interface to induce differentiation as described previously (53). Organotypic cultures were harvested after 16 days.
Recombinant plasmids.
The cloned HPV16:114b genome has been previously described (53). The cloned HPV8 wt and E8− genomes have been previously described (47, 59). To generate knockout genomes, the respective ATG start codons were mutated to ACG (E1, E2, E6, E8, HPV8 E7) or to GTG (HPV38 E7) as follows: HPV8 E1− (T952C; silent in E1), E2− (T2705C; silent in E1), E6− (T197C), and E7− (T654C; silent in E6) genomes were generated by overlap extension PCR and restriction enzyme cloning. Sequencing of the HPV8 reference genome revealed deviations in E6 and E7 from the published sequence (59) as follows: C302T (E6 S36L), A692G (E7 K14E), and A709G (E7 Q19Q). The cloned HPV38 wt genome has been previously described (60). HPV38 E1− (T912C; silent in E7), E2− (T2668C; silent in E1), E6− (T201C), E7− (A622G; silent in E6), and E8− (T1279C; silent in E1) genomes were generated by overlap extension PCR, inserted into wt genomes by restriction enzyme cloning, and then validated by DNA sequencing. The following plasmids were made to order in a pUC57 plasmid backbone (GenScript, NJ, USA) and used as copy number standards: HPV8 E1^E4 (nt 774 to 966/3303 to 3544), HPV8 E1^E2 (nt 7601 to 7604/2656 to 2826), HPV8 E8^E2 (nt 1225 to 1343/3303 to 3600), HPV8 E8^E2N (nt 1225 to 1343/2657 to 3037), HPV8 E4^L1 (nt 3301 to 3443/5851 to 6500), HPV8 E4b^L1 (nt 3457 to 3704/5851 to 6500), HPV38 E1^E4 (nt 841 to 926/3266 to 3419), HPV38 E1^E2 (nt 721 to 926/2620 to 2694), HPV38 URR^E4 (nt 7343 to 7400/1 to 31/3266 to 3600), HPV38 URR^E2 (nt 7343 to 7400/1 to 31/2620 to 2994), HPV38 E8^E2 (nt 1209 to 1309/3266 to 3600), HPV38 E8^E2N (nt 1205 to 1309/2619 to 2939), and HPV16 E1^E4^L1 (nt 865 to 880/3358 to 3632/5639 to 5696). The plasmid HPV38 E4^L1 (nt 3372 to 4130/4131 to 5787) was generated by cloning an RT-PCR fragment after adding EcoRI restriction sites into the pSG5 vector (Stratagene). The plasmid encoding human PGK1 has been previously described (53).
Southern blot analysis.
Low-molecular weight DNA was isolated from cells transfected with viral genomes and digested with Eco105I (a single cutter for HPV38) and DpnI. Digested DNAs were separated in 0.8% agarose gels. Blotting and hybridization to a 32P-labeled HPV38 probe was carried out as previously described (46). After exposure of the membrane to PhosphoImager screens, signals were visualized using the AIDA software package (Raytest; Germany).
Quantitative PCR.
RNA was isolated from transfected keratinocytes using QiaShredder columns and the RNeasy minikit (Qiagen). PolyA+ RNA was enriched from total RNA as previously described (46). cDNA was synthesized using the QuantiTect reverse transcription kit (Qiagen), and 50 ng per well was analyzed by qPCR using a LightCycler 480 and the corresponding LightCycler 480 SYBR green master mix (Roche). Primer for HPV and differentiation transcripts (Table 3) were used at 0.3 μM concentration. PGK1 primers were used for normalization (53). Copy numbers of viral and cellular transcripts were determined by plasmid standards run in parallel.
TABLE 3.
