Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2022 Dec 15;12:21707. doi: 10.1038/s41598-022-25848-1

Glucosidase inhibitor, Nimbidiol ameliorates renal fibrosis and dysfunction in type-1 diabetes

Subir Kumar Juin 1, Sathnur Pushpakumar 1, Suresh C Tyagi 1, Utpal Sen 1,✉
PMCID: PMC9755213  PMID: 36522378

Abstract

Diabetic nephropathy is characterized by excessive accumulation of extracellular matrix (ECM) leading to renal fibrosis, progressive deterioration of renal function, and eventually to end stage renal disease. Matrix metalloproteinases (MMPs) are known to regulate synthesis and degradation of the ECM. Earlier, we demonstrated that imbalanced MMPs promote adverse ECM remodeling leading to renal fibrosis in type-1 diabetes. Moreover, elevated macrophage infiltration, pro-inflammatory cytokines and epithelial‒mesenchymal transition (EMT) are known to contribute to the renal fibrosis. Various bioactive compounds derived from the medicinal plant, Azadirachta indica (neem) are shown to regulate inflammation and ECM proteins in different diseases. Nimbidiol is a neem-derived diterpenoid that is considered as a potential anti-diabetic compound due to its glucosidase inhibitory properties. We investigated whether Nimbidiol mitigates adverse ECM accumulation and renal fibrosis to improve kidney function in type-1 diabetes and the underlying mechanism. Wild-type (C57BL/6J) and type-1 diabetic (C57BL/6‐Ins2Akita/J) mice were treated either with saline or with Nimbidiol (0.40 mg kg−1 d−1) for eight weeks. Diabetic kidney showed increased accumulation of M1 macrophages, elevated pro-inflammatory cytokines and EMT. In addition, upregulated MMP-9 and MMP-13, excessive collagen deposition in the glomerular and tubulointerstitial regions, and degradation of vascular elastin resulted to renal fibrosis in the Akita mice. These pathological changes in the diabetic mice were associated with functional impairments that include elevated resistive index and reduced blood flow in the renal cortex, and decreased glomerular filtration rate. Furthermore, TGF-β1, p-Smad2/3, p-P38, p-ERK1/2 and p-JNK were upregulated in diabetic kidney compared to WT mice. Treatment with Nimbidiol reversed the changes to alleviate inflammation, ECM accumulation and fibrosis and thus, improved renal function in Akita mice. Together, our results suggest that Nimbidiol attenuates inflammation and ECM accumulation and thereby, protects kidney from fibrosis and dysfunction possibly by inhibiting TGF-β/Smad and MAPK signaling pathways in type-1 diabetes.

Subject terms: Kidney diseases, Diabetes complications

Introduction

The most common and detrimental pathophysiological complication of diabetes mellitus is diabetic nephropathy (DN) that has emerged as an alarming threat to the global population. DN is a chronic kidney disease (CKD) which is characterized by excessive accumulation and deposition of extracellular matrix (ECM) in the glomeruli and tubulointerstitium, progressing to renal fibrosis, deterioration of renal function, and eventually to end-stage renal disease (ESRD)1–3. Dysregulation of the major ECM proteins such as collagen, fibronectin, α-smooth muscle actin (α-SMA), and elastin is the hallmark of renal fibrosis and failure in DN1,4,5. Emerging evidence indicates that elevated infiltration and activation of macrophage, inflammation and myofibroblasts accumulation largely contribute to the development and progression of renal fibrosis6,7. Elevated macrophage infiltration is a common feature in renal fibrosis8,9. Activated macrophages synthesize different pro-inflammatory cytokines and chemokines, such as transforming growth factor-β1 (TGF-β1), tumour necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and monocyte chemoattractant protein-1 (MCP-1). TNF-α is the crucial mediator of primary inflammatory response and plays an important role in DN10. TNF-α stimulates mesangial cells to produce MCP-1, which, in turn, promotes macrophage recruitment and progression of renal fibrosis10–12. Previous reports demonstrated that ECM deposition during renal fibrosis is predominantly contributed by the accumulation of myofibroblasts that are differentiated from macrophages, resident fibroblasts, epithelial cells, endothelial cells, pericytes etc.13–15. Epithelial‒mesenchymal transition (EMT) indicates the process of differentiation of the epithelial cells to the mesenchymal phenotype leading to the myofibroblast transdifferentiation and excessive interstitial collagen deposition11,16–18. Moreover, previous findings demonstrated that elevated α-SMA expression in tubular and glomerular epithelial cells is involved in the glomerulonephritis and glomerulosclerosis16,19,20. TGF-β1 is thought to play as a key mediator of EMT and acts as an important pro-fibrotic factor to promote excessive ECM accumulation leading to glomerulosclerosis and tubulointerstitial fibrosis in DN13,21.

Matrix metalloproteinases (MMPs) are important zinc-dependent endopeptidases that collectively control the synthesis and degradation of all ECM components including collagen and elastin1,6. Previous reports suggested that MMPs play critical role in the regulation of inflammatory response and progression of EMT6. MMP-9 has been shown to regulate inflammation in experimental glomerulonephritis in vivo22. MMP-9 was also reported to be a crucial regulator of EMT in murine renal tubular cells and renal interstitial fibrosis in obstructive nephropathy23,24. Previous studies demonstrated that elevated MMP-9 and MMP-13 cause adverse ECM remodeling in type-1 diabetic kidney4,25,26.

Nimbidiol is a diterpenoid derived from the root and stem-bark of the medicinal plant, Azadirachta indica (commonly known as ‘neem’) and is reported to possess potential anti-diabetic properties by inhibiting glucosidases27. Several previous studies exhibited antimicrobial, antioxidant, anti-inflammatory, anti-fibrotic, and anticancer potential of diverse bioactive compounds derived from neem28,29. A wide range of neem extracts and neem-derived compounds have also been reported to show antihyperglycemic activity29. Moreover, earlier studies have also suggested that bioactive compounds from A. indica regulate ECM proteins by modulating expression of MMPs in different diseases including wide-spectrum cancer studies30–34. Recently, therapeutic intervention of neem extract has been shown to abrogate inflammation-driven renal fibrosis by reducing ECM accumulation in UUO nephropathy35. However, this is not known whether neem-derived Nimbidiol modulates MMPs and ECM proteins in diabetic scenario. The present study investigated whether glucosidase inhibitor, Nimbidiol protects kidney from fibrosis and dysfunction in type-1 diabetes and the potential signaling mechanism.

Results

Effect of Nimbidiol on body weight, blood glucose level and α-glucosidase activity in the diabetic mice

To evaluate the effect of Nimbidiol on body weights of the mice, all the mice were weighed at the end of the experiment. Akita mice showed significantly lower body weight compared to the age-matched WT mice (Fig. 1A). There was no significant change in body weight between WT mice treated with saline and Nimbidiol (Fig. 1A). Similarly, body weight of Nimbidiol-treated diabetic mice remained statistically unchanged compared to the diabetic mice that received saline (Fig. 1A). Previous reports suggested Nimbidiol as a promising antidiabetic drug due to its broad- spectrum glucosidase inhibition potentials27,36. Therefore, in the present study, we investigated whether Nimbidiol modulates levels of blood glucose, glycated haemoglobin (HbA1c) and α-glucosidase activity in type-1 diabetic mice. Our results showed significantly higher blood glucose and HbA1c levels in the Akita mice compared to that of WT control (Fig. 1B,C). Interestingly, blood glucose and HbA1c levels of the Akita mice treated with Nimbidiol were significantly reduced compared to the saline-treated diabetic mice (Fig. 1B,C). However, the blood glucose levels of Nimbidiol-treated Akita mice were higher than that of WT control (Fig. 1B). Our results also revealed a significant upregulation of the plasma α-glucosidase activity in Akita mice compared to the WT control (Fig. 1D). Notably, Nimbidiol treatment to Akita mice significantly reduced α-glucosidase activity compared to the saline-treated Akita mice (Fig. 1D).

Figure 1.

Figure 1

Effect of Nimbidiol on body weight, blood glucose level and α-glucosidase activity in the diabetic mice. The bar diagrams represent (A) body weight (B) blood glucose level (C) blood level of HbA1c and (D) α-glucosidase activity of the mice. Data are mean ± SD (n = 6/group). §p < 0.05 versus WT + Saline and WT + Nimbidiol, *p < 0.05 versus WT + Saline, WT + Nimbidiol and Akita + Nimbidiol, †p < 0.05 versus WT + Saline, WT + Nimbidiol and Akita + Saline.

Nimbidiol treatment improved renal function in the diabetic mice

Glomerular filtration rate (GFR) is considered as an important marker of renal function37. Previously, progressive decline in the GFR is reported in DN38. Therefore, to investigate the effect of Nimbidiol, renal function of the mice was evaluated by monitoring GFR. WT mice showed normal GFR (Fig. 2A,B). In diabetic mice, GFR was found to be significantly decreased compared to that of WT control (Fig. 2A,B). However, impaired renal function in diabetic mice was significantly improved with Nimbidiol treatment compared to the saline-treated Akita mice (Fig. 2A,B). There was no significant difference in GFR between saline-treated and Nimbidiol-treated WT mice (Fig. 2A,B).

Figure 2.

Figure 2

Nimbidiol treatment improved renal function in the diabetic mice. (A) Representative photographs of transcutaneous fluorescent emission of FITC-sinistrin for more than 2 h. ‘Yellow arrow’ indicates the background signal of the skin, ‘white arrow’ indicates time of injection of the FITC-sinistrin, and ‘green arrow’ indicates the time point selected to determine ‘R2’ and ‘t1/2’ used to calculate the ′GFR′ as mentioned in ‘Methods’. (B) The bar diagram represents GFR. Data are mean ± SD (n = 6/group). *p < 0.05 versus WT + Saline, WT + Nimbidiol and Akita + Nimbidiol, †p < 0.05 versus Akita + Saline.

Renal cortical blood flow in the diabetic mice was normalized in response to Nimbidiol treatment

In order to investigate whether Nimbidiol influences renal cortical blood flow, we performed laser Doppler flowmetry that serves as an efficient non-invasive method for evaluating intra-renal blood flow39. The results revealed that diabetic mice showed significantly (39%) reduced renal cortical blood flow compared to the basal level of the WT control (Fig. 3A,B). Compared to the saline-treated diabetic mice, treatment with Nimbidiol in diabetic mice significantly increased the renal cortical blood flow that was comparable to that of WT control (Fig. 3A,B). Renal cortical blood flow remained statistically unaltered between saline-treated and Nimbidiol-treated WT mice (Fig. 3A,B).

