Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Jan 1.
Published in final edited form as: Methods Mol Biol. 2022;2416:91–104. doi: 10.1007/978-1-0716-1908-7_7

Generating Trophoblast Stem Cells from Human Naïve Pluripotent Stem Cells

Chen Dong 1,2, Thorold W Theunissen 1,2,#
PMCID: PMC9749490  NIHMSID: NIHMS1852923  PMID: 34870832

Abstract

The placenta is a transient organ that mediates the exchange of nutrients, gases, and waste products between the mother and the developing fetus and is indispensable for a healthy pregnancy. Epithelial cells in the placenta, which are termed trophoblasts, originate from the trophectoderm (TE) compartment of the blastocyst. The human trophoblast lineage consists of several distinct cell types, including the self-renewing and bipotent cytotrophoblast and the terminally differentiated extravillous trophoblast and syncytiotrophoblast. Despite the importance of trophoblast research, it has long been hindered by the scarce accessibility of primary tissue and the lack of a robust in vitro model system. Recently, a culture condition was developed that supports the isolation of bona fide human trophoblast stem cells (hTSCs) from human blastocysts or first-trimester placental tissues. In this chapter, we describe a protocol to derive bona fide hTSCs from naïve human pluripotent stem cells (hPSCs), thus presenting a robust methodology to generate hTSCs from a renewable and widely accessible source. This approach may be used to generate patient-specific hTSCs to study trophoblast-associated pathologies and serves as a powerful experimental platform to study the specification of human TE.

Keywords: Human trophoblast stem cells, naïve human pluripotent stem cells, extravillous trophoblast, syncytiotrophoblast, transgene-free, validation

1. Introduction

During mammalian early embryogenesis, the totipotent morula undergoes a series of cell fate decisions that segregates into three separate embryonic and extraembryonic compartments, namely the epiblast (EPI), primitive endoderm (PE), and trophectoderm (TE) [1,2]. While the EPI and PE will go on to form the embryo proper and yolk sac, respectively, cells derived from the TE compartment, termed trophoblast, will eventually form the placenta [2,1,3,4]. The human trophoblast lineage includes several cell types. Initially, the self-renewing and bipotent villous cytotrophoblast (CTB), which are thought to be the source of human trophoblast stem cells (hTSCs), are formed from within the TE compartment [1,5,4]. hTSCs can then be terminally differentiated into either the syncytiotrophoblast (STB) or extravillous trophoblast (EVT) [4,1,5]. Trophoblast, and ultimately the placenta, perform a variety of critical functions during pregnancy. One such function is to mediate the implantation of the blastocyst into the endometrium [4,3]. This process is critical for successful pregnancy since most early pregnancy losses are a result of implantation failure [6]. Another crucial function of the placenta is to facilitate the maternal-fetal exchange of nutrients, gases, and waste products, which is fulfilled by the STBs [3]. Following implantation, the EVTs will further invade the decidua, remodel the spiral arteries, and interact with uterine natural killer (NK) cells [7,3,8]. Multiple pathologies including miscarriage, pre-eclampsia, and intrauterine growth restrictions are thought to be caused by deficient trophoblast development and function [9,10].

Despite its importance, our current understanding of human trophoblast development is limited, partially due to the lack of an adequate in vitro model system. Ethical concerns make it difficult to study human trophoblast in vivo, and since there are numerous reported differences between mouse and human placental development [4,1,11,12], the mouse embryo is also not an ideal model system. Therefore, the best available option is to study human trophoblast cells derived or generated in vitro. Recently, Okae and colleagues devised a novel culture condition that allows for the derivation and stable maintenance of bona fide hTSCs from human blastocysts or CTBs isolated from first-trimester placenta [13]. The hTSCs cultured under these conditions can also undergo directed differentiation into specialized EVTs and STBs [13]. However, since this method requires donated embryos or placenta from elective terminations, it does not constitute a widely accessible source of hTSCs. Additionally, it does not allow for the generation of patient-specific hTSCs to study pregnancy-associated pathologies.