qPCR primer sequences
| Viral type | Viral transcript | Detection limit (plasmid copies/reaction) | Forward primer | Reverse primer |
|---|---|---|---|---|
| HPV8 | URR^E2 | 20 | TCTATTTTGGCAGCGCTTTT | TCTATTTTGGCAGCGCTTTT |
| URR^E4 | 20 | TCTATTTTGGCAGCGCTTTT | CCTTTGGTTTCGGTTTGTTG | |
| E1^E2 | 2 | TCAAAATTGTTGCACCGTGT | TCAAAATTGTTGCACCGTGT | |
| E1^E4 | 2 | CGGGTATCAGGACCTTTCAA | CGGTGTCTGTCTGCTTGT | |
| E8^E2N | 20 | GACAGCGGAGTCGAGCTAAC | ATTGAAACGCTCGCTGAGAT | |
| E8^E2 | 20 | GACAGCGGAGTCGAGCTAAC | CGGTGTCTGTGTCTGCTTGT | |
| E6 | 2 | TGTAGCAACCGCAACGTTTG | ACTCCTTTCCAGCCTCCTCT | |
| E7 | 20 | ACGAACAGGAAACGGAGGAG | CCGCCATGTTTGCAGTTACC | |
| E4^L1 | 20 | TCAACCTCAAGATGGCAGTG | GCGAAAGACCCTGTGTTGAT | |
| E4^L1b | 2 | CCAGGACAAGCAGACACAGA | AACCTTACCGGTAGCCGATT | |
| HPV38 | URR^E2 | 20 | CAGACGAAGTGCACCGATAA | ACAGGTTGATAGCCCAATCG |
| URR^E4 | 20 | CAGACGAAGTGCACCGATAA | TGGTTGAAGGGCTAGATGCT | |
| E1^E2 | 2 | AGAGGAGGAGCCAGCATACA | TTTCCATTGTCTCCCTCGTC | |
| E1^E4 | 2 | CGATACGGGAGAAAAGCATC | CGATCGCTAGTTGCATGGTA | |
| E8^E2N | 2 | TTTGTGGAGCAAGACAGTGG | GTGCGCTGAGAGTTTCCATT | |
| E8^E2 | 2 | TTTGTGGAGCAAGACAGTGG | TGGTTGAAGGGCTAGATGCT | |
| E6 | 20 | TGTGCAGCAGCTCAGTGATA | TGTCTGTTGCTCCACCTGTT | |
| E7 | 20 | CCATTGACCTGCATTGCCAC | TGGGACACAGAAGCCTTACG | |
| E4^L1 | 20 | CGATACGGGAGAAAAGCATC | CGATCGCTAGTTGCATGGTA | |
| HPV16 | E1^E4 | 20 | TGGCTGATCCTGCAGCAGC | AGGCGACGGCTTTGGTATG |
| E4^L1 | 20 | CCCTGCCACACCACTAAGTT | CTGGGACAGGAGGCAAGTAG | |
| KRT10 | KRT10 | CGCCTGGCTTCCTACTTGG | CTGGCGCAGAGCTACCTCA |
Histology.
The patient sample was taken as a diagnostic punch biopsy after detailed written informed consent was obtained from the patient. The tissue was fixed in 4.5% formalin and then embedded in paraffin. Subsequently, approximately 4-μm-thick sections were taken and stained with hematoxylin and eosin (H&E) in an automatic stainer according to the standard protocol. The diagnosis was made by an experienced dermatopathologist.
ACKNOWLEDGMENTS
This work was funded by a grant from the Deutsche Forschungsgemeinschaft (Stu 218/6-1) to F.S.
Contributor Information
Frank Stubenrauch, Email: frank.stubenrauch@med.uni-tuebingen.de.
Lawrence Banks, International Centre for Genetic Engineering and Biotechnology.
REFERENCES
- 1.de Martel C, Plummer M, Vignat J, Franceschi S. 2017. Worldwide burden of cancer attributable to HPV by site, country and HPV type. Int J Cancer 141:664–670. 10.1002/ijc.30716. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Howley PM, Pfister HJ. 2015. Beta genus papillomaviruses and skin cancer. Virology 479–480:290–296. 10.1016/j.virol.2015.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Quint KD, Genders RE, de Koning MN, Borgogna C, Gariglio M, Bouwes Bavinck JN, Doorbar J, Feltkamp MC. 2015. Human beta-papillomavirus infection and keratinocyte carcinomas. J Pathol 235:342–354. 10.1002/path.4425. [DOI] [PubMed] [Google Scholar]
- 4.Hartevelt MM, Bavinck JN, Kootte AM, Vermeer BJ, Vandenbroucke JP. 1990. Incidence of skin cancer after renal transplantation in The Netherlands. Transplantation 49:506–509. 10.1097/00007890-199003000-00006. [DOI] [PubMed] [Google Scholar]
- 5.Orth G. 2006. Genetics of epidermodysplasia verruciformis: insights into host defense against papillomaviruses. Semin Immunol 18:362–374. 10.1016/j.smim.2006.07.008. [DOI] [PubMed] [Google Scholar]
- 6.de Jong SJ, Crequer A, Matos I, Hum D, Gunasekharan V, Lorenzo L, Jabot-Hanin F, Imahorn E, Arias AA, Vahidnezhad H, Youssefian L, Markle JG, Patin E, D'Amico A, Wang CQF, Full F, Ensser A, Leisner TM, Parise LV, Bouaziz M, Maya NP, Cadena XR, Saka B, Saeidian AH, Aghazadeh N, Zeinali S, Itin P, Krueger JG, Laimins L, Abel L, Fuchs E, Uitto J, Franco JL, Burger B, Orth G, Jouanguy E, Casanova JL. 2018. The human CIB1-EVER1-EVER2 complex governs keratinocyte-intrinsic immunity to beta-papillomaviruses. J Exp Med 215:2289–2310. 10.1084/jem.20170308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Ramoz N, Rueda LA, Bouadjar B, Montoya LS, Orth G, Favre M. 2002. Mutations in two adjacent novel genes are associated with epidermodysplasia verruciformis. Nat Genet 32:579–581. 10.1038/ng1044. [DOI] [PubMed] [Google Scholar]