Figure 3.

Figure 3

Renal cortical blood flow in the diabetic mice was normalized in response to Nimbidiol treatment. (A) Representative line tracing from laser Doppler flowmetry shows ‘flux units’ (no. of RBCs × velocity) in the aorta (black trace), renal artery (red trace), renal vein (blue trace), and renal cortex (pink trace, arrow). (B) The bar diagram represents the flux units as the percent change in the renal cortex versus WT + Saline. Data are mean ± SD (n = 6/group). *p < 0.05 versus WT + Saline, WT + Nimbidiol and Akita + Nimbidiol, †p < 0.05 versus Akita + Saline.

Nimbidiol ameliorated resistive index (RI) of the renal cortical artery in the diabetic mice

Resistive index (RI) indicates vascular elasticity and is considered as an important marker of kidney function40.To evaluate the effect of Nimbidiol on RI of the renal cortical artery, renal ultrasound was performed. Compared to the WT control, RI of the renal cortical artery in Akita mice was significantly increased, which was ameliorated by Nimbidiol treatment (Fig. 4A,B). However, Nimbidiol-treated WT mice showed no significant change in RI of the renal cortical artery compared to the WT mice receiving saline (Fig. 4A,B).

Figure 4.

Figure 4

Nimbidiol ameliorated resistive index (RI) of the renal cortical artery in the diabetic mice. (A) Representative images from ultrasound of renal cortical artery. Resistive index was calculated using the formula: (PSV-EDV)/PSV. PSV, peak systolic velocity (white arrow); EDV, end diastolic velocity (yellow arrow). (B) The bar diagram represents the resistive index. Data are mean ± SD (n = 6/group). *p < 0.05 versus WT + Saline, WT + Nimbidiol and Akita + Nimbidiol, †p < 0.05 versus Akita + Saline.

Nimbidiol treatment normalized the expression of collagen IV, fibronectin and elastin, and mitigated histopathogical changes in the diabetic kidney

Adverse ECM accumulation in glomerulus and tubulointerstitium promotes renal fibrosis and subsequent deterioration of renal function2. ECM regulation by neem-derived compounds has already been shown in cancer studies33,34. Therefore, in our current study, we examined the effect of Nimbidiol on the expression of important ECM proteins such as collagen IV (Col IV), fibronectin, and elastin in the diabetic kidney. No significant difference in Col IV, fibronectin and elastin expression was observed between saline- and Nimbidiol-treated WT kidney both at mRNA and protein levels (Fig. 5A,B). Compared to the WT mice, diabetic kidney showed a robust upregulation of Col IV and fibronectin expression at mRNA (0.82 and 1.21 fold, respectively) and protein (1.43 and 2.20 fold, respectively) levels (Fig. 5A,B). Elastin expression in the kidney of diabetic mice was significantly downregulated at mRNA (0.47 fold) and protein (0.39 fold) levels compared to the WT mice (Fig. 5A,B). Nimbidiol treatment significantly downregulated the expression of Col IV and fibronectin, and upregulated elastin expression in diabetic kidney compared to the saline-treated Akita mice (Fig. 5A,B).

Figure 5.

Figure 5

Nimbidiol treatment normalized the expression of collagen IV, fibronectin and elastin in the diabetic kidney. Representative images from (A) Semi-quantitative RT-PCR analyses showing gene expression and (B) western blot analyses showing protein expression of Col IV, fibronectin and elastin in the kidney. The bar diagrams represent the fold change from WT + Saline. Data are mean ± SD (n = 6/group). *p < 0.05 versus WT + Saline, WT + Nimbidiol and Akita + Nimbidiol, †p < 0.05 versus Akita + Saline.

Consistent with the mRNA and western blot analyses, immunohistochemical localization revealed a sharp upregulation of Col IV and fibronectin in the glomerulus and tubulointerstitium, and a robust downregulation of vascular elastin expression in the interlobular artery of the diabetic mice compared to WT control (Fig. 6A‒F). Notably, Nimbidiol treatment to the diabetic mice significantly decreased Col IV and fibronectin expression and increased elastin expression compared to that of saline-treated Akita mice (Fig. 6A‒F). Compared to the saline-treated WT mice, expression of Col IV, fibronectin and elastin statistically unaltered in the kidney of the Nimbidiol-treated WT mice (Fig. 6A‒F).

Figure 6.

Figure 6

Nimbidiol inhibited upregulation of collagen IV and fibronectin, and downregulation of elastin expression in the diabetic kidney. Representative immunofluorescence images of the renal cortex showing expression of (A) Col IV, (B) fibronectin and (C) elastin. The nuclear counterstaining was performed using DAPI (blue). The bar diagrams represent the fold change in the fluorescence intensity from WT + Saline for (D) Col IV (E) fibronectin and (F) elastin. Data are mean ± SD (n = 6/group). *p < 0.05 versus WT + Saline, WT + Nimbidiol and Akita + Nimbidiol, †p < 0.05 versus Akita + Saline. Scale bar: 20 µm; magnification × 60.

In order to monitor the potential histological changes, kidney sections were subjected to Hematoxylin and Eosin (H&E), and Periodic Acid-Schiff (PAS) staining. Kidney section of the Akita mice showed distinct glomerulopathy as well as tubulointerstitial injury as evidenced by prominent expansion and accumulation of mesangial matrix forming early nodules, thickening of the glomerular and tubular basement membrane, tubular dilation, interstitial widening etc. (Fig. 7A,B). Of note, Nimbidiol treatment ameliorated the histopathological changes in Akita mice (Fig. 7A,B). Further, Masson’s trichrome staining revealed a sharp increase in collagen deposition in the periglomerular, glomerular, and also tubulointerstitial regions of the diabetic kidney compared to the WT mice (Fig. 7C,E). It was interesting to observe that Nimbidiol treatment to Akita mice substantially decreased collagen deposition in the kidney to the basal level that was comparable to the of WT control (Fig. 7C,E). There was no significant difference in the glomerular and tubulointerstitial collagen deposition between saline- and Nimbidiol-treated WT mice (Fig. 7C,E). To evaluate the elastin content of the renal cortical blood vessels, kidney sections were stained with Verhoeff′s Van Gieson stain. Vascular elastin content between saline- and Nimbidiol-treated WT mice remained statistically unaltered (Fig. 7D,F). Diabetic kidney showed a drastic degradation in elastin content compared to the WT control (Fig. 7D,F). Nimbidiol treatment to Akita mice substantially improved the elastin content that was comparable to the WT control (Fig. 7D,F).

Figure 7.

Figure 7

Nimbidiol mitigated histopathological changes in the diabetic kidney. Representative photomicrographs of kidney sections stained with (A) Hematoxylin and Eosin (H&E) and (B) Periodic Acid-Schiff (PAS) stains showing prominent glomerulopathy as well as tubulointerstitial injury in the diabetic kidney. (C) Masson’s trichrome staining showing glomerular and tubulointerstitial collagen deposition (blue, black arrows) and (D) Verhoeff’s Van Gieson staining showing degradation of vascular elastin (dark brown, black arrows) in the renal cortex of the diabetic kidney. The bar diagrams represent the fold change in the total (E) collagen and (F) elastin area from WT + Saline. Data are mean ± SD (n = 6/group). *p < 0.05 versus WT + Saline, WT + Nimbidiol and Akita + Nimbidiol, †p < 0.05 versus Akita + Saline. Scale bar: 50 µm; magnification × 60.

Nimbidiol attenuated epithelial‒mesenchymal transition (EMT) in the diabetic kidney

Epithelial‒mesenchymal transition (EMT) is widely considered as a crucial mediator of glomerulosclerosis and tubulointerstitial fibrosis11,19,41. Therefore, we analyzed the expression of E-cadherin (epithelial marker) and α-SMA (mesenchymal marker) in the kidney and tested if Nimbidiol regulates their expression. Results revealed that compared to the WT control, diabetic kidney showed a significant downregulation of E-cadherin and upregulation of α-SMA expression at mRNA (0.59 and 1.14 fold, respectively) and protein (0.38and 0.71 fold, respectively) levels (Fig. 8A,B). Nimbidiol treatment normalized their expression in diabetic mice (Fig. 8A,B). The expression of E-cadherin and α-SMA remained statistically unaltered between WT mice treated with saline and Nimbidiol (Fig. 8A,B). Further, immunohistochemical staining exhibited a sharp downregulation of E-cadherin expression and a robust upregulation of α-SMA expression in the kidney of the diabetic mice compared to the WT control (Fig. 8C,D). Nimbidiol treatment restored basal level expression of E-cadherin and α-SMA in the diabetic kidney (Fig. 8C,D). No significant difference was observed in the expression of E-cadherin and α-SMA between saline- and Nimbidiol-treated WT mice (Fig. 8C,D).

Figure 8.

Figure 8

Nimbidiol attenuated epithelial‒mesenchymal transition (EMT) in the diabetic kidney. Representative images from (A) Semi-quantitative RT-PCR analyses showing gene expression and (B) western blot analyses showing protein expression of E-cadherin and α-SMA in the kidney. (C) Representative immunofluorescence images of the renal cortex demonstrate the expression of E-cadherin (green) and α-SMA (red). The nuclear counterstaining was performed using DAPI (blue). The bar diagrams represent the fold change in (A) gene expression, (B) protein expression and (D) fluorescence intensity from WT + Saline. Data are mean ± SD (n = 6/group). *p < 0.05 versus WT + Saline, WT + Nimbidiol and Akita + Nimbidiol, †p < 0.05 versus Akita + Saline. Scale bar: 20 µm; magnification × 60.

Nimbidiol reduced elevated expression of MMP-9 and MMP-13 in the diabetic kidney

Deregulation of MMPs is an important driver of adverse ECM turnover leading to renal fibrosis4,6,26. Elevated expression of MMP-9 and MMP-13 was reported to be associated with renal fibrosis in DN25,42,43. Previously, neem-derived compounds have been shown to modulate MMP-9 expression in cancer31,32. Therefore, we investigated the effect of Nimbidiol on the expression of MMP-9 and MMP-13 in the diabetic kidney. The mRNA and protein expression of MMP-9 and MMP-13 in WT control remained at basal levels (Fig. 9A,B). There was no significant difference in the mRNA and protein expression of MMP-9 and MMP-13 between saline- and Nimbidiol-treated WT mice (Fig. 9A,B). Of note, compared to WT, diabetic kidney showed a significant increase in the expression of MMP-9 and MMP-13 at mRNA (2.18 and 0.98 fold, respectively) and protein (0.54 and 0.46 fold, respectively) levels (Fig. 9A,B). Nimbidiol treatment mitigated the elevated expression of MMP-9 and MMP-13 in the diabetic kidney (Fig. 9A,B).