To improve the existing methodology of generating hTSCs, a novel source of hTSCs that is renewable, accessible, and amenable to genetic manipulation is required. We recently explored the suitability of naïve human pluripotent stem cells (hPSCs) as a source of hTSCs [14]. It is well-established that mammalian pluripotency comprises several distinct states, including the naïve state that corresponds to a pre-implantation identity and the primed state that corresponds to a late post-implantation identity [15]. Naïve hPSCs can be isolated under stringent culture conditions that display general and specific features of pluripotent cells in the human pre-implantation embryo [16,17]. Although mouse embryonic stem cells (mESCs) require transgene expression to be reprogrammed into trophoblast stem cell-like cells [18–21], numerous lines of evidence suggested that naïve hPSCs may harbor enhanced trophoblast potential [22]. For example, naïve hPSCs express much higher levels of trophoblast marker genes than primed hPSCs [23] and have a chromatin accessibility landscape with high resemblance to first trimester human placenta tissue [24], indicating that naïve hPSCs may have both transcriptional and epigenetic predisposition towards the trophoblast lineage. In addition, the TE, EPI, and PE lineage markers were found to undergo a brief period of co-expression in the late morula and early blastocyst stage of human embryogenesis, suggesting a model of concurrent lineage segregation distinct from that of mouse [25]. Since naïve hPSCs correspond to this same developmental period based on expression of transposable elements [23], they may be competent for both embryonic and extraembryonic differentiation. Indeed, we recently showed that when cultured in hTSC medium [13], naïve hPSCs can readily give rise to bona fide hTSCs (hTSCs derived from naïve hPSCs are termed “naïve hTSCs”), the identity of which was confirmed by morphological, molecular, transcriptomic, and epigenomic data [14] The enhanced potential of naïve hPSC for differentiation into hTSCs was recently corroborated by an independent study [26].

In this chapter, we describe a detailed protocol for the transgene-free derivation of hTSCs from naïve hPSCs (Figure 1A–C), their directed differentiation into the EVT and STB lineages (Figure 2A, B, E, F), and the validation of the identities of these distinct trophoblast cell types (Figure 1D, E, 2C, D, G, H).

Figure 1. Derivation and validation of naïve hTSCs.

Figure 1.

This figure is partially adapted from Dong et al. [14].

A. The experimental scheme for deriving naïve hTSCs from naïve hPSCs.

B. Phase contrast image of naïve hPSCs derived from primed H9 hPSCs in 5i/L/A media. The scale bars indicate 75 μm.

C. Phase contrast images of naïve hTSCs during the derivation process at passage 0, 1, and 6. The scale bars indicate 75 μm.

D. Flow cytometry analysis for trophoblast markers ITGA6 and EGFR in naïve hPSCs and naïve hTSCs.

E. Quantitative gene expression analysis for trophoblast marker genes ELF5, GATA3, and KRT7 in naïve hPSCs and naïve hTSCs. Error bars indicate ± 1 SD of technical replicates. “***” indicates a p-value <0.001.

Figure 2. Directed differentiation and validation of naïve hTSC-derived EVTs and STBs.

Figure 2.

This figure is partially adapted from Dong et al. [14].

A. The experimental scheme for deriving EVTs from naïve hTSCs.

B. Phase contrast image of EVTs derived from naïve hTSCs. The scale bars indicate 75 μm.

C. Flow cytometry analysis for EVT marker HLA-G in H9 and AN naïve hTSCs and EVTs.

D. Quantitative gene expression analysis for EVT marker genes MMP2 and HLA-G in H9 and AN naïve hTSCs and EVTs. Error bars indicate ± 1 SD of technical replicates. “***” indicates a p-value <0.001.

E. The experimental scheme for deriving STBs from naïve hTSCs.

F. Phase contrast image of STBs derived naïve hTSCs. The scale bars indicate 75 μm.

G. Quantitative gene expression analysis for STB marker genes CGB and SDC1 in H9 and AN naïve hTSCs and STBs. Error bars indicate ± 1 SD of technical replicates. “*” indicates a p-value <0.05; “**” indicates a p-value <0.01.

H. Immunofluorescence staining for STB markers hCG and SDC1 in naïve hTSC-derived STBs. The scale bars indicate 75 μm.

2. Materials

2.1. hTSC derivation and maintenance

  1. Fibroblast medium: supplement DMEM with 10 % FBS, 2 mM GlutaMAX, and 1 % penicillin-streptomycin. It can be stored at 4 °C for up to 4 weeks.