- 8.Arroyo Muhr LS, Hultin E, Dillner J. 2021. Transcription of human papillomaviruses in nonmelanoma skin cancers of the immunosuppressed. Int J Cancer 149:1341–1347. 10.1002/ijc.33683. [DOI] [PubMed] [Google Scholar]
- 9.Borgogna C, Landini MM, Lanfredini S, Doorbar J, Bouwes Bavinck JN, Quint KD, de Koning MN, Genders RE, Gariglio M. 2014. Characterization of skin lesions induced by skin-tropic alpha- and beta-papillomaviruses in a patient with epidermodysplasia verruciformis. Br J Dermatol 171:1550–1554. 10.1111/bjd.13156. [DOI] [PubMed] [Google Scholar]
- 10.Borgogna C, Lanfredini S, Peretti A, De Andrea M, Zavattaro E, Colombo E, Quaglia M, Boldorini R, Miglio U, Doorbar J, Bavinck JN, Quint KD, de Koning MN, Landolfo S, Gariglio M. 2014. Improved detection reveals active beta-papillomavirus infection in skin lesions from kidney transplant recipients. Mod Pathol 27:1101–1115. 10.1038/modpathol.2013.240. [DOI] [PubMed] [Google Scholar]
- 11.Borgogna C, Zavattaro E, De Andrea M, Griffin HM, Dell'Oste V, Azzimonti B, Landini MM, Peh WL, Pfister H, Doorbar J, Landolfo S, Gariglio M. 2012. Characterization of beta papillomavirus E4 expression in tumours from epidermodysplasia verruciformis patients and in experimental models. Virology 423:195–204. 10.1016/j.virol.2011.11.029. [DOI] [PubMed] [Google Scholar]
- 12.Weissenborn SJ, Nindl I, Purdie K, Harwood C, Proby C, Breuer J, Majewski S, Pfister H, Wieland U. 2005. Human papillomavirus-DNA loads in actinic keratoses exceed those in non-melanoma skin cancers. J Invest Dermatol 125:93–97. 10.1111/j.0022-202X.2005.23733.x. [DOI] [PubMed] [Google Scholar]
- 13.Caldeira S, Zehbe I, Accardi R, Malanchi I, Dong W, Giarre M, de Villiers EM, Filotico R, Boukamp P, Tommasino M. 2003. The E6 and E7 proteins of the cutaneous human papillomavirus type 38 display transforming properties. J Virol 77:2195–2206. 10.1128/jvi.77.3.2195-2206.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Cornet I, Bouvard V, Campo MS, Thomas M, Banks L, Gissmann L, Lamartine J, Sylla BS, Accardi R, Tommasino M. 2012. Comparative analysis of transforming properties of E6 and E7 from different beta human papillomavirus types. J Virol 86:2366–2370. 10.1128/JVI.06579-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Schmitt A, Harry JB, Rapp B, Wettstein FO, Iftner T. 1994. Comparison of the properties of the E6 and E7 genes of low- and high-risk cutaneous papillomaviruses reveals strongly transforming and high Rb-binding activity for the E7 protein of the low-risk human papillomavirus type 1. J Virol 68:7051–7059. 10.1128/JVI.68.11.7051-7059.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Buitrago-Perez A, Hachimi M, Duenas M, Lloveras B, Santos A, Holguin A, Duarte B, Santiago JL, Akgul B, Rodriguez-Peralto JL, Storey A, Ribas C, Larcher F, del Rio M, Paramio JM, Garcia-Escudero R. 2012. A humanized mouse model of HPV-associated pathology driven by E7 expression. PLoS One 7:e41743. 10.1371/journal.pone.0041743. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Minoni L, Romero-Medina MC, Venuti A, Sirand C, Robitaille A, Altamura G, Le Calvez-Kelm F, Viarisio D, Zanier K, Muller M, Accardi R, Tommasino M. 2020. Transforming properties of beta-3 human papillomavirus E6 and E7 proteins. mSphere 5:e00398-20. 10.1128/mSphere.00398-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Brimer N, Lyons C, Wallberg AE, Vande Pol SB. 2012. Cutaneous papillomavirus E6 oncoproteins associate with MAML1 to repress transactivation and NOTCH signaling. Oncogene 31:4639–4646. 10.1038/onc.2011.589. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Meyers JM, Spangle JM, Munger K. 2013. The human papillomavirus type 8 E6 protein interferes with NOTCH activation during keratinocyte differentiation. J Virol 87:4762–4767. 10.1128/JVI.02527-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Tan MJ, White EA, Sowa ME, Harper JW, Aster JC, Howley PM. 2012. Cutaneous beta-human papillomavirus E6 proteins bind mastermind-like coactivators and repress notch signaling. Proc Natl Acad Sci USA 109:E1473–E1480. 10.1073/pnas.1205991109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Jackson S, Harwood C, Thomas M, Banks L, Storey A. 2000. Role of Bak in UV-induced apoptosis in skin cancer and abrogation by HPV E6 proteins. Genes Dev 14:3065–3073. 10.1101/gad.182100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.O'Shaughnessy RFL, Akgũl B, Storey A, Pfister H, Harwood CA, Byrne C. 2007. Cutaneous human papillomaviruses down-regulate AKT1, whereas AKT2 up-regulation and activation associates with tumors. Cancer Res 67:8207–8215. 10.1158/0008-5472.CAN-07-0755. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Tomlins C, Storey A. 2010. Cutaneous HPV5 E6 causes increased expression of osteoprotegerin and interleukin 6 which contribute to evasion of UV-induced apoptosis. Carcinogenesis 31:2155–2164. 10.1093/carcin/bgq200. [DOI] [PubMed] [Google Scholar]
- 24.Underbrink MP, Howie HL, Bedard KM, Koop JI, Galloway DA. 2008. E6 proteins from multiple human betapapillomavirus types degrade Bak and protect keratinocytes from apoptosis after UVB irradiation. J Virol 82:10408–10417. 10.1128/JVI.00902-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Hu C, Bugbee T, Dacus D, Palinski R, Wallace N. 2022. Beta human papillomavirus 8 E6 allows colocalization of non-homologous end joining and homologous recombination repair factors. PLoS Pathog 18:e1010275. 10.1371/journal.ppat.1010275. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Hu C, Bugbee T, Gamez M, Wallace NA. 2020. Beta human papillomavirus 8E6 attenuates non-homologous end joining by hindering DNA-PKcs activity. Cancers (Basel) 12:2356. 10.3390/cancers12092356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Snow JA, Murthy V, Dacus D, Hu C, Wallace NA. 2019. Beta-HPV 8E6 attenuates ATM and ATR signaling in response to UV damage. Pathogens 8:267. 10.3390/pathogens8040267. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Wallace NA, Robinson K, Howie HL, Galloway DA. 2012. HPV 5 and 8 E6 abrogate ATR activity resulting in increased persistence of UVB induced DNA damage. PLoS Pathog 8:e1002807. 10.1371/journal.ppat.1002807. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Marcuzzi GP, Hufbauer M, Kasper HU, Weißenborn SJ, Smola S, Pfister H. 2009. Spontaneous tumour development in human papillomavirus type 8 E6 transgenic mice and rapid induction by UV-light exposure and wounding. J Gen Virol 90:2855–2864. 10.1099/vir.0.012872-0. [DOI] [PubMed] [Google Scholar]
- 30.Viarisio D, Mueller-Decker K, Kloz U, Aengeneyndt B, Kopp-Schneider A, Grone HJ, Gheit T, Flechtenmacher C, Gissmann L, Tommasino M. 2011. E6 and E7 from beta HPV38 cooperate with ultraviolet light in the development of actinic keratosis-like lesions and squamous cell carcinoma in mice. PLoS Pathog 7:e1002125. 10.1371/journal.ppat.1002125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Viarisio D, Muller-Decker K, Zanna P, Kloz U, Aengeneyndt B, Accardi R, Flechtenmacher C, Gissmann L, Tommasino M. 2016. Novel β-HPV49 transgenic mouse model of upper digestive tract cancer. Cancer Res 76:4216–4225. 10.1158/0008-5472.CAN-16-0370. [DOI] [PubMed] [Google Scholar]