Figure 9.

Figure 9

Nimbidiol reduced elevated expression of MMP-9 and MMP-13 in the diabetic kidney. Representative images from (A) Semi-quantitative RT-PCR analyses showing gene expression and (B) western blot analyses showing protein expression of MMP-9 and MMP-13 in the kidney. The bar diagrams represent the fold change from WT + Saline. Data are mean ± SD (n = 6/group). *p < 0.05 versus WT + Saline, WT + Nimbidiol and Akita + Nimbidiol, †p < 0.05 versus Akita + Saline.

Accumulation of M1 macrophages in the diabetic kidney was attenuated by Nimbidiol

Macrophages are the crucial mediators of renal inflammation and fibrosis in different renal diseases including DN11,14. Increased infiltration of pro-inflammatory M1 macrophages in the glomerulus and interstitium is highly involved in the initiation and progression of renal fibrosis in DN11. On the other hand, reparative roles of anti-inflammatory M2 macrophages have been shown in different kidney diseases including UUO and diabetic nephopathy11,44,45. Therefore, we investigated whether Nimbidiol modulates macrophage accumulation in the diabetic mice. In diabetic kidney, CD40 was upregulated and CD206 was downregulated significantly both at mRNA (1.42 and 0.59 fold, respectively) and protein (0.39and 0.26 fold, respectively) levels compared to the WT mice (Fig. 10A,B). Nimbidiol treatment normalized their expression in the diabetic mice (Fig. 10A,B). There was no significant difference in the expression of CD40 and CD206 between saline- and Nimbidiol-treated WT mice both at mRNA and protein levels (Fig. 10A,B). Similarly, immunohistochemical study revealed a robust increase of the CD40 + (pro-inflammatory M1-type) macrophages and a distinct decrease of the CD206 + (anti-inflammatory M2-type) macrophages in the kidney of the diabetic mice (Fig. 10C,D). However, the CD40 + and CD206 + macrophages in the kidney of the diabetic mice treated with Nimbidiol remained at the basal levels as observed in WT mice (Fig. 10C,D). There were no significant changes of the CD40 + and CD206 + macrophages between saline- and Nimbidiol-treated WT mice (Fig. 10C,D).

Figure 10.

Figure 10

Accumulation of M1 macrophages in the diabetic kidney was attenuated by Nimbidiol. Representative images from (A) Semi-quantitative RT-PCR analyses showing gene expression and (B) western blot analyses showing protein expression of CD40 and CD206 in the kidney. (C) Representative immunofluorescence images of the renal cortex demonstrate the expression of CD206 (green) and CD40 (red). The nuclear counterstaining was performed using DAPI (blue). The bar diagrams represent the fold change in (A) gene expression, (B) protein expression, and (D) fluorescence intensity from WT + Saline. Data are mean ± SD (n = 6/group). *p < 0.05 versus WT + Saline, WT + Nimbidiol and Akita + Nimbidiol, †p < 0.05 versus Akita + Saline. Scale bar: 20 µm; magnification × 60.

Nimbidiol treatment mitigated elevated pro-inflammatory cytokine and chemokine in the diabetic kidney

A plethora of evidence suggests that inflammation plays a pivotal role in the development and progression of DN, while pro-inflammatory cytokines and chemokines remain crucial mediators of inflammation11,46. Therefore, the present study investigated the expression of different pro-inflammatory cytokine and chemokine such as TNF-α, IL-1β and MCP-1 in the kidney, and tested whether Nimbidiol modulates their expression. The expression of TNF-α, IL-1β and MCP-1 was significantly increased at mRNA (1.19, 1.22 and 1.04 fold, respectively) and protein (0.93, 0.79 and 0.78 fold, respectively) levels in the diabetic mice compared to that of WT control (Fig. 11A,B). Notably, Nimbidiol treatment to diabetic mice reduced their expression to the basal levels that were comparable to the WT mice (Fig. 11A,B). WT mice treated with Nimbidiol showed no significant difference in the expression of TNF-α, IL-1β and MCP-1 compared to that of saline-treated WT mice (Fig. 11A,B).

Figure 11.

Figure 11

Nimbidiol treatment mitigated elevated pro-inflammatory cytokine and chemokine in the diabetic kidney. Representative images from (A) Semi-quantitative RT-PCR analyses showing gene expression and (B) western blot analyses showing protein expression of TNF-α, IL-1β and MCP-1 in the kidney. The bar diagrams represent the fold change from WT + Saline. Data are mean ± SD (n = 6/group). *p < 0.05 versus WT + Saline, WT + Nimbidiol and Akita + Nimbidiol, †p < 0.05 versus Akita + Saline.

Nimbidiol inhibited TGF-β1, Smad2/3 and mitogen-activated protein kinases (MAPKs) in the diabetic kidney

TGF-β1/Smad and mitogen-activated protein kinase (MAPK) signaling pathways play critical roles in excessive ECM production and development of renal fibrosis5,11,47. Therefore, we evaluated the protein expression of TGF-β1, Smad2/3 and MAPKs (P38, ERK1/2 and JNK), and examined whether Nimbidiol modulates their expression in the kidney. Results showed that protein expression levels of TGF-β1 and phosphorylated- Smad2/3, P38, ERK1/2 and JNK were significantly (0.45, 0.50, 0.46, 1.80 and 1.09 fold respectively) upregulated in diabetic kidney compared to the WT mice (Fig. 12A,B). Nimbidiol treatment to the diabetic mice significantly reduced protein expression of TGF-β1 and phosphorylation of Smad2/3, P38, ERK1/2 and JNK to the basal levels, comparable to the WT control (Fig. 12A,B). Compared to the saline-treated WT mice, the expression of TGF-β1, p-Smad2/3, p-P38, p-ERK1/2 and p-JNK remained statistically unaltered in WT mice treated with Nimbidiol (Fig. 12A,B).

Figure 12.

Figure 12

Nimbidiol inhibited TGF-β1, Smad2/3 and mitogen-activated protein kinases (MAPKs) in the diabetic kidney. Representative images from western blot analyses showing protein expression of (A) TGF-β1, Smad2/3 and p-Smad2/3, and (B) P38, p-P38, ERK1/2, p-ERK1/2, JNK and p-JNK in the kidney. The bar diagrams represent the fold change from WT + Saline. Data are mean ± SD (n = 6/group). *p < 0.05 versus WT + Saline, WT + Nimbidiol and Akita + Nimbidiol, †p < 0.05 versus Akita + Saline.

Discussion

Diabetes mellitus (DM) is a complex metabolic disorder characterized by impaired glucose metabolism leading to hypergycemia i.e., elevated blood sugar level. Untreated DM often leads to diabetic nephropathy (DN) that refers to renal fibrosis, progressive deterioration of renal function, renal failure and ultimately to end-stage renal disease (ESRD). Treating DN has become a significant challenge as the prevalence of DN-related mortality and morbidity is increasing worldwide. Different extracts from A. indica (neem) have earlier been reported to show anti-diabetic properties by inhibiting glucosidases and reducing blood glucose levels29,48–51. Although different studies have elucidated the anti-diabetic potential of several neem-derived bioactive compounds, their role in DN remains unknown. The present study investigated the effect of Nimbidiol, a potent glucosidase inhibitor from the root/stem-bark of A. indica, on the pathophysiological complications in type-1 DN. Our study showed that in type-1 diabetic kidney, polarization of macrophage towards M1-type, elevated pro-inflammatory cytokine, epithelial-mesenchymal transition (EMT), imbalanced MMPs and adverse ECM accumulation result to renal fibrosis and deterioration of renal function as evidenced fromdecreased glomerular filtration rate (GFR). The changes were associated with increased resistance in the renal cortical artery and decreased renal cortical blood flow. Nimbidiol treatment decreased elevated M1 macrophage, pro-inflammatory cytokine and ECM accumulation to ameliorate renal fibrosis and improve arterial resistance and blood flow of the renal cortex and renal function via downregulation of TGF-β1, p-Smad2/3, p-P38, p-ERK1/2 and p-JNK in type-1 diabetic kidney.

In the present study, body weight of diabetic mice was found to be significantly lower than that of WT control, which was in accordance with the previous study52. Nimbidiol showed no effect on body weight. Previous studies reported that hyperglycemia acts as the central regulator in the pathogenesis of DN1,53. Our results revealed a robust increase in blood glucose level in Akita mice, which is a typical feature of type-1 diabetic Akita mice54. Nimbidiol treatment reduced blood glucose level in diabetic mice suggesting its hypoglycaemic property. Alpha-glucosidase inhibitors (AGIs) competitively inhibit glucosidases and thus decelerate complex carbohydrate catabolism and delay glucose synthesis leading to amelioration of overall diabetic health36. Nimbidiol is reported to reversibly inhibit the activities of sucrase-isomaltase, maltase-glucoamylase, lactase, trehalase and microbial α-glucosidases27. Inhibition kinetics of Nimbidiol on a wide-spectrum glucosidase was described earlier27. Our finding for the first time showed that Nimbidiol efficiently reduced α-glucosidase activity in Akita mice confirming that anti-hyperglycemic effect of Nimbidiol is due to its glucosidase inhibitory activity as presumed previously27. Renal resistive index (RI), renal blood flow and GFR are some of the pivotal physiological parameters that serve as crucial indicators of renal function and prognostic markers of DN4,37,39,55. Our study demonstrated that increased resistance and reduced blood flow in the renal cortex were associated with reduced GFR, indicating deteriorated renal function in type-1 diabetic mice, which was in accordance with the previous findings4. Our current study further showed that Nimbidiol treatment to Akita mice reduced renal cortical arterial resistance, increased renal cortical blood flow and thus, improved renal function, suggesting a renoprotective role of Nimbidiol in type-1 DN. In chronic kidney disease (CKD), increased RI and poor renal function were found to be associated with adverse histopathological changes and renal fibrosis56. In Akita mice it has also been demonstrated that elevated RI and decline in renal function were associated with adverse ECM accumulation4. Collagen and fibronectin are crucial ECM proteins excessive accumulation of which was reported to be associated with pathological complications of DN57,58. On the other hand, degradation of elastin, another important ECM protein is known be involved in renovascular remodeling during DN. In our present study, a sharp increase in collagen IV and fibronectin expression and a decrease in elastin expression were evidenced in diabetic kidney, similar to our previous studies1,25. Moreover, our study showed a robust collagen deposition in the glomerular and tubulointerstitial regions and degradation of vascular elastin content resulted to renal fibrosis in diabetic kidney, corroborating our earlier findings1,4,25. Further, we observed that Nimbidiol treatment normalized the expression of collagen IV, fibronectin and elastin in diabetic kidney. Moreover, Nimbidiol substantially reduced glomerular and tubulointerstitial collagen deposition and also attenuated vascular elastin degradation, indicating an important role of Nimbidiol in improving renal function in type-1 DN by ameliorating adverse ECM-induced fibrovascular pathology.

Epithelial‒mesenchymal transition (EMT) is characterized by the loss of E-cadherin and activation of α-SMA–positive myofibroblasts, which is known to trigger excessive ECM accumulation59. Notably, our present study showed a downregulation of epithelial marker, E-cadherin and upregulation of mesenchymal marker, α-SMA indicating EMT as an important contributor of excessive ECM accumulation in the type-1 diabetic kidney. It is worth mentioning that active participation of EMT to promote renal fibrosis has previously been shown in UUO nephopathy and also in type-1 DN18,19,59–62. Our study showed that Nimbidiol treatment normalized the expression of E-cadherin and α-SMA in diabetic kidney indicating that Nimbidiol mitigates ECM accumulation by inhibiting EMT and can be used as a potential anti-fibrotic agent in type-1 DN.

Matrix metalloproteinases (MMPs) are profoundly implicated in the ECM regulation in DN63. Involvement of elevated MMP-9 in excessive renal ECM accumulation has been evidenced in previous studies wherein elevated MMP-9 was shown incapable of degrading nonenzymatically glycated collagen IV leading to thickening of glomerular basement membrane64,65. Further,MMP-9 was reported to promote EMT and subsequent tubulointerstitial collagen accumulation66–68.The current study showed a sharp upregulation of MMP-9 and MMP-13 in diabetic kidney, which was found to be involved in excessive ECM accumulation and renal fibrosis, corroborating the previous findings1,4,25,69,70. It was noteworthy that the degree of increase in the mRNA expression of MMP-9 and MMP-13 was not reflected in the protein levels. The poor correlation between mRNA expression and protein levels has been explained earlier71–73. Cis- and trans-acting mechanisms, secondary structures of RNA, codon bias, ribosome density and occupancy, amino acid usage, post-transcriptional mechanisms and half-lives of protein, untranslated RNA species, secreted proteins, mRNA distribution and sequestration to the nucleus are some of the important factors that greatly influence quantitative correlations between mRNA expression and protein abundance levels71–73. As MMPs-9 and -13 are also secreted proteins thus it is highly plausible to observe such poor correlation between their mRNA and protein levels. Whatsoever, our study further showed that Nimbidiol treatment remarkably alleviated the elevated expression of MMP-9 and MMP-13 in diabetic kidney, indicating MMP regulation by Nimbidiol help mitigating adverse ECM remodeling in type-1 DN. Notably, previous studies have provided evidence of MMP-9 inhibitory role of multiple neem extracts in different diseases30–32,74–76. However, to the best of our knowledge, our current study for the first time showed an important role of Nimbidiol in regulation of MMPs, and thus, ECM accumulation in DN.

Macrophage infiltration and activation promotes continuous secretion a wide range of profibrogenic factors, inflammatory cytokines and chemokines that in turn, induce renal fibrosis in DN11,14,24,47.Moreover, several earlier studies reported that TNF-α, IL-1β and MCP-1 play crucial role in ECM accumulation and renal fibrosis5,77–79. Our present study showed that macrophage polarization towards M1-type, and increased pro-inflammatory cytokines and chemokine (TNF-α, IL-1β, MCP-1) were associated with renal fibrosis indicating evidence of a crucial role of macrophage mediated inflammation in the renal fibrosis and dysfunction in DN. Interestingly, Nimbidiol treatment attenuated macrophage polarization towards M1-type and cytokines upregulation resulting to the amelioration of diabetes induced renal inflammation and fibrosis in Akita mice. Of note, various neem extracts and neem-derived bioactive compounds have been reported to show potential role on macrophage polarization and anti-inflammatory activity in different diseases74–76,80. Our study provides strong evidence of anti-inflammatory role of Nimbidiol by macrophage repolarization in type-1 DN.

TGF-β1 is an important pro-fibrotic factor which plays a central role in renal inflammation and development of renal fibrosis13,81. TGF-β1 has been reported to promote renal fibrosis by various mechanisms such as direct synthesis of ECM proteins like collagen and fibronectin, mesangial cell proliferation, progression of EMT, depletion of podocytes and tubular epithelial cells etc. 82–85. It has been also reported that TGF-β1 inducesMMP-9, which in turn, promotes EMT and renal fibrosis 66–68. A plethora of evidence suggests that TGF-β1 primarily acts via intracellular signaling cascades such as Smads and MAPKs (P38, ERK1/2 and JNK) to promote EMT and renal fibrosis in CKD84,86–88. TGF-β1 phosphorylates Smad2/3, and p-Smad2/3 regulates transcription of the genes involved in fibrosis89,90. Previous studies demonstrated the potential of neem-derived bioactive compound in mitigating inflammation-induced fibrosis by reducing EMT and ECM deposition through inhibition of TGF-β/Smad signaling in different murine disease models including UUO nephropathy35,91,92. A wide-spectrum cancer studies have shown that neem extract plays an important role in the regulation of MAPKs28. Moreover, inhibition of MAPK phosphorylation by neem-derived compound has also been reported in earlier studies93,94. In our present study, normalization of TGF-β1, p-Smad2/3, p-P38, p-ERK1/2 and p-JNK in Nimbidiol-treated diabetic mice suggested that Nimbidiol may mitigate renal fibrosis in type-1 DN by attenuating TGF-β1/Smad and MAPK signaling pathways. Chronic hyperglycemia, oxidative stress, and advanced glycation end products (AGEs) are some of the crucial factors that stimulate TGF-β to promote renal fibrosis in the progression and development of DN95,96. A plethora of evidence showed that hyperglycemia or high glucose acts as the key regulator of TGF-β production and activation of MAPKs both in vitro and in vivo including DN95–98. As our study clearly exhibited that Nimbidiol alleviates hyperglycemia by inhibiting α-glucosidase activity thus, anti-hyperglycemic effect of Nimbidiol could play a crucial role to ameliorate renal fibrosis and dysfunction in type-1 diabetes. However, we agree that further studies are required to unravel the mechanistic insight into Nimbidiol action and whether Nimbidiol directly acts on the signaling molecules of TGF-β/Smad and/or MAPK pathway to regulate diabetic renal fibrosis and dysfunction in future research.

To summarize, hyperglycemia triggers accumulation of M1 macrophages along with elevated pro-inflammatory cytokine, chemokine and pro-fibrotic factors (TNF-α, IL-1β, MCP-1 and TGF-β1), that may be contributing to the increased α-SMA and decreased E-cadherin expression indicating EMT, and elevated levels of MMP-9 and MMP-13 expression in the diabetic kidney. Together, this leads to the upregulation of Col IV and fibronectin along with excessive collagen deposition in the glomerular and tubulointerstitial regions, and degradation of vascular elastin resulting to the renal fibrosis. These pathological changes were further associated with elevated renal cortical resistive index, reduced renal cortical blood flow and decreased GFR. Nimbidiol treatment reduced macrophage-mediated inflammation and elevated expression of TGF-β1, p-Smad2/3, p-P38, p-ERK1/2 and p-JNK leading to the amelioration of adverse ECM accumulation and improvement of renal function in type-1 diabetic mice. In conclusion, our study demonstrates that glucosidase inhibitor, Nimbidiol ameliorates renal fibrosis and dysfunction in type-1 diabetes possibly by inhibiting TGF-β/Smad and MAPK signaling pathways and therefore, Nimbidiol may be developed as a promising antidiabetic drug in future.

Methods

Reagents and chemicals

Fibronectin (cat. no. ab2413; 1 µg ml−1); andTGF-β1 (cat. no. ab64715; 2 µg ml−1) were from Abcam (Cambridge, CA, UK). α-SMA (cat. no. 19245S; 1:1000), E-cadherin (cat. no. 14472S; 1:1000), Smad2/3 (cat. no.8685S; 1:1000), p-Smad2/3 (cat. no. 8828S; 1:1000), P38 (cat. no.8690S; 1:1000), p-P38 (cat. no.9211S; 1:1000), ERK1/2 (cat. no. 4695P; 1:1000), p-ERK1/2 (cat. no.4370P; 1:2000), JNK (cat. no.9252P; 1:1000) and p-JNK (cat. no.4668P; 1:1000), antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). TNF-α (cat. no.60291-1-IG; 1:2500) antibody was from Proteintech (Rosemont, IL, USA). Collagen IV (cat. no. NBP1-26549; 1:1000) antibody was from Novus Biologicals LLC (Centennial, CO, USA). MMP-9 (cat. no. MA5-15886; 1:1000), MMP-13 (cat. no. 701287; 2 µg ml−1), MCP-1 (cat. no. MA5-17040; 1:1000) and fluorescently conjugated secondary antibodies, anti-rabbit (Alexa Fluor 594, cat. no. A-11012; 2 µg ml−1), anti-mouse (Alexa Fluor 488, cat. no. A-1100; 2 µg ml−1 and Alexa Fluor 594, cat. no. A-11005; 2 µg ml−1), and anti-goat (Alexa Fluor 488, cat. no. A-11055; 2 µg ml−1) were purchased from Thermo Fisher Scientific (Waltham, MA, USA).IL-1β (cat. no. AF-401-NA; 0.25 µg ml−1) was from R&D Systems, Inc. (Minneapolis, MN, USA). Elastin (cat. no. sc-58756; 1:500), CD-40 (cat. no. sc-1731;1:500), CD-206 (cat. no. sc-34577; 1:500), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (cat. no. sc-365062; 1:1000), and all HRP-conjugated secondary antibodies, i.e., anti-mouse (cat. no. sc-516102; 1:1000), anti-rabbit (cat. no. sc-2357; 1:1000), and anti-goat (cat. no. sc-2354; 1:1000) were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). PVDF (cat. no. 1620177) membrane was purchased from Bio-Rad (Hercules, CA, USA). O.C.T. compound (cat. no. 23-730-571) was from Fisher Healthcare, (Houston, TX, USA). Bovine Serum Albumin (BSA) (cat. no. A30075) and non-fat dry milk powder (cat. no. M17200) were purchased from Research Products International Corp. (Mt. Prospect, IL, USA). Tween 20 (cat. no. M147) was from VWR Chemicals, LLC (Solon, OH, USA). Agarose (cat. no. BP-160) and mounting medium (cat. no. SP15) were purchased from Fisher Scientific (Fair Lawn, NJ, USA). DAPI (cat. no. F6057) and Nimbidiol [cat. no. SMB00209; molecular formula: ‘C17H22O3’, molecular weight: 274.35; purity: ≥ 95% (LC/MS-ELSD); IUPAC name: (4aS)-6,7-dihydroxy-1,1,4a-trimethyl-3,4,10,10a-tetrahydro-2H-phenanthren-9-one] were from Sigma-Aldrich (St. Louis, MO, USA).

Animals

C57BL/6 J wild-type (WT) (stock no. 000664) and C57BL6/‐Ins2Akita/J type-1 diabetic (Akita) (stock no. 003548) male mice aged 10–14 weeks were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). We chose male Akita mice because male mice spontaneously develop diabetes at the early age (five weeks) with high blood glucose levels while diabetes is less severe and more variable in female mice99,100. The mice were fed standard chow and water ad libitum. All animal experiments were conducted according to the protocols (Approval No. 20683, dated December 2, 2020) approved by the institutional animal care and use committee of the University of Louisville School of Medicine and conformed to the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (NIH Publication, 2011), U.S.A. Animal studies were performed in compliance with the ‘ARRIVE’ guidelines. The mice were randomly segregated into four groups, viz. WT treated with saline [WT + saline], WT treated with Nimbidiol [WT + Nimbidiol], Akita treated with saline [Akita + Saline] and Akita treated with Nimbidiol [Akita + Nimbidiol]. WT and Akita mice were treated either with saline or with Nimbidiol (0.40 mg kg−1 d−1) using micro-osmotic pump for eight weeks. At the end of the experiment (eight weeks), mice were euthanized by using 2X tribromoethanol (TBE), and blood and kidney were collected.

Micro-osmotic pump insertion

Under isoflurane anaesthesia, an incision was made along dorsal midline of the mice to form a subcutaneous pocket in the right flank using sterile forceps and blunt-tipped scissors. Saline or Nimbidiol-laden ALZET micro-osmotic pumps (Model 1004, DURECT Corporation, CA, USA) were implanted in the subcutaneous pocket for the delivery of Nimbidiol at the dose of 0.40 mg kg−1 d−1 for eight weeks.

Measurements of body weight, blood glucose and glycated haemoglobin (HbA1c) levels, and α-glucosidase activity

Body weights of the mice were measured by an electronic balance (Model: EJ-1500, A&D, CA, USA). Blood glucose levels were obtained using a blood glucose meter (Ascensia Diabetes Care, NJ, USA). Blood levels of HbA1c were measured by a ‘Mouse Hemoglobin A1c (HbA1c) Assay Kit’ (cat. no. 80310, Crystal Chem, Inc., IL, USA). Plasma α-glucosidase activity was measured by a commercially available kit (cat. no. DAGD-100, BioAssay Systems, CA, USA).

Glomerular filtration rate (GFR) measurement

Transcutaneous GFR was measured following the method described elsewhere101 with minor modifications. In brief, mice were anesthetized by isoflurane inhalation and then hair on the left dorsolateral part was shaved using a trimmer followed by topical application of Nair (Ewing, NJ). The NIC-Kidney device (Mannheim Pharma and Diagnostics, GmbH, Amtsgericht Mannheim, Germany) was gently fastened on the shaved area by an adhesive patch. FITC-sinistrin (7 mg/100 g b.w.) was injected into the femoral vein by a 32 gauge needle (TSK Laboratory, Japan) and monitored for next 2 h. MPD software (Mannheim Pharma and Diagnostics, GmbH, Amtsgericht Mannheim, Germany) was used to calculate GFR following the formula: GFR[µL/min/100 g b.w.] = 14,616.8 [µL/100 g b.w.]/t1/2(FITC-sinistrin) [min] as described previously101.

Renal ultrasound

Ultrasonography was performed to assess the renal cortical blood flow as described earlier102. In brief, the mice were subjected to isoflurane anesthesia and placed to a warm platform at 37.5 °C. Left dorsolateral part of the mouse was depilated and an acoustic gel (Other-Sonic; Pharmaceutial Innovations, Newark, NJ) was applied on the shaved skin. Vevo 2100 system (VisualSonics, Toronto, ON, Canada) was used to perform Ultrasonography. Renal cortical blood vessels of the left kidney were scanned by the transducer, MS550D (22–55 MHz). Peak systolic velocity (PSV) and end-diastolic velocity (EDV) (mm/sec) in the renal cortical blood vessels were recorded in the Pulsed-Wave Doppler mode. Resistive index (RI) of the renal cortical blood vessels was determined by analyzing the exported cine loops.

Laser Doppler flowmetry

Blood flow in the renal cortical vessels was determined by the Speckle Contrast Imager (Moor FLPI, Wilmington, DE, USA) as described previously39. Through a dorsal incision, the camera was focused on the kidney, aorta, renal artery and vein. Cortical flux units (No. of RBCs × velocity) were recorded as line traces.

Isolation of RNA and semi-quantitative RT-PCR

Total RNA was isolated from kidney using Trizol reagent (cat. no. 15596-026, Invitrogen, Carlsbad, CA, USA) and reverse-transcribed using EasyScript cDNA Synthesis kit (cat. no. G234, MidSci, St. Louis, MO, USA) as per manufacturer′s instructions. cDNA was amplified by reverse transcriptase PCR using the GoTaq Hot Start Green Master Mix (cat. no. M5122, Promega, Madison, WI, USA) following manufacturer′s protocol. The PCR product was run on 1.5% agarose gel and the bands were visualized under UV light using a ChemiDoc XRS system (Bo-Rad, Hercules, CA). The expression of the gene was normalized with GAPDH. The band intensity was quantified by densitometry using ‘ImageJ’ software (Supplementary Information 1). The primer sequences (Invitrogen, Carlsbad, CA, USA) are mentioned in Table 1.

Table 1.

Primer sequences used for semi-quantitative RT-PCR analysis.

Forward Reverse
Col IV 5′GACCACTATGCTTGAAGTGA3′ 5′ACAGAAGGCCTTAGTAGTCT3′
Fibronectin 5′TTGTTCGGTGGAGTAGACCC3′ 5′TTCAGGGAGGTTGAGCTCTG3′
Elastin 5′TGACAGTATAGGGCTGAGCA3′ 5′GAGTTGTTGTGGGTGAGACA3′
MMP-9 5′CACACGACATCTTCCAGTACCA3′ 5′TCATTTTGGAAACTCACACGCC3′
MMP-13 5′CAGTTGACAGGCTCCGAGAA3′ 5′TTCACCCACATCAGGCACTC3′
CD40 5′ACTGATACCGTCTGTCATCC3′ 5′CTTATCCTCACAGCTTGTCC3′
CD206 5′TGTTGATTGTTGATTGCCAC3′ 5′ACCAGTGTAGCAGTGTTAAG3′
α-SMA 5′CTATGTGTGAAGAGGAAGACA3′ 5′CATTCCAACCATTACTCCCT3′
E-cadherin 5′GGATCAGGACCAGGACTACG3′ 5′AGCTTCTTGAATCGGTTGCC3′
TNF-α 5′GATCGGTCCCCAAAGGGATG3′ 5′GGCTACAGGCTTGTCACTCG3′
IL-1β 5′TCCCTTTTCGTGAATGAGCAGA3′ 5′GGAGGAAAACACAGGCTCTCTT3′
MCP-1 5′ACCACCTCAAGCACTTCTGTAG3′ 5′TTAAGGCATCACAGTCCGAGTC3′
GAPDH 5′GTCAAGGCCGAGAATGGGAA3′ 5′GGCCTCACCCCATTTGATGT3′

Immunoblotting

An equal amount of protein was electrophoresed by sodium dodecyl sulphate- polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred onto the polyvinylidine difluoride (PVDF) membrane. 5% non-fat dry milk or BSA (for the detection of phosphorylated proteins) in TBST was used to block the membrane for 1 h at room temperature and standard immunoblotting was performed as described earlier1. GAPDH was used as a reference to normalize the expression of the protein. Densitometric analysis was performed to quantify the band intensity using ′ImageJ′ software (Supplementary Information 1).

Hematoxylin and Eosin (H&E) staining

Neutral buffered formaldehyde-fixed, paraffin-embedded kidneys were cut at 5 μm thickness. The kidney sections were stained with hematoxylin (cat. no. 95057-844, VWR International, PA, USA) and eosin (cat. no. 26396-07, Electron Microscopy Sciences, PA, USA), and the histopathological changes were observed under an EVOS FL Automated System (Life Technologies, Inc., Grand Island, NY, USA).

Periodic Acid-Schiff (PAS) staining

For PAS staining, 5-μm-thcik kidney sections were used to stain with ‘Periodic Acid Schiff Stain Kit’ (ES3400-IFU, Azer Scientific, PA, USA) according to the manufacturer′s instructions. Briefly, the sections were deparaffinized and hydrated to distilled water and incubated in Periodic Acid Solution for 10 min at room temperature. After rinsing in distilled water, the sections were immersed in Schiff’s Solution for 15 min. Slides were then rinsed in hot running tap water and distilled water followed by counterstaining with Mayer′s hematoxylin for 2‒3 min. After rinsing in running tap water, the slides were subjected to Bluing Reagent for 30 s. The slides were then rinsed in distilled water, dehydrated through graded alcohols, and mounted. The histopathological changes were evaluated under the EVOS FL Automated System (Life Technologies, Inc., Grand Island, NY, USA).

Collagen staining

Collagen deposition in the kidney was analyzed by using a ‘Masson trichrome stain kit’ (cat. no. 87019, Richard-Allan Scientific, Kalamazoo, MI, USA). The kidney sections of 5 μm thickness were stained according to the manufacturer′s instructions. An EVOS FL Automated System (Life Technologies, Inc., Grand Island, NY, USA) was used to capture the images, and analyzed by ‘ImageJ’ software.

Elastin staining

The kidney sections of 5 μm thickness were stained with an ‘Elastic stain kit’ (cat. no. 87017, Richard-Allan Scientific, Kalamazoo, MI, USA) as per manufacturer’s instructions. In brief, sections were deparaffinized and hydrated to deionized water followed by stained with ‘working elastic stain solution’ for 15–20 min. Excess stain was rinsed off with running tap water and the sections were decolorized with ‘working differentiating solution’. Slides were rinsed in tap water and then placed in ‘Sodium thiosulfate solution’ for 1 min. The sections were rinsed in deionized water and stained in ‘Van Gieson stain solution’ for 1 min. The sections were dehydrated and slides were mounted. The images were acquired using an EVOS FL Automated System (Life Technologies, Inc., Grand Island, NY, USA), and analyzed by ‘ImageJ’ software.

Immunohistochemistry

The kidney cryosections of 5 μm thickness were fixed with freshly prepared 4% paraformaldehyde for 20 min. The sections were blocked with 1% BSA in PBS-T for 1 h at room temperature, and incubated overnight at 4 °C with appropriate primary antibody. Tissue sections were further incubated with corresponding Alexa Fluor 488 and/or 594-conjugated secondary antibodies (Invitrogen, Carlsbad, CA, USA) for 90 min at room temperature. An Olympus FluoView1000 laser scanning confocal microscope (B&B Microscope, Pittsburgh, PA, USA) was used to capture the images, and ‘ImageJ’ software was used to quantify the fluorescence intensity.

Statistical analysis

Data are presented as mean ± standard deviation (SD) from 6 mice per group. The significance of difference between the means of different groups was determined by ANOVA followed by Tukey’s post hoc test. P < 0.05 was considered as significant.

Supplementary Information

Acknowledgements

This study was supported by the grants, ‘DK104653’ and ‘DK116591’ from National Institutes of Health to U.S.

Author contributions

S.K.J. and U.S. designed the project; S.K.J. carried out the experiments, acquired data, performed analysis, wrote and edited the manuscript; S.P. contributed to the data acquisition and analysis; S.C.T. contributed to the research design; U.S. edited and finalized the manuscript; all authors have read and approved the manuscript.

Data availability

The data presented in this study are available on request from the corresponding author.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-022-25848-1.

References

  • 1.Juin SK, Pushpakumar S, Sen U. GYY4137 regulates extracellular matrix turnover in the diabetic kidney by modulating retinoid X receptor signaling. Biomolecules. 2021 doi: 10.3390/biom11101477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Grutzmacher C, et al. Aberrant production of extracellular matrix proteins and dysfunction in kidney endothelial cells with a short duration of diabetes. Am. J. Physiol. Renal Physiol. 2013;304:F19–30. doi: 10.1152/ajprenal.00036.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Tramonti G, Kanwar YS. Tubular biomarkers to assess progression of diabetic nephropathy. Kidney Int. 2011;79:1042–1044. doi: 10.1038/ki.2011.9. [DOI] [PubMed] [Google Scholar]
  • 4.Kundu S, Pushpakumar S, Sen U. MMP-9- and NMDA receptor-mediated mechanism of diabetic renovascular remodeling and kidney dysfunction: Hydrogen sulfide is a key modulator. Nitric Oxide. 2015;46:172–185. doi: 10.1016/j.niox.2015.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cheng Z, Tu J, Zhang H, Zhang Y, Zhou B. Urolithin a attenuates renal fibrosis by inhibiting TGF-β1/Smad and MAPK signaling pathways. J. Funct. Foods. 2021 doi: 10.1016/j.jff.2021.104547. [DOI] [Google Scholar]
  • 6.Tan RJ, Liu Y. Matrix metalloproteinases in kidney homeostasis and diseases. Am. J. Physiol. Renal Physiol. 2012;302:F1351–1361. doi: 10.1152/ajprenal.00037.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wynn TA, Ramalingam TR. Mechanisms of fibrosis: Therapeutic translation for fibrotic disease. Nat. Med. 2012;18:1028–1040. doi: 10.1038/nm.2807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Sato Y, Yanagita M. Resident fibroblasts in the kidney: A major driver of fibrosis and inflammation. Inflamm Regen. 2017;37:17. doi: 10.1186/s41232-017-0048-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Tang PM, Nikolic-Paterson DJ, Lan HY. Macrophages: Versatile players in renal inflammation and fibrosis. Nat. Rev. Nephrol. 2019;15:144–158. doi: 10.1038/s41581-019-0110-2. [DOI] [PubMed] [Google Scholar]
  • 10.Chung CH, et al. Effects of tumor necrosis factor-alpha on podocyte expression of monocyte chemoattractant Protein-1 and in diabetic nephropathy. Nephron Extra. 2015;5:1–18. doi: 10.1159/000369576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Meng XM, Mak TS, Lan HY. Macrophages in renal fibrosis. Adv. Exp. Med. Biol. 2019;1165:285–303. doi: 10.1007/978-981-13-8871-2_13. [DOI] [PubMed] [Google Scholar]
  • 12.Ohta MY, Nagai Y, Takamura T, Nohara E, Kobayashi K. Inhibitory effect of troglitazone on tumor necrosis factor alpha-induced expression of monocyte chemoattractant protein-1 in human mesangial cells. Metabolism. 2000;49:163–166. doi: 10.1016/s0026-0495(00)91143-0. [DOI] [PubMed] [Google Scholar]
  • 13.Meng XM, Tang PM, Li J, Lan HY. TGF-beta/Smad signaling in renal fibrosis. Front. Physiol. 2015;6:82. doi: 10.3389/fphys.2015.00082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Meng XM, Nikolic-Paterson DJ, Lan HY. Inflammatory processes in renal fibrosis. Nat. Rev. Nephrol. 2014;10:493–503. doi: 10.1038/nrneph.2014.114. [DOI] [PubMed] [Google Scholar]
  • 15.Nikolic-Paterson DJ, Wang S, Lan HY. Macrophages promote renal fibrosis through direct and indirect mechanisms. Kidney Int. Suppl. 2014;2011(4):34–38. doi: 10.1038/kisup.2014.7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Falke LL, Gholizadeh S, Goldschmeding R, Kok RJ, Nguyen TQ. Diverse origins of the myofibroblast-implications for kidney fibrosis. Nat. Rev. Nephrol. 2015;11:233–244. doi: 10.1038/nrneph.2014.246. [DOI] [PubMed] [Google Scholar]
  • 17.Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J. Clin. Invest. 2009;119:1420–1428. doi: 10.1172/JCI39104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Essawy M, et al. Myofibroblasts and the progression of diabetic nephropathy. Nephrol. Dial. Transplant. 1997;12:43–50. doi: 10.1093/ndt/12.1.43. [DOI] [PubMed] [Google Scholar]
  • 19.Ng YY, et al. Glomerular epithelial-myofibroblast transdifferentiation in the evolution of glomerular crescent formation. Nephrol. Dial. Transplant. 1999;14:2860–2872. doi: 10.1093/ndt/14.12.2860. [DOI] [PubMed] [Google Scholar]
  • 20.Ng YY, et al. Tubular epithelial-myofibroblast transdifferentiation in progressive tubulointerstitial fibrosis in 5/6 nephrectomized rats. Kidney Int. 1998;54:864–876. doi: 10.1046/j.1523-1755.1998.00076.x. [DOI] [PubMed] [Google Scholar]
  • 21.Kim SI, Choi ME. TGF-beta-activated kinase-1: New insights into the mechanism of TGF-beta signaling and kidney disease. Kidney Res. Clin. Pract. 2012;31:94–105. doi: 10.1016/j.krcp.2012.04.322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kluger MA, et al. Leukocyte-derived MMP9 is crucial for the recruitment of proinflammatory macrophages in experimental glomerulonephritis. Kidney Int. 2013;83:865–877. doi: 10.1038/ki.2012.483. [DOI] [PubMed] [Google Scholar]
  • 23.Wang X, et al. Mice lacking the matrix metalloproteinase-9 gene reduce renal interstitial fibrosis in obstructive nephropathy. Am. J. Physiol. Renal Physiol. 2010;299:F973–982. doi: 10.1152/ajprenal.00216.2010. [DOI] [PubMed] [Google Scholar]
  • 24.Tan TK, et al. Macrophage matrix metalloproteinase-9 mediates epithelial-mesenchymal transition in vitro in murine renal tubular cells. Am. J. Pathol. 2010;176:1256–1270. doi: 10.2353/ajpath.2010.090188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.John A, et al. GYY4137, a hydrogen sulfide donor modulates miR194-dependent collagen realignment in diabetic kidney. Sci. Rep. 2017;7:10924. doi: 10.1038/s41598-017-11256-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Li SY, et al. Matrix metalloproteinase-9 deficiency attenuates diabetic nephropathy by modulation of podocyte functions and dedifferentiation. Kidney Int. 2014;86:358–369. doi: 10.1038/ki.2014.67. [DOI] [PubMed] [Google Scholar]
  • 27.Mukherjee A, Sengupta S. Characterization of nimbidiol as a potent intestinal disaccharidase and glucoamylase inhibitor present in Azadirachta indica (neem) useful for the treatment of diabetes. J. Enzyme Inhib. Med. Chem. 2013;28:900–910. doi: 10.3109/14756366.2012.694877. [DOI] [PubMed] [Google Scholar]
  • 28.Nagini S, Nivetha R, Palrasu M, Mishra R. Nimbolide, a neem limonoid, is a promising candidate for the anticancer drug arsenal. J. Med. Chem. 2021;64:3560–3577. doi: 10.1021/acs.jmedchem.0c02239. [DOI] [PubMed] [Google Scholar]
  • 29.Pingali U, Ali MA, Gundagani S, Nutalapati C. Evaluation of the effect of an aqueous extract of Azadirachta indica (Neem) leaves and twigs on glycemic control, endothelial dysfunction and systemic inflammation in subjects with Type 2 diabetes mellitus—A randomized, double-blind, placebo-controlled clinical study. Diabetes Metab. Syndr. Obes. 2020;13:4401–4412. doi: 10.2147/DMSO.S274378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Yadav DK, et al. Tamarixetin 3-O-beta-d-glucopyranoside from Azadirachta indica leaves: Gastroprotective role through inhibition of matrix metalloproteinase-9 activity in mice. J. Nat. Prod. 2017;80:1347–1353. doi: 10.1021/acs.jnatprod.6b00957. [DOI] [PubMed] [Google Scholar]
  • 31.Kudalkar MD, Nayak A, Bhat KS, Nayak RN. Effect of Azadirachta indica (Neem) and aloe vera as compared to subantimicrobial dose doxycycline on matrix metalloproteinases (MMP)-2 and MMP-9: An in-vitro study. Ayu. 2014;35:85–89. doi: 10.4103/0974-8520.141947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Babykutty S, et al. Nimbolide retards tumor cell migration, invasion, and angiogenesis by downregulating MMP-2/9 expression via inhibiting ERK1/2 and reducing DNA-binding activity of NF-kappaB in colon cancer cells. Mol. Carcinog. 2012;51:475–490. doi: 10.1002/mc.20812. [DOI] [PubMed] [Google Scholar]
  • 33.Chugh NA, Koul A. Altered presence of extra cellular matrix components in murine skin cancer: Modulation by Azadirachta indica leaf extract. J. Tradit. Complement Med. 2021;11:197–208. doi: 10.1016/j.jtcme.2020.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Arumugam A, Subramani R, Lakshmanaswamy R. Involvement of actin cytoskeletal modifications in the inhibition of triple-negative breast cancer growth and metastasis by nimbolide. Mol. Ther. Oncolytics. 2021;20:596–606. doi: 10.1016/j.omto.2021.02.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Annaldas S, Saifi MA, Khurana A, Godugu C. Nimbolide ameliorates unilateral ureteral obstruction-induced renal fibrosis by inhibition of TGF-beta and EMT/Slug signalling. Mol. Immunol. 2019;112:247–255. doi: 10.1016/j.molimm.2019.06.003. [DOI] [PubMed] [Google Scholar]
  • 36.Munir KM, Davis SN. The treatment of type 1 diabetes mellitus with agents approved for type 2 diabetes mellitus. Expert Opin. Pharmacother. 2015;16:2331–2341. doi: 10.1517/14656566.2015.1084502. [DOI] [PubMed] [Google Scholar]
  • 37.Youssef DM, Fawzy FM. Value of renal resistive index as an early marker of diabetic nephropathy in children with type-1 diabetes mellitus. Saudi J Kidney Dis. Transpl. 2012;23:985–992. doi: 10.4103/1319-2442.100880. [DOI] [PubMed] [Google Scholar]
  • 38.Jerums G, et al. New and old markers of progression of diabetic nephropathy. Diabetes Res. Clin. Pract. 2008;82(Suppl 1):S30–37. doi: 10.1016/j.diabres.2008.09.032. [DOI] [PubMed] [Google Scholar]
  • 39.Pushpakumar S, Kundu S, Sen U. Hydrogen sulfide protects hyperhomocysteinemia-induced renal damage by modulation of caveolin and eNOS interaction. Sci. Rep. 2019;9:2223. doi: 10.1038/s41598-018-38467-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Hanamura K, Tojo A, Kinugasa S, Asaba K, Fujita T. The resistive index is a marker of renal function, pathology, prognosis, and responsiveness to steroid therapy in chronic kidney disease patients. Int. J. Nephrol. 2012;2012:139565. doi: 10.1155/2012/139565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Zeisberg M, Maeshima Y, Mosterman B, Kalluri R. Renal fibrosis. Extracellular matrix microenvironment regulates migratory behavior of activated tubular epithelial cells. Am. J. Pathol. 2002;160:2001–2008. doi: 10.1016/S0002-9440(10)61150-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kundu S, Pushpakumar SB, Tyagi A, Coley D, Sen U. Hydrogen sulfide deficiency and diabetic renal remodeling: Role of matrix metalloproteinase-9. Am. J. Physiol. Endocrinol. Metab. 2013;304:E1365–1378. doi: 10.1152/ajpendo.00604.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Qing-Hua G, et al. The kidney expression of matrix metalloproteinase-9 in the diabetic nephropathy of Kkay mice. J. Diabetes Complicat. 2008;22:408–412. doi: 10.1016/j.jdiacomp.2007.10.002. [DOI] [PubMed] [Google Scholar]
  • 44.Zhang XL, Guo YF, Song ZX, Zhou M. Vitamin D prevents podocyte injury via regulation of macrophage M1/M2 phenotype in diabetic nephropathy rats. Endocrinology. 2014;155:4939–4950. doi: 10.1210/en.2014-1020. [DOI] [PubMed] [Google Scholar]
  • 45.Cochrane AL, et al. Renal structural and functional repair in a mouse model of reversal of ureteral obstruction. J. Am. Soc. Nephrol. 2005;16:3623–3630. doi: 10.1681/ASN.2004090771. [DOI] [PubMed] [Google Scholar]
  • 46.Nelson CL, et al. Systemic and vascular inflammation is elevated in early IgA and type 1 diabetic nephropathies and relates to vascular disease risk factors and renal function. Nephrol. Dial. Transplant. 2005;20:2420–2426. doi: 10.1093/ndt/gfi067. [DOI] [PubMed] [Google Scholar]
  • 47.Li Q, Li K, Chen Z, Zhou B. Anti-renal fibrosis and anti-inflammation effect of urolithin B, ellagitannin-gut microbial-derived metabolites in unilateral ureteral obstruction rats. J. Funct. Foods. 2020 doi: 10.1016/j.jff.2019.103748. [DOI] [Google Scholar]
  • 48.Sanni O, et al. Azadirachta indica inhibits key enzyme linked to type 2 diabetes in vitro, abates oxidative hepatic injury and enhances muscle glucose uptake ex vivo. Biomed. Pharmacother. 2019;109:734–743. doi: 10.1016/j.biopha.2018.10.171. [DOI] [PubMed] [Google Scholar]
  • 49.Perez-Gutierrez RM, Damian-Guzman M. Meliacinolin: A potent alpha-glucosidase and alpha-amylase inhibitor isolated from Azadirachta indica leaves and in vivo antidiabetic property in streptozotocin-nicotinamide-induced type 2 diabetes in mice. Biol. Pharm. Bull. 2012;35:1516–1524. doi: 10.1248/bpb.b12-00246. [DOI] [PubMed] [Google Scholar]
  • 50.Bhat M, Kothiwale SK, Tirmale AR, Bhargava SY, Joshi BN. Antidiabetic properties of Azardiracta indica and bougainvillea spectabilis: In vivo studies in murine diabetes model. Evid. Based Complement Alternat. Med. 2011;2011:561625. doi: 10.1093/ecam/nep033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Khosla P, Bhanwra S, Singh J, Seth S, Srivastava RK. A study of hypoglycaemic effects of Azadirachta indica (Neem) in normaland alloxan diabetic rabbits. Indian J. Physiol. Pharmacol. 2000;44:69–74. [PubMed] [Google Scholar]
  • 52.Jun JY, Ma Z, Segar L. Spontaneously diabetic Ins2(+/Akita):apoE-deficient mice exhibit exaggerated hypercholesterolemia and atherosclerosis. Am. J. Physiol. Endocrinol. Metab. 2011;301:E145–154. doi: 10.1152/ajpendo.00034.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Zhang L, et al. High glucose induces renal mesangial cell proliferation and fibronectin expression through JNK/NF-kappaB/NADPH oxidase/ROS pathway, which is inhibited by resveratrol. Int. J. Biochem. Cell. Biol. 2012;44:629–638. doi: 10.1016/j.biocel.2012.01.001. [DOI] [PubMed] [Google Scholar]
  • 54.Yoshioka M, Kayo T, Ikeda T, Koizumi A. A novel locus, Mody4, distal to D7Mit189 on chromosome 7 determines early-onset NIDDM in nonobese C57BL/6 (Akita) mutant mice. Diabetes. 1997;46:887–894. doi: 10.2337/diab.46.5.887. [DOI] [PubMed] [Google Scholar]
  • 55.Ohta Y, et al. Increased renal resistive index in atherosclerosis and diabetic nephropathy assessed by Doppler sonography. J. Hypertens. 2005;23:1905–1911. doi: 10.1097/01.hjh.0000181323.44162.01. [DOI] [PubMed] [Google Scholar]
  • 56.Bige N, et al. Renal arterial resistive index is associated with severe histological changes and poor renal outcome during chronic kidney disease. BMC Nephrol. 2012;13:139. doi: 10.1186/1471-2369-13-139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Qian Y, Feldman E, Pennathur S, Kretzler M, Brosius FC., 3rd From fibrosis to sclerosis: Mechanisms of glomerulosclerosis in diabetic nephropathy. Diabetes. 2008;57:1439–1445. doi: 10.2337/db08-0061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Mason RM, Wahab NA. Extracellular matrix metabolism in diabetic nephropathy. J. Am. Soc. Nephrol. 2003;14:1358–1373. doi: 10.1097/01.asn.0000065640.77499.d7. [DOI] [PubMed] [Google Scholar]
  • 59.Liu Y. Epithelial to mesenchymal transition in renal fibrogenesis: Pathologic significance, molecular mechanism, and therapeutic intervention. J. Am. Soc. Nephrol. 2004;15:1–12. doi: 10.1097/01.asn.0000106015.29070.e7. [DOI] [PubMed] [Google Scholar]
  • 60.Yang J, Liu Y. Blockage of tubular epithelial to myofibroblast transition by hepatocyte growth factor prevents renal interstitial fibrosis. J. Am. Soc. Nephrol. 2002;13:96–107. doi: 10.1681/ASN.V13196. [DOI] [PubMed] [Google Scholar]
  • 61.Oldfield MD, et al. Advanced glycation end products cause epithelial-myofibroblast transdifferentiation via the receptor for advanced glycation end products (RAGE) J. Clin. Invest. 2001;108:1853–1863. doi: 10.1172/JCI11951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Yang J, Liu Y. Dissection of key events in tubular epithelial to myofibroblast transition and its implications in renal interstitial fibrosis. Am. J. Pathol. 2001;159:1465–1475. doi: 10.1016/S0002-9440(10)62533-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Zakiyanov O, Kalousova M, Zima T, Tesar V. Matrix metalloproteinases in renal diseases: A critical appraisal. Kidney Blood Press Res. 2019;44:298–330. doi: 10.1159/000499876. [DOI] [PubMed] [Google Scholar]
  • 64.Nakamura T, et al. Urinary excretion of podocytes in patients with diabetic nephropathy. Nephrol. Dial.Transplant. 2000;15:1379–1383. doi: 10.1093/ndt/15.9.1379. [DOI] [PubMed] [Google Scholar]
  • 65.Mott JD, et al. Nonenzymatic glycation of type IV collagen and matrix metalloproteinase susceptibility. Kidney Int. 1997;52:1302–1312. doi: 10.1038/ki.1997.455. [DOI] [PubMed] [Google Scholar]
  • 66.Zhao H, et al. Matrix metalloproteinases contribute to kidney fibrosis in chronic kidney diseases. World J. Nephrol. 2013;2:84–89. doi: 10.5527/wjn.v2.i3.84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Kalluri R, Neilson EG. Epithelial-mesenchymal transition and its implications for fibrosis. J. Clin. Invest. 2003;112:1776–1784. doi: 10.1172/JCI20530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Zeisberg M, et al. Renal fibrosis: collagen composition and assembly regulates epithelial-mesenchymal transdifferentiation. Am. J. Pathol. 2001;159:1313–1321. doi: 10.1016/S0002-9440(10)62518-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Tan TK, et al. Matrix metalloproteinase-9 of tubular and macrophage origin contributes to the pathogenesis of renal fibrosis via macrophage recruitment through osteopontin cleavage. Lab. Invest. 2013;93:434–449. doi: 10.1038/labinvest.2013.3. [DOI] [PubMed] [Google Scholar]
  • 70.Surse VM, Gupta J, Tikoo K. Esculetin induced changes in Mmp13 and Bmp6 gene expression and histone H3 modifications attenuate development of glomerulosclerosis in diabetic rats. J. Mol. Endocrinol. 2011;46:245–254. doi: 10.1530/JME-10-0154. [DOI] [PubMed] [Google Scholar]
  • 71.Liu Y, Beyer A, Aebersold R. On the dependency of cellular protein levels on mRNA abundance. Cell. 2016;165:535–550. doi: 10.1016/j.cell.2016.03.014. [DOI] [PubMed] [Google Scholar]
  • 72.Greenbaum D, Colangelo C, Williams K, Gerstein M. Comparing protein abundance and mRNA expression levels on a genomic scale. Genome Biol. 2003;4:117. doi: 10.1186/gb-2003-4-9-117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Maier T, Guell M, Serrano L. Correlation of mRNA and protein in complex biological samples. FEBS Lett. 2009;583:3966–3973. doi: 10.1016/j.febslet.2009.10.036. [DOI] [PubMed] [Google Scholar]
  • 74.Morris J, et al. The highly pure neem leaf extract, SCNE, inhibits tumorigenesis in oral squamous cell carcinoma via disruption of pro-tumor inflammatory cytokines and cell signaling. Front. Oncol. 2019;9:890. doi: 10.3389/fonc.2019.00890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Elumalai P, et al. Nimbolide inhibits invasion and migration, and down-regulates uPAR chemokine gene expression, in two breast cancer cell lines. Cell Prolif. 2014;47:540–552. doi: 10.1111/cpr.12148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Gupta SC, et al. Modification of cysteine 179 of IkappaBalpha kinase by nimbolide leads to down-regulation of NF-kappaB-regulated cell survival and proliferative proteins and sensitization of tumor cells to chemotherapeutic agents. J. Biol. Chem. 2010;285:35406–35417. doi: 10.1074/jbc.M110.161984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Lemos DR, et al. Interleukin-1beta activates a MYC-dependent metabolic switch in kidney stromal cells necessary for progressive tubulointerstitial fibrosis. J. Am. Soc. Nephrol. 2018;29:1690–1705. doi: 10.1681/ASN.2017121283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Therrien FJ, Agharazii M, Lebel M, Lariviere R. Neutralization of tumor necrosis factor-alpha reduces renal fibrosis and hypertension in rats with renal failure. Am. J. Nephrol. 2012;36:151–161. doi: 10.1159/000340033. [DOI] [PubMed] [Google Scholar]
  • 79.Jones LK, et al. IL-1RI deficiency ameliorates early experimental renal interstitial fibrosis. Nephrol. Dial. Transplant. 2009;24:3024–3032. doi: 10.1093/ndt/gfp214. [DOI] [PubMed] [Google Scholar]
  • 80.Goswami KK, et al. Targeting STAT3 phosphorylation by neem leaf glycoprotein prevents immune evasion exerted by supraglottic laryngeal tumor induced M2 macrophages. Mol. Immunol. 2014;59:119–127. doi: 10.1016/j.molimm.2014.01.015. [DOI] [PubMed] [Google Scholar]
  • 81.Hu HH, et al. New insights into TGF-beta/Smad signaling in tissue fibrosis. Chem. Biol. Interact. 2018;292:76–83. doi: 10.1016/j.cbi.2018.07.008. [DOI] [PubMed] [Google Scholar]
  • 82.Wu CF, et al. Transforming growth factor beta-1 stimulates profibrotic epithelial signaling to activate pericyte-myofibroblast transition in obstructive kidney fibrosis. Am. J. Pathol. 2013;182:118–131. doi: 10.1016/j.ajpath.2012.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Meng XM, Chung AC, Lan HY. Role of the TGF-beta/BMP-7/Smad pathways in renal diseases. Clin. Sci. (Lond.) 2013;124:243–254. doi: 10.1042/CS20120252. [DOI] [PubMed] [Google Scholar]
  • 84.Lopez-Hernandez FJ, Lopez-Novoa JM. Role of TGF-beta in chronic kidney disease: An integration of tubular, glomerular and vascular effects. Cell Tissue Res. 2012;347:141–154. doi: 10.1007/s00441-011-1275-6. [DOI] [PubMed] [Google Scholar]
  • 85.Samarakoon R, Overstreet JM, Higgins SP, Higgins PJ. TGF-beta1 –> SMAD/p53/USF2 –> PAI-1 transcriptional axis in ureteral obstruction-induced renal fibrosis. Cell Tissue Res. 2012;347:117–128. doi: 10.1007/s00441-011-1181-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Schwalm S, et al. Sphingosine kinase-2 deficiency ameliorates kidney fibrosis by up-regulating smad7 in a mouse model of unilateral ureteral obstruction. Am. J. Pathol. 2017;187:2413–2429. doi: 10.1016/j.ajpath.2017.06.017. [DOI] [PubMed] [Google Scholar]
  • 87.Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature. 2003;425:577–584. doi: 10.1038/nature02006. [DOI] [PubMed] [Google Scholar]
  • 88.Massague J. TGFbeta signalling in context. Nat. Rev. Mol. Cell Biol. 2012;13:616–630. doi: 10.1038/nrm3434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Park JH, et al. Pomolic acid ameliorates fibroblast activation and renal interstitial fibrosis through inhibition of SMAD-STAT signaling pathways. Molecules. 2018 doi: 10.3390/molecules23092236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Chevalier RL. Obstructive nephropathy: Towards biomarker discovery and gene therapy. Nat. Clin. Pract. Nephrol. 2006;2:157–168. doi: 10.1038/ncpneph0098. [DOI] [PubMed] [Google Scholar]
  • 91.Bansod S, Aslam Saifi M, Khurana A, Godugu C. Nimbolide abrogates cerulein-induced chronic pancreatitis by modulating beta-catenin/Smad in a sirtuin-dependent way. Pharmacol. Res. 2020;156:104756. doi: 10.1016/j.phrs.2020.104756. [DOI] [PubMed] [Google Scholar]
  • 92.Diddi S, Bale S, Pulivendala G, Godugu C. Nimbolide ameliorates fibrosis and inflammation in experimental murine model of bleomycin-induced scleroderma. Inflammopharmacology. 2019;27:139–149. doi: 10.1007/s10787-018-0527-4. [DOI] [PubMed] [Google Scholar]
  • 93.Shin SS, et al. Nimbolide represses the proliferation, migration, and invasion of bladder carcinoma cells via Chk2-mediated G2/M phase cell cycle arrest, altered signaling pathways, and reduced transcription factors-associated MMP-9 expression. Evid. Based Complement. Alternat. Med. 2019;2019:3753587. doi: 10.1155/2019/3753587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Chien SY, et al. Nimbolide induces apoptosis in human nasopharyngeal cancer cells. Environ. Toxicol. 2017;32:2085–2092. doi: 10.1002/tox.22423. [DOI] [PubMed] [Google Scholar]
  • 95.Zhang Y, et al. Signaling pathways involved in diabetic renal fibrosis. Front. Cell Dev. Biol. 2021;9:696542. doi: 10.3389/fcell.2021.696542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Huang JS, et al. Klotho attenuates high glucose-induced fibronectin and cell hypertrophy via the ERK1/2-p38 kinase signaling pathway in renal interstitial fibroblasts. Mol. Cell Endocrinol. 2014;390:45–53. doi: 10.1016/j.mce.2014.04.001. [DOI] [PubMed] [Google Scholar]
  • 97.Rane MJ, et al. Interplay between Akt and p38 MAPK pathways in the regulation of renal tubular cell apoptosis associated with diabetic nephropathy. Am. J. Physiol. Renal Physiol. 2010;298:F49–61. doi: 10.1152/ajprenal.00032.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Qian X, et al. Novel hydrogen sulfide-releasing compound, S-propargyl-cysteine, prevents STZ-induced diabetic nephropathy. Biochem. Biophys. Res. Commun. 2016;473:931–938. doi: 10.1016/j.bbrc.2016.03.154. [DOI] [PubMed] [Google Scholar]
  • 99.Hu P, et al. Type 1 diabetic Akita mice have low bone mass and impaired fracture healing. Bone. 2021;147:115906. doi: 10.1016/j.bone.2021.115906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Pendse AA, Johnson LA, Tsai YS, Maeda N. Pparg-P465L mutation worsens hyperglycemia in Ins2-Akita female mice via adipose-specific insulin resistance and storage dysfunction. Diabetes. 2010;59:2890–2897. doi: 10.2337/db10-0673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Schreiber A, et al. Transcutaneous measurement of renal function in conscious mice. Am. J. Physiol. Renal Physiol. 2012;303:F783–788. doi: 10.1152/ajprenal.00279.2012. [DOI] [PubMed] [Google Scholar]
  • 102.Pushpakumar S, et al. Methylation-dependent antioxidant-redox imbalance regulates hypertensive kidney injury in aging. Redox Biol. 2020;37:101754. doi: 10.1016/j.redox.2020.101754. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The data presented in this study are available on request from the corresponding author.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES