ABSTRACT
Two complete and three partial genome sequences of grapevine red globe virus (GRGV) from grapevines (Vitis spp.) in Japan were determined.
ANNOUNCEMENT
Grapevine red globe virus (GRGV) is a tentative member of the genus Maculavirus (family Tymoviridae) and has a genome consisting of approximately 6,850 nucleotides (nt) of single-stranded positive-sense RNA. GRGV has been reported from at least 14 countries and reported to cause no obvious symptoms on grapevines (Vitis spp.) (1–5). Fourteen complete genomes of GRGV have been reported since 2017 (6), but none from Asia. Here, we report the complete genome sequences of GRGV in Japan.
To verify whether commercial grapevine nursery stocks in Japan were infected with GRGV, total RNA was extracted from petioles of 32 stocks as described by Iandolino et al. (7) using 3-mercapto-1,2-propanediol instead of 2-mercaptoethanol and treated with DNase I (Nippon Gene, Japan). Then, reverse transcription-PCR (RT-PCR) was performed with the GRGV-specific primer pair RG6061F and RG6801R (6) using the SuperScript III one-step RT-PCR system (Invitrogen, USA), revealing five GRGV-infected stocks: one Pinot Noir (JP-PN), one Chardonnay (JP-Ch), and three Yama Sauvignon (JP-YS1 to -YS3). Pinot Noir, which was also infected by grapevine leafroll-associated virus 3 (GLRaV-3), grapevine rupestris stem pitting-associated virus, and grapevine fanleaf virus (data not shown), presented a reddish-purple interveinal area and downward rolling of leaves presumably caused by GLRaV-3 (8). Other nursery stocks presented no obvious symptoms.
GRGV genomes were amplified by RT-PCR, using the primer pairs described in Table 1, except for the 5′ ends, which were amplified as described previously (9), and the 3′ ends, which were amplified using LA Taq (TaKaRa, Japan) with GRGV-6678F and GRadaptor-R (Table 1) after reverse transcription with avian myeloblastosis virus (AMV) RTase (Nippon Gene) with the GeneRacer oligo(dT) primer (Invitrogen). The amplicons were directly Sanger sequenced and assembled using ATGC v. 4.3.5 (Genetyx, Japan). Finally, the complete genomes of JP-YS1 and JP-YS3 and partial genomes of JP-YS2, JP-Ch, and JP-PN were obtained.
TABLE 1.
Primers used in this study
| Purpose and primer | Sequence (5′ to 3′) | Amplified region (nt)a |
|---|---|---|
| Detection of GRGV | ||
| RG6061F (14) | CCGAGCTTCTCTCCAAGATCA | 6042–6798 |
| RG6801R (14) | ACTTAACGTAGGCCACTGGGT | |
| 5′ RACEb | ||
| GRGV-290R | GGAATGGACCAGAAGGAATG | |
| GRGV-351R | GAAGAGGTGGGGGAAGTTGGT | |
| GRGV-412R | GGAAGTCTCCGAGGAG | |
| AAP | GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG | |
| AUAP | GGCCACGCGTCGACTAGTAC | |
| RT-PCR | ||
| JP-YS1 and JP-YS3 | ||
| GRGV-38F | TCTGGTTATCTTGCTCACATTCG | 38–1211 |
| GRGV-1211R | CCCCAGGAGTCCAGGATGGAG | |
| GRGV-970F | TGCCCRACCCTCACCAACC | 970–1935 |
| GRGV-1935R | GAACCAGCGGTAGGCCATG | |
| GRGV-1531F | GCCCACTACTTCCTCTTCCG | 1531–3318 |
| GRGV-3318R | GCGCTGGAGCATCTGCTG | |
| GRGV-3085F | CACAARTACCGMTCCCACC | 3085–3659 |
| GRGV-3659R | GACCADAGRCAGTACATGTC | |
| GRGV-3374F | GGAAGCGCAATCTCAAGATC | 3374–6577 |
| GRGV-6577R | GGGGGTGTTGTTGTAGGACAC | |
| GRGV-5811F | CAAAGCCTTCCGCCCCGAG | 5811–6846 |
| GRGV-6846R | GTGGGGGCAAGCAGAGACTG | |
| JP-PN | ||
| GRGV-2F (6) | TCCGCCCCGAGAAGCACTTTG | 5819–6831 |
| RG1980R (15) | GACTGGGAAACTGCACACTACTA | |
| JP-YS2 and JP-Ch | ||
| GRGV-5866F | CACAACACTGAATCGCTTCC | 5866–6797 |
| GRGV-6797R | CTTAACGTAGGCCACTGGGTCC | |
| Amplification of 3′ ends | ||
| GRGV-6678F | GCTCATCCGTGCGTGTCACC | |
| GRadaptor-R | CTACGTAACGGCATGACAGTG | |
| GRadaptor-oligodT | GCTGTCAACGATACGCTACGTAACGGCATGACAGTGTTTTTTTTTTTTTTTTTT |
The complete JP-YS1 and JP-YS3 genomes were both 6,859 nt long, excluding the poly(A) tail. Their structures were identical, and two putative GRGV open reading frames (ORFs) were predicted by NCBI ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder/). ORF1 (nt 199 to 6,132) encoded a putative 220-kDa replicase polyprotein, and ORF2 (nt 6,008 to 6,715) encoded a putative 24.9-kDa coat protein (CP). The partial sequences of JP-YS2, JP-Ch, and JP-PN were also predicted to contain the full ORF2. A phylogenetic analysis of the CP showed that the Japanese viruses formed a monophyletic group with all known GRGVs (Fig. 1).
FIG 1.
Phylogenetic tree of GRGV and closely related viruses. The tree was constructed based on CP amino acid sequences using the maximum-likelihood method with the LG+G model in MEGA11 (13). Numbers at the nodes are bootstrap values (>70%) obtained for 1,000 replicates. The viruses identified in this study are in bold. The scale bar indicates the number of amino acid substitutions per site. Turnip yellow mosaic virus (genus Tymovirus, family Tymoviridae) was used as an outgroup. Black dots on the right indicate isolates used to obtain pairwise sequence identities of the complete genome in addition to those of CP.
The sequence-based criteria demarcating species in the genus Maculavirus are 80% genome-wide nucleotide identity or 90% CP amino acid identity (10). The pairwise sequence identities of the Japanese isolates with previously reported GRGVs (Fig. 1) were calculated using the MUSCLE algorithm (11) in the program SDT v.1.2 (12). The overall genome sequence identities were 85.5 to 90.8% (JP-YS1) and 85.4 to 90.7% (JP-YS3) at the nucleotide level. Those of the CP were 87.2 to 99.1% (JP-YS1 to -YS3), 87.7 to 98.7% (JP-Ch), and 87.2 to 99.6% (JP-PN) at the amino acid level. Although the amino acid identities of the CP were below the demarcation threshold in some combinations, the high genome-wide nucleotide identity above 80% and the close phylogenetic relationship (Fig. 1) strongly indicate that the Japanese viruses are isolates of GRGV.
Data availability.
The viral genome sequences have been deposited in the DDBJ under accession numbers LC704874 (JP-Ch), LC704875 (JP-PN), LC704876 (JP-YS1), LC704877 (JP-YS2), and LC704878 (JP-YS3).
ACKNOWLEDGMENTS
This work was supported by JSPS KAKENHI grant 21H04722 and the Mishima Kaiun Memorial Foundation.
Contributor Information
Yasuyuki Yamaji, Email: ayyamaji@g.ecc.u-tokyo.ac.jp.
Jelle Matthijnssens, KU Leuven.
REFERENCES
- 1.Sabanadzovic S, Aboughanem-Sabanadzovic N, Martelli GP. 2017. Grapevine fleck and similar viruses, p 331–349. In Meng B, Martelli GP, Golino DA, Fuchs M (ed), Grapevine viruses: molecular biology, diagnostics and management. Springer, New York, NY. [Google Scholar]
- 2.Vončina D, Al Rwahnih M, Rowhani A, Gouran M, Almeida RPP. 2017. Viral diversity in autochthonous Croatian grapevine cultivars. Plant Dis 101:1230–1235. doi: 10.1094/PDIS-10-16-1543-RE. [DOI] [PubMed] [Google Scholar]
- 3.Czotter N, Molnar J, Szabó E, Demian E, Kontra L, Baksa I, Szittya G, Kocsis L, Deak T, Bisztray G, Tusnady GE, Burgyan J, Varallyay E. 2018. NGS of virus-derived small RNAs as a diagnostic method used to determine viromes of Hungarian vineyards. Front Microbiol 9:122. doi: 10.3389/fmicb.2018.00122. [DOI] [Google Scholar]
- 4.Ruiz-García AB, Nourinejhad Zarghani S, Okic A, Olmos A, Wetzel T. 2018. First report of grapevine red globe virus in grapevine in Germany. Plant Dis 102:1675. doi: 10.1094/PDIS-01-18-0105-PDN. [DOI] [Google Scholar]
- 5.Nourinejhad Zarghani S, Khalili M, Dizadji A, Wetzel T. 2021. First report of grapevine red globe virus in grapevine in Iran. J Plant Pathol 103:661–661. doi: 10.1007/s42161-021-00749-w. [DOI] [Google Scholar]
- 6.Cretazzo E, Velasco L. 2017. High-throughput sequencing allowed the completion of the genome of grapevine red globe virus and revealed recurring co-infection with other tymoviruses in grapevine. Plant Pathol 66:1202–1213. doi: 10.1111/ppa.12669. [DOI] [Google Scholar]
- 7.Iandolino AB, Goes da Silva F, Lim H, Choi H, Williams LE, Cook DR. 2004. High-quality RNA, cDNA, and derived EST libraries from grapevine (Vitis vinifera L.). Plant Mol Biol Rep 22:269–278. doi: 10.1007/BF02773137. [DOI] [Google Scholar]
- 8.Burger JT, Maree HJ, Gouveia P, Naidu RA. 2017. Grapevine leafroll-associated virus 3, p 167–195. In Meng B, Martelli GP, Golino DA, Fuchs M (ed), Grapevine viruses: molecular biology, diagnostics and management. Springer, New York, NY. [Google Scholar]
- 9.Suzuki T, Iwabuchi N, Tokuda R, Matsumoto O, Yoshida T, Nishikawa M, Maejima K, Namba S, Yamaji Y. 2021. Complete genome sequence of Mirabilis crinkle mosaic virus isolated from pokeweed in Japan. Microbiol Resour Announc 10:e00283-21. doi: 10.1128/MRA.00283-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Dreher TW, Edwards MC, Gibbs AJ, Haenni A-L, Hammond RW, Jupin I, Koenig R, Sabanadzovic S, Martelli GP. 2012. Family Tymoviridae, p 944–952. In King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ. (ed), Virus taxonomy: ninth report of the International Committee on Taxonomy of Viruses. Elsevier, Amsterdam, The Netherlands. [Google Scholar]
- 11.Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792–1797. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Muhire BM, Varsani A, Martin DP. 2014. SDT: a virus classification tool based on pairwise sequence alignment and identity calculation. PLoS One 9:e108277. doi: 10.1371/journal.pone.0108277. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Tamura K, Stecher G, Kumar S. 2021. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Mol Biol Evol 38:3022–3027. doi: 10.1093/molbev/msab120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Jarugula S, Chingandu N, Adiputra J, Bagewadi B, Adegbola RO, Thammina C, Rayapati N. 2020. First report of grapevine red globe virus in grapevines in Washington State. Plant Dis 105:717. doi: 10.1094/PDIS-07-20-1609-PDN. [DOI] [Google Scholar]
- 15.Cretazzo E, Padilla CV, Velasco L. 2017. First report of grapevine red globe virus in grapevine in Spain. Plant Dis 101:264. doi: 10.1094/PDIS-06-16-0932-PDN. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The viral genome sequences have been deposited in the DDBJ under accession numbers LC704874 (JP-Ch), LC704875 (JP-PN), LC704876 (JP-YS1), LC704877 (JP-YS2), and LC704878 (JP-YS3).