- 32.Viarisio D, Muller-Decker K, Accardi R, Robitaille A, Durst M, Beer K, Jansen L, Flechtenmacher C, Bozza M, Harbottle R, Voegele C, Ardin M, Zavadil J, Caldeira S, Gissmann L, Tommasino M. 2018. Beta HPV38 oncoproteins act with a hit-and-run mechanism in ultraviolet radiation-induced skin carcinogenesis in mice. PLoS Pathog 14:e1006783. 10.1371/journal.ppat.1006783. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Bedard KM, Underbrink MP, Howie HL, Galloway DA. 2008. The E6 oncoproteins from human betapapillomaviruses differentially activate telomerase through an E6AP-dependent mechanism and prolong the lifespan of primary keratinocytes. J Virol 82:3894–3902. 10.1128/JVI.01818-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Muench P, Probst S, Schuetz J, Leiprecht N, Busch M, Wesselborg S, Stubenrauch F, Iftner T. 2010. Cutaneous papillomavirus E6 proteins must interact with p300 and block p53-mediated apoptosis for cellular immortalization and tumorigenesis. Cancer Res 70:6913–6924. 10.1158/0008-5472.CAN-10-1307. [DOI] [PubMed] [Google Scholar]
- 35.Elbel M, Carl S, Spaderna S, Iftner T. 1997. A comparative analysis of the interactions of the E6 proteins from cutaneous and genital papillomaviruses with p53 and E6AP in correlation to their transforming potential. Virology 239:132–149. 10.1006/viro.1997.8860. [DOI] [PubMed] [Google Scholar]
- 36.Steger G, Pfister H. 1992. In vitro expressed HPV 8 E6 protein does not bind p53. Arch Virol 125:355–360. 10.1007/BF01309654. [DOI] [PubMed] [Google Scholar]
- 37.White EA, Kramer RE, Tan MJ, Hayes SD, Harper JW, Howley PM. 2012. Comprehensive analysis of host cellular interactions with human papillomavirus E6 proteins identifies new E6 binding partners and reflects viral diversity. J Virol 86:13174–13186. 10.1128/JVI.02172-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Accardi R, Dong W, Smet A, Cui R, Hautefeuille A, Gabet AS, Sylla BS, Gissmann L, Hainaut P, Tommasino M. 2006. Skin human papillomavirus type 38 alters p53 functions by accumulation of deltaNp73. EMBO Rep 7:334–340. 10.1038/sj.embor.7400615. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Moody CA, Laimins LA. 2010. Human papillomavirus oncoproteins: pathways to transformation. Nat Rev Cancer 10:550–560. 10.1038/nrc2886. [DOI] [PubMed] [Google Scholar]
- 40.Spriggs CC, Laimins LA. 2017. Human papillomavirus and the DNA damage response: exploiting host repair pathways for viral replication. Viruses 9:232. 10.3390/v9080232. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Haller K, Stubenrauch F, Pfister H. 1995. Differentiation-dependent transcription of the epidermodysplasia verruciformis-associated human papillomavirus type 5 in benign lesions. Virology 214:245–255. 10.1006/viro.1995.0028. [DOI] [PubMed] [Google Scholar]
- 42.Iftner T, Sagner G, Pfister H, Wettstein FO. 1990. The E7 protein of human papillomavirus 8 is a nonphosphorylated protein of 17 kDa and can be generated by two different mechanisms. Virology 179:428–436. 10.1016/0042-6822(90)90311-e. [DOI] [PubMed] [Google Scholar]
- 43.Sankovski E, Mannik A, Geimanen J, Ustav E, Ustav M. 2014. Mapping of betapapillomavirus human papillomavirus 5 transcription and characterization of viral-genome replication function. J Virol 88:961–973. 10.1128/JVI.01841-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Stubenrauch F, Malejczyk J, Fuchs PG, Pfister H. 1992. Late promoter of human papillomavirus type 8 and its regulation. J Virol 66:3485–3493. 10.1128/JVI.66.6.3485-3493.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Geimanen J, Isok-Paas H, Pipitch R, Salk K, Laos T, Orav M, Reinson T, Ustav M, Jr, Ustav M, Ustav E. 2011. Development of a cellular assay system to study the genome replication of high- and low-risk mucosal and cutaneous human papillomaviruses. J Virol 85:3315–3329. 10.1128/JVI.01985-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Rehm TM, Straub E, Iftner T, Stubenrauch F. 2022. Restriction of viral gene expression and replication prevents immortalization of human keratinocytes by a beta-human papillomavirus. Proc Natl Acad Sci USA 119:e2118930119. 10.1073/pnas.2118930119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Dreer M, Fertey J, van de Poel S, Straub E, Madlung J, Macek B, Iftner T, Stubenrauch F. 2016. Interaction of NCOR/SMRT repressor complexes with papillomavirus E8^E2C proteins inhibits viral replication. PLoS Pathog 12:e1005556. 10.1371/journal.ppat.1005556. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Lace MJ, Anson JR, Thomas GS, Turek LP, Haugen TH. 2008. The E8^E2 gene product of human papillomavirus type 16 represses early transcription and replication but is dispensable for viral plasmid persistence in keratinocytes. J Virol 82:10841–10853. 10.1128/JVI.01481-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Stubenrauch F, Hummel M, Iftner T, Laimins LA. 2000. The E8^E2C protein, a negative regulator of viral transcription and replication, is required for extrachromosomal maintenance of human papillomavirus type 31 in keratinocytes. J Virol 74:1178–1186. 10.1128/jvi.74.3.1178-1186.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Stubenrauch F, Straub E, Klein K, Kramer D, Iftner T, Wong M, Roden RBS. 2021. Expression of E8^E2 is required for wart formation by mouse papillomavirus 1 in vivo. J Virol 95:e01930-20. 10.1128/JVI.01930-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Meyers C, Frattini MG, Hudson JB, Laimins LA. 1992. Biosynthesis of human papillomavirus from a continuous cell line upon epithelial differentiation. Science 257:971–973. 10.1126/science.1323879. [DOI] [PubMed] [Google Scholar]
- 52.Bienkowska-Haba M, Luszczek W, Myers JE, Keiffer TR, DiGiuseppe S, Polk P, Bodily JM, Scott RS, Sapp M. 2018. A new cell culture model to genetically dissect the complete human papillomavirus life cycle. PLoS Pathog 14:e1006846. 10.1371/journal.ppat.1006846. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Straub E, Dreer M, Fertey J, Iftner T, Stubenrauch F. 2014. The viral E8^E2C repressor limits productive replication of human papillomavirus 16. J Virol 88:937–947. 10.1128/JVI.02296-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Pfefferle R, Marcuzzi GP, Akgul B, Kasper HU, Schulze F, Haase I, Wickenhauser C, Pfister H. 2008. The human papillomavirus type 8 E2 protein induces skin tumors in transgenic mice. J Invest Dermatol 128:2310–2315. 10.1038/jid.2008.73. [DOI] [PubMed] [Google Scholar]
- 55.Warburton A, Markowitz TE, Katz JP, Pipas JM, McBride AA. 2021. Recurrent integration of human papillomavirus genomes at transcriptional regulatory hubs. NPJ Genom Med 6:101. 10.1038/s41525-021-00264-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Baker CC, Howley PM. 1987. Differential promoter utilization by the bovine papillomavirus in transformed cells and productively infected wart tissues. EMBO J 6:1027–1035. 10.1002/j.1460-2075.1987.tb04855.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Wettstein FO, Barbosa MS, Nasseri M. 1987. Identification of the major cottontail rabbit papillomavirus late RNA cap site and mapping and quantitation of an E2 and minor E6 coding mRNA in papillomas and carcinomas. Virology 159:321–328. 10.1016/0042-6822(87)90470-3. [DOI] [PubMed] [Google Scholar]
- 58.Xue XY, Majerciak V, Uberoi A, Kim BH, Gotte D, Chen X, Cam M, Lambert PF, Zheng ZM. 2017. The full transcription map of mouse papillomavirus type 1 (MmuPV1) in mouse wart tissues. PLoS Pathog 13:e1006715. 10.1371/journal.ppat.1006715. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Fuchs PG, Iftner T, Weninger J, Pfister H. 1986. Epidermodysplasia verruciformis-associated human papillomavirus 8: genomic sequence and comparative analysis. J Virol 58:626–634. 10.1128/JVI.58.2.626-634.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Scheurlen W, Gissmann L, Gross G, Zur Hausen H. 1986. Molecular cloning of two new HPV types (HPV 37 and HPV 38) from a keratoacanthoma and a malignant melanoma. Int J Cancer 37:505–510. 10.1002/ijc.2910370406. [DOI] [PubMed] [Google Scholar]