  2. hTSC medium: supplement DMEM/F12 with 0.1 mM 2-mercaptoethanol, 0.2 % FBS, 0.5 % penicillin-streptomycin, 0.3 % BSA, 1 % ITS-X, 1.5 μg/mL L-ascorbic acid, 50 ng/mL EGF, 2 μM CHIR99021, 0.5 μM A83-01, 1 μM SB431542, 0.8 mM VPA, and 5 μM Y-27632. It can be stored at 4 °C for up to 2 weeks.

  3. Collagen IV, stock concentration at 1 mg/mL.

  4. Dulbecco’s phosphate buffered saline (DPBS)

  5. Trypan blue

  6. TrypLE Express

2.2. EVT differentiation

  1. EVT basal medium: supplement DMEM/F12 with 0.1 mM 2-mercaptoethanol, 0.5 % penicillin-streptomycin, 0.3 % BSA, 1 % ITS-X, 7.5 μM A83-01, and 2.5 μM Y-27632. 0.5 % Matrigel should also be added immediately before feeding. It can be stored at 4 °C for up to 2 weeks.

  2. EVT day 0 medium: supplement EVT basal medium with 4 % KSR and 100 ng/mL NRG1. 2 % Matrigel should also be added immediately before feeding. It can be stored at 4 °C for up to 2 weeks.

  3. EVT day 3 medium: supplement EVT basal medium 4 % KSR. 2 % Matrigel should also be added immediately before feeding. It can be stored at 4 °C for up to 2 weeks.

2.3. STB differentiation

  1. 3D STB medium: supplement DMEM/F12 with 0.1 mM 2-mercaptoethanol, 0.5 % penicillin-streptomycin, 0.3 % BSA, 1 % ITS-X, 50 ng/mL EGF, 2.5 μM Y-27632, 2 μM Forskolin, and 4 % KSR. It can be stored at 4 °C for up to 2 weeks.

2.4. Characterization of cellular identity

  1. FACS buffer: supplement DPBS with 5 % FBS.

  2. Permeabilization buffer: supplement DPBS with 0.1 % Triton X-100.

  3. Blocking buffer: supplement DPBS with 0.1 % Triton X-100 and 0.5 % BSA.

  4. BD LSRFortessa X-20 (BD Biosciences)

  5. Plus-charged slides

  6. PAP pen

  7. FlowJo software package

  8. 20 % paraformaldehyde

  9. anti-ITG6-FITC antibody

  10. anti-EGFR-APC antibody

  11. anti-HLA-G-PE antibody

  12. mouse-anti-hCG antibody

  13. mouse-anti-SDC1 antibody

  14. anti-mouse-Alexa 488 antibody

  15. Hoechst 33258

  16. E.Z.N.A. total RNA kit I

  17. High capacity cDNA reverse transcription kit

  18. PowerUp SYBR green master mix

  19. StepOnePlus Real-Time PCR System (Applied Biosystems)

  20. Primer sequences: RPLP0-F, GCTTCCTGGAGGGTGTCC; RPLP0-R, GGACTCGTTTGTACCCGTTG; ELF5-F, AGTCTGCACTGACATTTTCTCATC; ELF5-R, CAGAAGTCCTAGGGGCAGTC; KRT7-F, AGGATGTGGATGCTGCCTAC; KRT7-R, CACCACAGATGTGTCGGAGA; GATA3-F, TGCAGGAGCAGTATCATGAAGCCT; GATA3-R, GCATCAAACAACTGTGGCCAGTGA; MMP2-F, TGGCACCCATTTACACCTACAC; MMP2-R, ATGTCAGGAGAGGCCCCATAGA; HLA-G-F, CAGATACCTGGAGAACGGGA; HLA-G-R, CAGTATGATCTCCGCAGGGT; CGB-F, ACCCTGGCTGTGGAGAAGG; CGB-R, ATGGACTCGAAGCGCACA; SDC1-F, GCTGACCTTCACACTCCCCA; SDC1-R, CAAAGGTGAAGTCCTGCTCCC

3. Methods

Unless otherwise specified, perform all experiments at room temperature and all cell culture procedures in a sterile laminar flow hood. Warm all cell culture media to room temperature before use.

3.1. Deriving hTSCs from naïve hPSCs

  1. Coat cell culture plates with 5 μg/mL Collagen IV in DPBS at 37 °C for at least 3 hours. Coated plates can be sealed with parafilm and stored at 4 °C for at least 1 to 2 weeks.

  2. Aspirate cell culture media from a confluent well of naïve hPSCs cultured in 5i/L/A or PXGL media (see Notes 1, 2, 3, 4) (Figure 1B).

  3. Add 1 mL TrypLE Express per well of a 6-well plate and incubate at 37 °C for 5 min.

  4. Completely single-cell dissociate the naïve hPSCs by pipetting up and down, then transfer the cells to a 15 mL Falcon tube with 5 mL fibroblast medium.

  5. Centrifuge the cells at 250 x g for 3 min.

  6. Aspirate the media.

  7. Resuspend the cell pellet in 1 mL hTSC medium.

  8. Count the number of naïve hPSCs (see Note 5).

  9. Seed 0.5-1.0 X 106 naïve hPSCs per Collagen IV coated well of a 6-well plate. Each well should eventually contain 2 mL hTSC medium. Culture the cells in 5 % CO2 and 20 % O2.

  10. Replace media every 2 days with 2 mL fresh hTSC medium until the cells reach 80-100 % confluence (see Note 6).

  11. At this point, passage the cells by first aspirating cell culture media from the well.

  12. Add 1 mL TrypLE Express per well of a 6-well plate and incubate at 37 °C for 5 min (see Note 7).

  13. Completely single-cell dissociate the cells by pipetting up and down, then transfer the cells to a 15 mL Falcon tube with 5 mL fibroblast medium.

  14. Centrifuge the cells at 250 x g for 3 min.

  15. Aspirate the media.

  16. Resuspend the cell pellet in hTSC medium and passage the cells at a ratio of 1:2. Each well should eventually contain 2 mL hTSC medium. Culture the cells in 5 % CO2 and 20 % O2.

  17. Repeat steps 10-16. It takes 5-10 passages for highly proliferative naïve hTSCs to become homogeneous in the culture (see Note 8) (Figure 1C).

  18. At this point, naïve hTSCs can be passaged every 3 days at a ratio of 1:4.

3.2. Validating naïve hTSC identity by flow cytometry

  1. Aspirate cell culture media from an ~80 % confluent well of naïve hTSCs and a confluent well of naïve hPSCs

  2. Add 1 mL TrypLE Express per well of a 6-well plate and incubate at 37 °C for 5 min.

  3. Completely single-cell dissociate the cells by pipetting up and down, then transfer the cells to a 15 mL Falcon tube with 5 mL fibroblast medium.

  4. Centrifuge the cells at 250 x g for 3 min.

  5. Aspirate the media.

  6. Resuspend each cell pellet in 1 mL cold FACS buffer by pipetting up and down.

  7. Centrifuge the cells at 250 x g for 3 min at 4 °C.

  8. Aspirate the FACS buffer.

  9. Resuspend each cell pellet in 100 μL cold FACS buffer.

  10. Add 1 μL anti-ITGA6-FITC and 5 μL anti-EGFR-APC antibody per tube (see Note 9). Mix well by flicking the tubes.

  11. Incubate on ice and in the dark for 30 min.

  12. Following incubation, wash the cells by adding 1 mL cold FACS buffer per tube.

  13. Centrifuge the cells at 250 x g for 3 min at 4 °C.

  14. Aspirate the FACS buffer.

  15. Resuspend each cell pellet in 300-500 μL cold FACS buffer and pass through a cell strainer.

  16. Collect the data using a BD LSRFortessa X-20 and analyze the results via FlowJo (see Note 10).

  17. Cultures of good quality naïve hTSCs should contain at least 80 % of ITGA6 and EGFR double positive cells relative to naïve hPSCs. For cells at passage 10 or beyond, double positive population should be able to reach 95 % (Figure 1D).

3.3. Validating naïve hTSC identity by qRT-PCR

  1. Aspirate cell culture media from an ~80 % confluent well of naïve hTSCs and a confluent well of naïve hPSCs.

  2. Add 1 mL TrypLE Express per well of a 6-well plate and incubate at 37 °C for 5 min.

  3. Completely single-cell dissociate the cells by pipetting up and down, then transfer the cells to a 15 mL Falcon tube with 5 mL fibroblast medium.

  4. Centrifuge the cells at 250 x g for 3 min.

  5. Aspirate the media.

  6. Immediately isolate total RNA from the cells using the E.Z.N.A. total RNA kit I (see Note 11), or flash freeze the cell pellets in liquid nitrogen and store at −80 °C to isolate the RNA at a later time. The RNA should be stored at −80 °C.

  7. Perform cDNA synthesis from the isolated total RNA using the high capacity cDNA reverse transcription kit (see Note 11). The cDNA should be stored in −20 °C.

  8. Perform qRT-PCR using the PowerUp SYBR green master mix on the StepOnePlus Real-Time PCR System on cDNA samples from naïve hPSC and naïve hTSC (see Note 11). RPLP0 is used as the housekeeping control. ELF5, KRT7, and GATA3 are used as trophoblast markers.

  9. ELF5 expression should be at least ~8 times higher in naïve hTSCs than in naïve hPSCs; KRT7 expression should be at least ~15 times higher in naïve hTSCs than in naïve hPSCs; GATA3 expression should be at least ~5 times higher in naïve hTSCs than in naïve hPSCs (Figure 1E).

3.4. Directed differentiation of EVT from naïve hTSCs

  1. Coat cell culture plates with 1 μg/mL Collagen IV in DPBS at 37 °C for at least 3 hours. Coated plates can be sealed with parafilm and stored at 4 °C for at least 1 to 2 weeks.

  2. Aspirate cell culture media from an ~80% confluent well of naïve hTSCs.

  3. Add 1 mL TrypLE Express per well of a 6-well plate and incubate at 37 °C for 5 min.

  4. Completely single-cell dissociate the cells by pipetting up and down, then transfer the cells to 5 mL fibroblast medium.

  5. Centrifuge the cells at 250 x g for 3 min.

  6. Aspirate the media.

  7. Resuspend the cell pellet in 1 mL EVT day 0 medium.

  8. Count the number of naïve hTSCs (see Note 5).

  9. Seed 0.75 X 105 naïve hTSCs per Collagen IV coated well of a 6-well plate. Each well should eventually contain 2 mL EVT day 0 medium. Culture the cells in 5 % CO2 and 20 % O2. This time point is referred to as day 0.

  10. On day 3, aspirate all EVT day 0 medium, and add 2 mL EVT day 3 medium per well (see Note 12).

  11. On day 6, aspirate all EVT day 3 medium, and add 2 mL EVT basal medium per well (see Note 12).

  12. On day 8, the cells are designated as terminally differentiated EVTs and are ready for downstream analysis (see Note 12) (Figure 2B).

3.5. Validating naïve hTSC-derived EVT identity by flow cytometry

  1. Aspirate cell culture media from a well of day 8 EVTs and an ~80 % confluent well of naïve hTSCs

  2. Carry out the flow cytometry analysis as described above in section 3.2, steps 2-9.

  3. Add 1 μL anti-HLA-G-PE antibody per tube (see Note 13). Mix well by flicking the tubes.

  4. Carry out the experiment as described above in section 3.2, steps 11-16.

  5. Cultures of good quality EVT should contain at least 80 % of HLA-G positive population relative to naïve hTSCs (Figure 2C).

3.6. Validating naïve hTSC-derived EVT identity by qRT-PCR

  1. Aspirate cell culture media from a well of day 8 EVTs and an ~80 % confluent well of naïve hTSCs.

  2. Carry out the RNA isolation and cDNA synthesis as described above in section 3.3, steps 2-7.

  3. Perform qRT-PCR using the PowerUp SYBR green master mix on the StepOnePlus Real-Time PCR System on cDNA samples from EVTs and naïve hTSCs (see Note 11). RPLP0 is used as the housekeeping control. HLA-G and MMP2 are used as trophoblast markers.

  4. HLA-G expression should be at least ~30 times higher in EVTs than in naïve hTSCs; MMP2 expression should be at least ~600 times higher in EVTs than in naïve hTSCs (Figure 2D).

3.7. Directed differentiation of STB from naïve hTSCs

  1. Harvest and count naïve hTSCs as described above in section 3.4, steps 2-8.

  2. Seed 2.5 X 105 naïve hTSCs per well of an ultra-low attachment 6-well plate. Each well should eventually contain 3 mL 3D STB medium. Culture the cells in 5 % CO2 and 20 % O2. This time point is referred to as day 0 (see Note 14).

  3. On day 3, add another 3 mL of 3D STB medium per well on top of the old media (see Note 14).

  4. On day 6, pass the entire culture through a 40 μm cell strainer. The cells remaining on the strainer are ready for downstream analysis (see Notes 14, 15) (Figure 2F).

3.8. Validating naïve hTSC-derived STB identity by qRT-PCR

  1. Carry out the RNA isolation and cDNA synthesis as described above in section 3.3 steps 6-7.

  2. Perform qRT-PCR using the PowerUp SYBR green master mix on the StepOnePlus Real-Time PCR System on cDNA samples from STBs and naïve hTSCs (see Note 11). RPLP0 is used as the housekeeping control. CGB and SDC1 are used as trophoblast markers.

  3. CGB expression should be at least ~15 times higher in STBs than in naïve hTSCs; SDC1 expression should be at least ~3 times higher in STBs than in naïve hTSCs (Figure 2G).

3.9. Validating naïve hTSC-derived STB identity by immunofluorescence

  1. Collect terminally differentiated STBs as described above in section 3.7, step 4.

  2. Add 1 mL 4 % paraformaldehyde in DPBS to fix the STBs for 20 min on a nutator (see Note 16).

  3. Let the STBs sediment, aspirate the 4 % paraformaldehyde, then add 1 mL DPBS to wash for 5 min on a nutator.

  4. Repeat the DPBS wash 2 more times.

  5. Let the STBs sediment, aspirate the DPBS, then resuspend the STBs in ~100 μL DPBS and seed on plus-charged slides. Circle the STBs with a PAP pen.

  6. Allow the DPBS to air dry overnight.

  7. Permeabilize the STBs by pipetting 100 μL 0.1 % Triton X-100 in DPBS onto the circle on the slide for 5 min on a nutator. Aspirate the buffer.

  8. Block the STBs with 100 μL blocking buffer for 1 hour on a nutator. Aspirate the buffer.

  9. Incubate the STBs with 100 μL blocking buffer supplemented with one of the following primary antibodies overnight at 4 °C on a nutator: mouse-anti-SDC1, 1:100; mouse-anti-hCG, 1:100 (see Note 17).

  10. Aspirate the buffer, and wash the STBs with 100 μL DPBS for 5 min on a nutator.

  11. Repeat the DBPS wash 2 more times.

  12. Incubate the STBs with 100 μL blocking buffer supplemented with 0.2 μL anti-mouse-Alexa 488 secondary antibody (diluted 1:500) for 1 hour on a nutator.

  13. Aspirate the buffer, and wash the STBs with 100 μL DPBS for 15 min on a nutator.

  14. Aspirate the buffer, and wash the STBs with 100 μL DPBS supplemented with 0.1 μL Hoechst 33258 (1:1000) for 15 min on a nutator.

  15. Aspirate the buffer, and wash the STBs with 100 μL DPBS for 15 min on a nutator.

  16. Aspirate the buffer, and mount the STBs in 100 μL mounting medium under a coverslip.

  17. Image the STBs with a Leica DMi-8 fluorescence microscope. Successfully differentiated STBs should show clear expression of CGB and SDC1 at levels well above the background (Figure 2).

Acknowledgements

Work in our laboratory is supported by the NIH Director’s New Innovator Award (DP2 GM137418) and grants from the Shipley Foundation Program for Innovation in Stem Cell Science, the Edward Mallinckrodt, Jr. Foundation, and the Washington University Children’s Discovery Institute. No federal NIH/NIGMS funds are used to develop 3D models of early human development. We thank Dr. Rowan Karvas for proofreading the manuscript.

4. Notes

1.

For a detailed protocol on naïve hPSC induction and maintenance in 5i/L/A media, please refer to Chapter 2 in this book.

2.

Most of our hTSC differentiation experiments were performed using naïve cells derived and maintained in 5i/L/A [16], but we have also been able to derive hTSCs from naïve hPSCs maintained in the alternative media formulation PXGL [27].

3.

It is recommended that naïve hPSCs within 10 passages be used for hTSC differentiation to reduce the possibility of the cells acquiring karyotypic abnormalities as a result of prolonged culture in naïve media.

4.

In our experience the most ideal stage to harvest naïve hPSCs is when they reach ~80% confluence. That is usually ~6 to 8 days after passage.

5.

Any cell counter/hemocytometer will be sufficient for this step. We prefer to exclude dead cells using trypan blue.

6.

The cells will maintain round, naïve-like morphology for the first ~3 days in hTSC medium, but will then adopt a flatter, cobblestone-like morphology. It takes approximately one week for the cells to reach 80-100 % confluence.

7.

We found that TrypLE Express is the best dissociation reagent for hTSCs. Other dissociation reagents such as Accutase will result in low viability after passaging.

8.

For the first ~3 passages, the cells will grow slowly and appear flat. This is normal and not a cause for concern. Highly proliferative hTSC-like cells will then emerge and become homogeneous within the next several passages.

9.

We chose to analyze the expression of ITGA6 and EGFR, two known hTSC surface markers [14]. Researchers may choose to use other published hTSC markers instead.

10.

Most flow cytometry cell analyzer and analyzing software can be used for this step.

11.

Most commercial total RNA isolation and cDNA reverse transcription kits and qRT-PCR systems will work for this step.

12.

For the first 2-3 days of EVT differentiation, the cells will remain sparse and have a round morphology. Starting around day 3, a more mesenchyme-like morphology can be observed. By the end of the differentiation process, there should be long and needle-like processes protruding from most of the cells.

13.

We choose to analyze the expression of HLA-G, a known EVT surface marker [14]. Researchers may choose to use other published EVT markers instead.

14.

For the first ~2 days of STB differentiation, majority of the cells will remain single.

15.

In our experience, instead of using a cell strainer, the 3D STBs can also be collected following gravity sedimentation for ~5 min.

16.

For the procedures outlined in Section 3.9, PBS could be used in place of DPBS.

17.

A no primary antibody control sample should also be included in this step.

References

  • 1.Shahbazi MN, Zernicka-Goetz M (2018) Deconstructing and reconstructing the mouse and human early embryo. Nature Cell Biology 20 (8):878–887. doi: 10.1038/s41556-018-0144-x [DOI] [PubMed] [Google Scholar]
  • 2.Piliszek A, Grabarek JB, Frankenberg SR et al. (2016) Cell fate in animal and human blastocysts and the determination of viability. Molecular Human Reproduction 22 (10):681–690. doi: 10.1093/molehr/gaw002 [DOI] [PubMed] [Google Scholar]
  • 3.Burton GJ, Fowden AL (2015) The placenta: a multifaceted, transient organ. Philosophical Transactions of the Royal Society B: Biological Sciences 370 (1663):20140066. doi: 10.1098/rstb.2014.0066 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.James JL, Carter AM, Chamley LW (2012) Human placentation from nidation to 5 weeks of gestation. Part I: What do we know about formative placental development following implantation? Placenta 33 (5):327–334. doi: 10.1016/j.placenta.2012.01.020 [DOI] [PubMed] [Google Scholar]
  • 5.Roberts RM, Fisher SJ (2011) Trophoblast Stem Cells1. Biology of Reproduction 84 (3):412–421. doi: 10.1095/biolreprod.110.088724 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Koot YE, Teklenburg G, Salker MS et al. (2012) Molecular aspects of implantation failure. Biochimica et biophysica acta 1822 (12):1943–1950. doi: 10.1016/j.bbadis.2012.05.017 [DOI] [PubMed] [Google Scholar]
  • 7.Burton GJ, Woods AW, Jauniaux E et al. (2009) Rheological and physiological consequences of conversion of the maternal spiral arteries for uteroplacental blood flow during human pregnancy. Placenta 30 (6):473–482. doi: 10.1016/j.placenta.2009.02.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Vento-Tormo R, Efremova M, Botting RA et al. (2018) Single-cell reconstruction of the early maternal-fetal interface in humans. Nature 563 (7731):347–353. doi: 10.1038/s41586-018-0698-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Norwitz ER (2006) Defective implantation and placentation: laying the blueprint for pregnancy complications. Reproductive BioMedicine Online 13 (4):591–599. doi: 10.1016/S1472-6483(10)60649-9 [DOI] [PubMed] [Google Scholar]
  • 10.Moffett A, Loke C (2006) Immunology of placentation in eutherian mammals. Nature Reviews Immunology 6 (8):584–594. doi: 10.1038/nri1897 [DOI] [PubMed] [Google Scholar]
  • 11.Niakan KK, Eggan K (2013) Analysis of human embryos from zygote to blastocyst reveals distinct gene expression patterns relative to the mouse. Developmental biology 375 (1):54–64. doi: 10.1016/j.ydbio.2012.12.008 [DOI] [PubMed] [Google Scholar]
  • 12.Gerri C, McCarthy A, Alanis-Lobato G et al. (2020) Initiation of a conserved trophectoderm program in human, cow and mouse embryos. Nature. doi: 10.1038/s41586-020-2759-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Okae H, Toh H, Sato T et al. (2018) Derivation of Human Trophoblast Stem Cells. Cell stem cell 22 (1):50–63.e56. doi: 10.1016/j.stem.2017.11.004 [DOI] [PubMed] [Google Scholar]
  • 14.Dong C, Beltcheva M, Gontarz P et al. (2020) Derivation of trophoblast stem cells from naive human pluripotent stem cells. Elife 9. doi: 10.7554/eLife.52504 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Nichols J, Smith A (2009) Naive and Primed Pluripotent States. Cell stem cell 4 (6):487–492. doi: 10.1016/j.stem.2009.05.015 [DOI] [PubMed] [Google Scholar]
  • 16.Theunissen TW, Powell BE, Wang H et al. (2014) Systematic Identification of Culture Conditions for Induction and Maintenance of Naive Human Pluripotency. Cell stem cell 15 (4):471–487. doi: 10.1016/j.stem.2014.07.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Takashima Y, Guo G, Loos R et al. (2014) Resetting transcription factor control circuitry toward ground-state pluripotency in human. Cell 158 (6):1254–1269. doi: 10.1016/j.cell.2014.08.029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Niwa H, Toyooka Y, Shimosato D et al. (2005) Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell 123 (5):917–929. doi: 10.1016/j.cell.2005.08.040 [DOI] [PubMed] [Google Scholar]
  • 19.Kuckenberg P, Buhl S, Woynecki T et al. (2010) The transcription factor TCFAP2C/AP-2gamma cooperates with CDX2 to maintain trophectoderm formation. Molecular and cellular biology 30 (13):3310–3320. doi: 10.1128/mcb.01215-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Cambuli F, Murray A, Dean W et al. (2014) Epigenetic memory of the first cell fate decision prevents complete ES cell reprogramming into trophoblast. Nat Commun 5:5538. doi: 10.1038/ncomms6538 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Blij S, Parenti A, Tabatabai-Yazdi N et al. (2015) Cdx2 efficiently induces trophoblast stem-like cells in naive, but not primed, pluripotent stem cells. Stem cells and development 24 (11):1352–1365. doi: 10.1089/scd.2014.0395 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Dong C, Fischer L, Theunissen TW (2019) Recent insights into the naïve state of human pluripotency and its applications. Experimental Cell Research:111645. doi: 10.1016/j.yexcr.2019.111645 [DOI] [PubMed] [Google Scholar]
  • 23.Theunissen TW, Friedli M, He Y et al. (2016) Molecular Criteria for Defining the Naive Human Pluripotent State. Cell stem cell 19 (4):502–515. doi: 10.1016/j.stem.2016.06.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Pontis J, Planet E, Offner S et al. (2019) Hominoid-Specific Transposable Elements and KZFPs Facilitate Human Embryonic Genome Activation and Control Transcription in Naive Human ESCs. Cell Stem Cell 24 (5):724–735 e725. doi: 10.1016/j.stem.2019.03.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Petropoulos S, Edsgard D, Reinius B et al. (2016) Single-Cell RNA-Seq Reveals Lineage and X Chromosome Dynamics in Human Preimplantation Embryos. Cell 165 (4):1012–1026. doi: 10.1016/j.cell.2016.03.023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Cinkornpumin JK, Kwon SY, Guo Y et al. (2020) Naive Human Embryonic Stem Cells Can Give Rise to Cells with a Trophoblast-like Transcriptome and Methylome. Stem Cell Reports 15 (1):198–213. doi: 10.1016/j.stemcr.2020.06.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bredenkamp N, Stirparo GG, Nichols J et al. (2019) The Cell-Surface Marker Sushi Containing Domain 2 Facilitates Establishment of Human Naive Pluripotent Stem Cells. Stem cell reports. doi: 10.1016/j.stemcr.2019.03.014 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES