Abstract
The ecology of soil fungi is poorly understood, and recent comprehensive reports on Trichoderma are unavailable for any region, including the Zoige alpine wetland ecological region in China. One hundred soil samples were collected from different soil types and soil layers in Zoige alpine wetland ecological regions. Using the traditional suspension plating method, 80 Trichoderma strains were chosen to analyze species diversity. After a preliminary classification of morphological characteristics and the genes glyceraldehyde-3-phosphate dehydrogenase (gpd), 57 representative strains were selected and eventually identified as seven species via phylogenetic analyses of multilocus sequences based on the genes transcription elongation factor 1 alpha (tef1), encoding RNA polymerase II subunit B (rpb2) and ATP citrate lyase (acl1). Among them, T. harzianum was the dominant species isolated from five soil layers and four soil types, and had the highest isolation frequency (23%) in this zone, while T. polysporum and T. pyramidale were rare species, with isolation frequencies of less than 1%. Our detailed morphological observation and molecular phylogenetic analyses support the recognition of Trichoderma zoigense was described for the first time as a new species, while T. atrobrunneum as a new record for China was found. Our results will be used as a reference for a greater understanding of soil microbial resources, ecological rehabilitation and reconstructions in the Zoige alpine wetland.
Subject terms: Fungal genetics, Biodiversity, Eukaryote
Introduction
As an essential member of the soil microflora, soil fungi (along with other microorganisms) participate in the material cycle and energy flow in ecosystems. Fungi play an especially vital role in organic decomposition, carbon and nitrogen storage, biogeochemical cycles, soil stabilization, and plant parasitism1–5, and fungal diversity has been recognized as a critical indicator of soil health6,7. Research on the soil ecological environment, especially on the diversity of fungi in some important ecological regions, has recently gained much attention. More specifically, the role of soil microorganisms in promoting the regulatory mechanism of plant communities has become increasingly recognized. Thus, the microbial diversity on the surface and subsurface has remained a significant theme on recent ecological research8. For instance, in China, fungal flora and soil diversity have been reported in the Changbai Mountains, three nature reserves in Jiuzhaigou County, and Mount Gongga9,10.
The genus Trichoderma, which includes more than 200 species in various geographical regions and climatic zones around the world, a number that is regularly increasing11–13, is the most common fungi in soil and rotting wood14,15. Trichoderma have a fine metabolic regulation that is able to respond to environmental changes and to nutrient and oxygen limitations. They therefore produce a range of enzymes to degrade homopolysaccharides and heteropolysaccharides, which are important carbon sink ecosystem. Some species of Trichoderma have a powerful phosphate-solubilizing ability, whereas other species act as industrial enzymes for the preparation of cellulose, hemicellulase, xylanase, chitinase, protease, and antibiotics in agricultural production16–22. In addition, the genus has been confirmed to be associated with the ability to control plant pathogens, promote plant growth, stimulate plant immunity and remediate soil contaminants23–26.
Hypocrea and Trichoderma were once treated as two separate genera, although studies by the Tulasne brothers indicated that Hypocrea is a sexual morph (teleomorph) of Trichoderma. Combining Hypocrea and Trichoderma, Doi et al.27–38 summarized previously reported species and revised nearly 50 new species of the genus based primarily on morphological characteristics. However, distinguishing Trichoderma species using traditional morphological methods is difficult and inaccurate39. Due to the overlap between intraspecific and interspecific sequence differences in the nuclear rDNA ITS region, it is not suitable for multiple gene identification. Multiple molecular techniques have been applied for identifying Trichoderma; for example the genes encoding RNA polymerase II subunit B (rpb2), transcription elongation factor 1 alpha (tef1) and ATP citrate lyase (acl1) have commonly been used either individually or in combination40–47. A combination of phylogenetic analyses of multiple genes and morphological characteristics has been widely used to study fungal diversity, and nearly a hundred new species of this genus have been recorded in various ecological zones worldwide40,46–60.
Wetlands represent a significant land resource and a source of natural resources with various functions, such as forest, cultivated land and sea. These areas are rich in biological diversity in terms of both the ecological landscape and the human living environment. The Zoige alpine wetland is one of the most important wetlands in China because of its complex natural environment, abundant ecological resources, and unique climatic conditions. Although reports have addressed the local soil active organic carbon, vegetation, animal community, gas flux, functional bacteria and microorganism methanogens61–68, the ecology of soil fungi is poorly understood, and recent comprehensive reports on Trichoderma are not available for any region, including the Zoige alpine wetland ecological region in China. Only Feng et al.69 have analyzed the fungal community structure in the soil of this region via a combination of BIOLOG analysis and traditional cultural methods. Because morphological and molecular tools are ideal for assessments of the species diversity in all geographical regions, the work described here was designed to investigate the species diversity of the genus Trichoderma in the unique ecological environment of the Zoige alpine wetland, with an emphasis on four major soil types (peat soil, meadow soil, subalpine meadow soil, and aeolian sandy soil). Our results may be used as a reference for a greater understanding of soil microorganisms in various ecological regions, ecological rehabilitation and reconstruction, and microbial resources.
Results
Trichoderma species collection
Eighty strains were obtained from 100 soil samples collected from Zoige alpine wetland ecological regions in China. Details of the strains isolated from soil samples are given in Table 1. All strains were subsequently used for morphological identification, while fifty-seven were used for phylogenetic analysis.
Table 1.
Details of 80 Trichoderma isolates from the Zoige alpine wetland in this study.
| Isolates | Geographical location | Altitude (m a.s.l.) | Soil types | Soil layers (m) | Species |
|---|---|---|---|---|---|
| T1 | 102° 29′ 05.8″, 33° 43′ 17.7″ | 3448 | Aeolian sand soil | 0–10 | Trichoderma harzianum |
| T2 | 102° 56′ 26.3″, 33° 36′ 13.4″ | 3446 | Peat soil | 0–10 | T. harzianum |
| T3 | 102° 42′ 52.1″, 33° 31′ 18.5″ | 3461 | Subalpine meadow soil | 10–20 | T. harzianum |
| T4 | 102° 29′ 05.8″, 33° 43′ 17.7″ | 3448 | Aeolian sand soil | 0–10 | T. harzianum |
| T5 | 102° 29′ 05.8″, 33° 43′ 17.7″ | 3448 | Aeolian sand soil | 0–10 | T. harzianum |
| T6 | 102° 29′ 05.8″, 33° 43′ 17.7″ | 3448 | Aeolian sand soil | 0–10 | T. harzianum |
| T7 | 102° 56′ 26.3″, 33° 36′ 13.4″ | 3446 | Peat soil | 0–10 | T. harzianum |
| T8 | 102° 55′ 18.5″, 33° 35′ 36.0″ | 3462 | Peat soil | 0–10 | T. harzianum |
| T9 | 102° 29′ 04.6″, 33° 43′ 17.6″ | 3450 | Aeolian sand soil | 0–10 | T. harzianum |
| T10 | 102° 55′ 20.3″, 33° 37′ 07.8″ | 3443 | Peat soil | 0–10 | T. harzianum |
| T11 | 102° 32′ 25.4″, 33° 45′ 55.8″ | 3488 | Peat soil | 0–10 | T. harzianum |
| T12 | 102° 29′ 04.6″, 33° 43′ 17.6″ | 3450 | Aeolian sand soil | 0–10 | T. harzianum |
| T13 | 102° 49′ 44.4″, 33° 38′ 01.1″ | 3446 | Meadow soil | 0–10 | T. harzianum |
| T14 | 102° 56′ 37.3″, 33° 35′ 12.8″ | 3435 | Peat soil | 0–10 | T. harzianum |
| T15 | 102° 42′ 52.1″, 33° 31′ 18.5″ | 3461 | Subalpine meadow soil | 20–30 | T. harzianum |
| T16 | 102° 29′ 57.5″, 33° 23′ 56.1″ | 3452 | Meadow soil | 0–10 | T. alni |
| T17 | 102° 55′ 18.5″, 33° 35′ 36.0″ | 3462 | Peat soil | 0–10 | T. harzianum |
| T18 | 102° 49′ 44.4″, 33° 38′ 01.1″ | 3446 | Meadow soil | 0–10 | T. harzianum |
| T19 | 102° 55′ 18.5″, 33° 35′ 36.0″ | 3462 | Peat soil | 0–10 | T. harzianum |
| T20 | 102° 55′ 18.5″, 33° 35′ 36.0″ | 3462 | Peat soil | 0–10 | T. pyramidale |
| T21 | 102° 56′ 26.3″, 33° 36′ 13.4″ | 3446 | Peat soil | 0–10 | T. harzianum |
| T22 | 102° 56′ 37.3″, 33° 35′ 12.8″ | 3435 | Peat soil | 0–10 | T. harzianum |
| T23 | 102°49′44.4″, 33° 38′ 01.1″ | 3446 | Meadow soil | 10–20 | T. harzianum |
| T24 | 102° 37′ 27.9″, 33° 50′ 31.1″ | 3433 | Subalpine meadow soil | 0–10 | T. alni |
| T25 | 102° 29′ 57.5″, 33° 23′ 56.1″ | 3452 | Meadow soil | 0–10 | T. zoigense |
| T26 | 102° 32′ 25.4″, 33° 45′ 55.8″ | 3488 | Peat soil | 0–10 | T. harzianum |
| T27 | 102° 49′ 44.4″, 33°38′ 01.1″ | 3446 | Meadow soil | 0–10 | T. rossicum |
| T28 | 102° 29′ 57.5″, 33° 23′ 56.1″ | 3452 | Meadow soil | 0–10 | T. alni |
| T29 | 102° 42′ 52.1″, 33° 31′ 18.5″ | 3461 | Subalpine meadow soil | 0–10 | T. harzianum |
| T30 | 102° 42′ 52.1″, 33° 31′ 18.5″ | 3461 | Subalpine meadow soil | 0–10 | T. harzianum |
| T31 | 102° 42′ 52.1″, 33° 31′ 18.5″ | 3461 | Subalpine meadow soil | 0–10 | T. harzianum |
| T32 | 102° 29′ 04.6″, 33° 43′ 17.6″ | 3450 | Aeolian sand soil | 0–10 | T. harzianum |
| T33 | 102° 29′ 05.8″, 33° 43′ 17.7″ | 3448 | Aeolian sand soil | 0–10 | T. harzianum |
| T34 | 102° 32′ 25.4″, 33° 45′ 55.8″ | 3488 | Peat soil | 0–10 | T. harzianum |
| T35 | 102° 51′ 22.1″, 33° 32′ 24.6″ | 3488 | Peat soil | 0–10 | T. harzianum |
| T36 | 102° 55′ 18.5″, 33° 35′ 36.0″ | 3462 | Peat soil | 0–10 | T. alni |
| T37 | 102° 55′ 18.5″, 33° 35′ 36.0″ | 3462 | Peat soil | 0–10 | T. harzianum |
| T38 | 102° 56′ 26.3″, 33° 36′ 13.4″ | 3446 | Peat soil | 0–10 | T. harzianum |
| T39 | 102° 37′ 03.3″, 33° 57′ 33.3″ | 3437 | Peat soil | 0–10 | T. atrobrunneum |
| T40 | 102° 56′ 57.9″, 33° 36′ 29.8″ | 3493 | Subalpine meadow soil | 0–10 | T. alni |
| T41 | 102° 29′ 09.9″, 33° 26′ 47.9″ | 3452 | Subalpine meadow soil | 0–10 | T. alni |
| T42 | 102° 29′ 26.9″, 33° 43′ 14.3″ | 3462 | Aeolian sand soil | 0–10 | T. atrobrunneum |
| T43 | 102° 29′ 57.5″, 33° 23′ 56.1″ | 3452 | Meadow soil | 0–10 | T. zoigense |
| T44 | 102° 29′ 57.5″, 33° 23′ 56.1″ | 3452 | Meadow soil | 20–30 | T. zoigense |
| T45 | 102° 49′ 44.4″, 33° 38′ 01.1″ | 3446 | Meadow soil | 20–30 | T. harzianum |
| T46 | 102° 42′ 52.1″, 33° 31′ 18.5″ | 3461 | Subalpine meadow soil | 0–10 | T. harzianum |
| T47 | 102° 42′ 52.1″, 33° 31′ 18.5″ | 3461 | Subalpine meadow soil | 0–10 | T. harzianum |
| T48 | 102° 52′ 33.1″, 33° 33′ 55.9″ | 3501 | Subalpine meadow soil | 0–10 | T. zoigense |
| T49 | 102° 52′ 33.1″, 33° 33′ 55.9″ | 3501 | Subalpine meadow soil | 10–20 | T. harzianum |
| T50 | 102° 32′ 25.4″, 33° 45′ 55.8″ | 3488 | Peat soil | 50–100 | T. polysporum |
| T51 | 102° 33′ 21.5″, 33° 54′ 57.6″ | 3426 | Subalpine meadow soil | 30–50 | T. rossicum |
| T52 | 102° 33′ 21.5″, 33° 54′ 57.6″ | 3426 | Subalpine meadow soil | 30–50 | T. rossicum |
| T53 | 102° 55′ 18.5″, 33° 35′ 36.0″ | 3462 | Peat soil | 0–10 | T. alni |
| T54 | 102° 29′ 09.7″, 33° 28′ 02.6″ | 3480 | Subalpine meadow soil | 0–10 | T. alni |
| T55 | 102° 55′ 18.5″, 33° 35′ 36.0″ | 3462 | Peat soil | 0–10 | T. harzianum |
| T56 | 102° 42′ 52.1″, 33° 31′ 18.5″ | 3461 | Subalpine meadow soil | 0–10 | T. harzianum |
| T57 | 102° 37′ 03.3″, 33° 57′ 33.3″ | 3437 | Peat soil | 0–10 | T. atrobrunneum |
| T58 | 102° 29′ 57.5″, 33° 23′ 56.1″ | 3452 | Meadow soil | 0–10 | T. zoigense |
| T59 | 102° 56′ 37.3″, 33° 35′ 12.8″ | 3435 | Peat soil | 0–10 | T. harzianum |
| T60 | 102° 29′ 57.5″, 33° 23′ 56.1″ | 3452 | Meadow soil | 0–10 | T. zoigense |
| T61 | 102° 29′ 09.9″, 33° 26′ 47.9″ | 3452 | Subalpine meadow soil | 0–10 | T. alni |
| T62 | 102° 56′ 57.9″, 33° 36′ 29.8″ | 3493 | Subalpine meadow soil | 0–10 | T. alni |
| T63 | 102° 37′ 03.3″, 33° 57′ 33.3″ | 3437 | Peat soil | 0–10 | T. harzianum |
| T64 | 102° 49′ 44.4″, 33° 38′ 01.1″ | 3446 | Meadow soil | 0–10 | T. rossicum |
| T65 | 102° 52′ 33.1″, 33° 33′ 55.9″ | 3501 | Subalpine meadow soil | 0–10 | T. harzianum |
| T66 | 102° 29′ 57.5″, 33° 23′ 56.1″ | 3452 | Meadow soil | 0–10 | T. zoigense |
| T67 | 102° 56′ 57.9″, 33° 36′ 29.8″ | 3493 | Subalpine meadow soil | 0–10 | T. alni |
| T68 | 102° 36′ 51.0″, 33° 26′ 10.7″ | 3531 | Subalpine meadow soil | 0–10 | T. alni |
| T69 | 102° 37′ 12.6″, 33° 51′ 02.1″ | 3434 | Subalpine meadow soil | 0–10 | T. alni |
| T70 | 102° 56′ 57.9″, 33° 36′ 29.8″ | 3493 | Subalpine meadow soil | 0–10 | T. alni |
| T71 | 102° 29′ 57.5″, 33° 23′ 56.1″ | 3452 | Meadow soil | 0–10 | T. zoigense |
| T72 | 102° 29′ 57.5″, 33° 23′ 56.1″ | 3452 | Meadow soil | 10–20 | T. alni |
| T73 | 102° 29′ 05.8″, 33° 43′ 17.7″ | 3448 | Aeolian sand soil | 0–10 | T. harzianum |
| T74 | 102° 29′ 05.8″, 33° 43′ 17.7″ | 3448 | Aeolian sand soil | 0–10 | T. harzianum |
| T75 | 102° 37′ 12.6″, 33° 51′ 02.1″ | 3426 | Subalpine meadow soil | 30–50 | T. harzianum |
| T76 | 102° 49′ 44.4″, 33° 38′ 01.1″ | 3446 | Meadow soil | 30–50 | T. harzianum |
| T77 | 102° 29′ 57.5″, 33° 23′ 56.1″ | 3452 | Meadow soil | 50–100 | T. harzianum |
| T78 | 102° 51′ 22.1″, 33° 32′ 24.6″ | 3444 | Peat soil | 30–50 | T. harzianum |
| T79 | 102° 32′ 25.4″, 33° 45′ 55.8″ | 3488 | Peat soil | 50–100 | T. harzianum |
| T80 | 102° 54′ 15.2″, 33° 34′ 72.2″ | 3449 | Peat soil | 0–10 | T. harzianum |
Phylogenetic analysis
The ITS region used preliminarily as a species identification criterion was applied to TrichOKey at www.ISTH.info70. However, the ITS region has a low number of variable sites and long insertions in certain species; thus, it is unsuitable for a phylogenetic reconstruction of this group41. Our study successfully amplified most fragments of the genes tef1, rpb2, and acl1. We also designed a pair of new primers based on the full-length tef1 gene, 5′-GAGAAGTTCGAGAAGGTGAGC-3′ and 5′-ATGTCACGGACGGCGAAAC-3′, with which a 1.4-kb fragment was amplified for most isolates.
All samples analyzed in our study were divided into 4 primary clades based on the gpd gene region, including 49 strains from the T. harzianum complex, 3 T. rossicum strains, 1 T. polysporum strain and one unknown species (4 Trichoderma sp. strains) (Fig. 1). Maximum parsimony analysis was conducted among 101 strains, with Protocrea farinosa (CPK 2472) and P. pallida (CBS 299.78) used as outgroup (Table 2). The dataset for the rpb2, tef1 and acl1 genes contained 3403 characteristics, among which 1152 were parsimony-informative, 988 were variable and parsimony-uninformative, and 1263 were constant. The most parsimonious trees are shown in Fig. 2 (tree length = 5054, consistency index = 0.6005, homoplasy index = 0.3995, retention index = 0.8105, rescaled consistency index = 0.4867).
Figure 1.
Neighbor-joining tree based on partial gpd gene sequences from 57 Trichoderma isolates. Parsimony bootstrap values of more than 50% are shown at nodes.
Table 2.
Trichoderma strain included in the multi-gene sequence analysis, with details of clade, strain number, location, and GenBank accessions of the sequences generated.
| Species | Clade | Strain | Location | ITS | TEF | RPB2 | ACL1 | GPD |
|---|---|---|---|---|---|---|---|---|
| Trichoderma aggressivum | Green/harzianum | CBS 100525 | UK: England | – | AF534614 | AF545541 | – | – |
| T. alni | Green/harzianum | Hypo 254 = CBS 120633 (T) | UK: England | EU518651 | EU498312 | EU498349 | KJ664942 | – |
| C.P.K. 2494 | – | – | EU498313 | EU498350 | – | – | ||
| C.P.K. 2854 | – | – | EU498314 | EU498351 | – | – | ||
| C.P.K. 2858 | – | – | EU498315 | – | – | – | ||
| T16 | China | KX632517 | KX632574 | KX632631 | KX632688 | KX632745 | ||
| T24 | China | KX632518 | KX632575 | KX632632 | KX632689 | KX632746 | ||
| T28 | China | KX632519 | KX632576 | KX632633 | KX632690 | KX632747 | ||
| T36 | China | KX632520 | KX632577 | KX632634 | KX632691 | KX632748 | ||
| T40 | China | KX632521 | KX632578 | KX632635 | KX632692 | KX632749 | ||
| T41 | China | KX632522 | KX632579 | KX632636 | KX632693 | KX632750 | ||
| T53 | China | KX632523 | KX632580 | KX632637 | KX632694 | KX632751 | ||
| T54 | China | KX632524 | KX632581 | KX632638 | KX632695 | KX632752 | ||
| T. amazonicum | Green/harzianum | IB 95 | Peru | – | HM142377 | HM142368 | – | – |
| T. atrobrunneum | Green/harzianum | G.J.S. 90-254 | Germany | – | AF443943 | FJ442735 | KJ664942 | – |
| Hypo 25 | Austria | – | KJ665359 | – | – | – | ||
| S343 | Spain | – | KJ665383 | – | – | – | ||
| S447 | Spain | – | KJ665396 | – | – | – | ||
| Hypo 4 | Germany | – | KJ665365 | – | KJ664949 | – | ||
| Hypo 182 | Germany | – | KJ665357 | – | KJ664948 | – | ||
| T39 | China | KX632514 | KX632571 | KX632628 | KX632685 | KX632742 | ||
| T42(CGMCC 3.20167) | China | KX632515 | KX632572 | KX632629 | KX632686 | KX632743 | ||
| T57 | China | KX632516 | KX632573 | KX632630 | KX632687 | KX632744 | ||
| T. brunneoviride | Green/harzianum | CBS 120928 | Austria | EU518661 | EU498318 | EU498358 | – | – |
| CBS 121130 (T) | Germany | – | EU498316 | – | – | – | ||
| T. catoptron | Green/harzianum | G.J.S. 02-76 | Sri Lanka | AY737766 | AY391963 | AY391900 | KJ664969 | – |
| T. ceraceum | Green/harzianum | G.J.S. 88-26 | USA | – | AY391964 | AY391901 | – | – |
| T. cerinum | Green/harzianum | CBS 136992 = S357 | France | – | KF134797 | KF134788 | KJ664977 | – |
| T. cinnamomeum | Green/harzianum | G.J.S. 97-230 = CBS 114235 (T) | USA | – | – | AY391918 | KJ664965 | – |
| G.J.S. 97-237 | USA | AY737759 | AY391979 | AY391920 | – | – | ||
| T. citrinoviride | Longibrachiatum | CBS 121275 = Hypo 162 | Germany | – | – | FJ860586 | KJ64978 | – |
| C.P.K. 2005 | Austria | – | FJ860694 | – | – | – | ||
| T. compactum | Green/harzianum | CBS 121218 (T) | China | – | KF134798 | KF134789 | KJ664984 | – |
| T. corneum | Green/harzianum | G.J.S. 97-82 | Thailand | – | KJ665455 | KJ665252 | KJ664985 | – |
| T. dacrymycellum | Green/harzianum | Hypo 233 = WU 29044 | Germany | FJ860749 | FJ860633 | FJ860533 | KJ664993 | – |
| T. epimyces | Green/harzianum | C.P.K. 1980 | Germany | EU518662 | EU498319 | EU498359 | KJ664993 | – |
| T. guizhouense | Green/harzianum | HGUP0039 | China | – | JX089585 | – | – | – |
| T. harzianum | Green/harzianum | CBS 226.95 (T neo) | UK: England | AY605713 | AF534621 | AF545549 | – | – |
| T1 | China | KX632476 | KX632533 | KX632590 | KX632647 | KX632704 | ||
| T2 | China | KX632477 | KX632534 | KX632591 | KX632648 | KX632705 | ||
| T3 | China | KX632478 | KX632535 | KX632592 | KX632649 | KX632706 | ||
| T4 | China | KX632479 | KX632536 | KX632593 | KX632650 | KX632707 | ||
| T5 | China | KX632480 | KX632537 | KX632594 | KX632651 | KX632708 | ||
| T6 | China | KX632481 | KX632538 | KX632595 | KX632652 | KX632709 | ||
| T7 | China | KX632482 | KX632539 | KX632596 | KX632653 | KX632710 | ||
| T8 | China | KX632483 | KX632540 | KX632597 | KX632654 | KX632711 | ||
| T9 | China | KX632484 | KX632541 | KX632598 | KX632655 | KX632712 | ||
| T10 | China | KX632485 | KX632542 | KX632599 | KX632656 | KX632713 | ||
| T11 | China | KX632486 | KX632543 | KX632600 | KX632657 | KX632714 | ||
| T12 | China | KX632487 | KX632544 | KX632601 | KX632658 | KX632715 | ||
| T13 | China | KX632488 | KX632545 | KX632602 | KX632659 | KX632716 | ||
| T14 | China | KX632489 | KX632546 | KX632603 | KX632660 | KX632717 | ||
| T15 | China | KX632490 | KX632547 | KX632604 | KX632661 | KX632718 | ||
| T17 | China | KX632491 | KX632548 | KX632605 | KX632662 | KX632719 | ||
| T18 | China | KX632492 | KX632549 | KX632606 | KX632663 | KX632720 | ||
| T19 | China | KX632493 | KX632550 | KX632607 | KX632664 | KX632721 | ||
| T21 | China | KX632494 | KX632551 | KX632608 | KX632665 | KX632722 | ||
| T22 | China | KX632495 | KX632552 | KX632609 | KX632666 | KX632723 | ||
| T23 | China | KX632496 | KX632553 | KX632610 | KX632667 | KX632724 | ||
| T26 | China | KX632497 | KX632554 | KX632611 | KX632668 | KX632725 | ||
| T29 | China | KX632498 | KX632555 | KX632612 | KX632669 | KX632726 | ||
| T30 | China | KX632499 | KX632556 | KX632613 | KX632670 | KX632727 | ||
| T31 | China | KX632500 | KX632557 | KX632614 | KX632671 | KX632728 | ||
| T32 | China | KX632501 | KX632558 | KX632615 | KX632672 | KX632729 | ||
| T33 | China | KX632502 | KX632559 | KX632616 | KX632673 | KX632730 | ||
| T34 | China | KX632503 | KX632560 | KX632617 | KX632674 | KX632731 | ||
| T35 | China | KX632504 | KX632561 | KX632618 | KX632675 | KX632732 | ||
| T37 | China | KX632505 | KX632562 | KX632619 | KX632676 | KX632733 | ||
| T38 | China | KX632506 | KX632563 | KX632620 | KX632677 | KX632734 | ||
| T45 | China | KX632507 | KX632564 | KX632621 | KX632678 | KX632735 | ||
| T46 | China | KX632508 | KX632565 | KX632622 | KX632679 | KX632736 | ||
| T47 | China | KX632509 | KX632566 | KX632623 | KX632680 | KX632737 | ||
| T49 | China | KX632510 | KX632567 | KX632624 | KX632681 | KX632738 | ||
| T55 | China | KX632511 | KX632568 | KX632625 | KX632682 | KX632739 | ||
| T56 | China | KX632512 | KX632569 | KX632626 | KX632683 | KX632740 | ||
| T. hausknechtii | Green/harzianum | Hypo 649 = CBS 133493 (T) | France | – | KJ665515 | KJ665276 | KJ665034 | – |
| T. helicolixii | Green/harzianum | S640 = CBS 133499 (T) | Greece | – | KJ665517 | KJ665278 | KJ665036 | – |
| T. inhamatum | Green/harzianum | CBS 273.78 (T) | Colombia | – | AF348099 | FJ442725 | – | – |
| T. italicum | Green/harzianum | S131 = CBS 132567 (T) | Italy | – | KJ665525 | KJ665282 | KJ665045 | – |
| T. longibrachiatum | Longibrachiatum | CBS 816.68 | USA | – | EU401591 | DQ087242 | – | – |
| S328 | Spain | – | JQ685867 | JQ685883 | – | – | ||
| T. parepimyces | Green/harzianum | CBS 122769 (T) | Austria | – | FJ860664 | FJ860562 | KJ665138 | – |
| T. pleuroti | Green/harzianum | CBS 124387 (T) | Korea | – | HM142382 | HM142372 | – | – |
| T. pleuroticola | Green/harzianum | CBS 124383 (T) | Korea | – | HM142381 | HM142371 | – | – |
| T. polysporum | Polysporum | Hypo 422 = C.P.K. 2461 | Austria | – | – | FJ179613 | KJ665057 | – |
| Hypo 522 = C.P.K. 3131 | Austria | – | FJ860661 | JQ685878 | KJ665138 | – | ||
| T50 | China | KX632525 | KX632582 | KX632639 | KX632696 | KX632753 | ||
| T. priscilae | Green/harzianum | S168 = CBS 131487 (T) | Spain | – | KJ665691 | KJ665333 | KJ665151 | – |
| T. pseudogelatinsum | Green/harzianum | CNU N309 | Korea | – | HM920202 | HM920173 | – | – |
| T. pyramidale | Green/harzianum | S73 = CBS 135574 (T) | Italy | – | KJ665699 | KJ665334 | KJ665116 | – |
| S573 | Italy | – | KJ665698 | – | – | – | ||
| S533 | Spain | – | KJ665697 | – | KJ665162 | – | ||
| T20 | China | KX632513 | KX632570 | KX632627 | KX632684 | KX632741 | ||
| T. reesei | Longibrachiatum | QM 6a = CBS 383.78 (T) | New Guinea | – | – | HM182969 | KJ665163 | – |
| T. rossicum | Stromaticum | DAOM 230011 (T) | Russia | – | AY937441 | HQ342288 | – | – |
| T27 | China | KX632526 | KX632583 | KX632640 | KX632697 | KX632754 | ||
| T51 | China | KX632527 | KX632584 | KX632641 | KX632698 | KX632755 | ||
| T52 | China | KX632528 | KX632585 | KX632642 | KX632699 | KX632756 | ||
| T. saturnisporopsis | Longibrachiatum | TR 175 = C.P.K. 1356 (T) | USA | – | – | DQ857348 | – | – |
| T. saturnisporum | Longibrachiatum | ATCC 18903 = CBS 330.70 | USA | – | EU280044 | DQ087243 | – | – |
| T. simmonsii | Green/harzianum | Hypo 15 = C.P.K. 1596 | Austria | – | KJ665706 | – | – | – |
| Hypo 30 = C.P.K. 2391 | Austria | – | KJ665707 | – | KJ665182 | – | ||
| S7 | Italy | – | KJ665719 | KJ665337 | KJ665182 | – | ||
| T. stramineum | Green/harzianum | G.J.S.02-84 = CBS 114248 | Sri Lanka | AY737765 | AY391999 | AY391945 | – | – |
| T. stromaticum | Stromaticum | P.C. 209 | Brazil | – | AF534613 | AF545539 | KJ665185 | – |
| T. tawa | Green/harzianum | G.J.S. 97-174 | Thailand | AY737756 | AY392004 | AY391956 | – | – |
| T. tomentosum | Green/harzianum | CBS 120637 | Austria | FJ860744 | FJ860629 | FJ860532 | KJ665222 | – |
| DAOM 178713a (T) | Canada | – | AF534630 | AF545557 | – | – | ||
| T. zoigense | Longibrachiatum | T25 | China | KX632529 | KX632586 | KX632643 | KX632700 | KX632757 |
| T43 | China | KX632530 | KX632587 | KX632644 | KX632701 | KX632758 | ||
| T44 (CGMCC 3.20145) | China | KX632531 | KX632588 | KX632645 | KX632702 | KX632759 | ||
| T48 (CGMCC 3.20146) | China | KX632532 | KX632589 | KX632646 | KX632703 | KX632760 | ||
| Protocrea farinosa | Outgroup | CBS 121551 | Austria | – | – | EU703935 | – | – |
| C.P.K. 2472 | Austria | – | EU703892 | – | – | – | ||
| P. pallida | Outgroup | CBS 121552 | Denmark | – | – | EU703944 | – | – |
| CBS 299.78 (T) | USA | – | EU703900 | – | – | – |
Figure 2.

Maximum parsimony tree of Trichoderma species inferred from the combined rpb2, tef1 and acl1 partial sequences. Maximum parsimony bootstrap values above 50% are shown at nodes. The tree was rooted with Protocrea farinose and P. pallida Isolates from this study are shown in red (new species in bold).
The phylogram showed that 57 stains belonged to the following four clades: Harzianum, Polysporum, Stromaticum, and Longibrachiatum. The strains of the first three clades with neighboring named species were well supported by bootstrap values greater than 90%. The Harzianum clade contained T. alni, T. atrobrunneum, T. harzianum and T. pyramidale of the Trichoderma species complex. The Polysporum clade contained only T. polysporum, and the Stromaticum clade contained T. rossicum. The Longibrachiatum clade contained four strains of Trichoderma sp., T25, T43, T44 and T48, which were separated from any other known taxa of this clade showed a low bootstrap value (MPBP = 62%) with T. citrinoviride and T. saturnisporum. We thus regarded it as a new species and named it Trichoderma zoigense, as described in the next section.
Growth rates
As shown in Fig. 3, the genus Trichoderma from Zoige alpine wetland ecological regions was able to grow in a range from 15 to 35 °C, and the suitable growth temperature for most species ranged from 20 to 30 °C. All seven species identified had normal viability at relatively low temperature (15 °C), and they rarely grew well over 35 °C except for T. zoigense. For T. atrobrunneum, T. harzianum and T. pyramidale, the optimum growth temperature on CMD was 25 to 30 °C. T. alni and T. rossicum preferred a cool growth environment, with an optimum temperature of 25 °C, whereas T. zoigense was more partial to a hot environment, with an optimum temperature of 30 °C, and it even grew well up to 35 °C. T. polysporum was the only slow-growing species that grew with less than 6.0 mm/day between 15 and 30 °C and did not survive at 35 °C. The above results showed that all species had different growth rates but were not completely differentiated from each other on CMD. These species were roughly divided into four groups based on their optimum growth temperature.
Figure 3.
Growth rates of 7 species of Trichoderma on CMD given as mm per day at five temperatures. The values were the means of 3–5 experiments, with 1–3 representative isolates per species.
Relationship with ecological factors
Our results revealed a substantial disparity in the number and distribution of Trichoderma species among Zoige alpine wetland ecological regions (Tables 3, 4). Table 3 showed that T. harzianum was found in all four soil types, but most isolates of this species were obtained from peat soil. T. rossicum, T. alni and T. zoigense were also present in meadow soil and subalpine meadow soil, whereas T. atrobrunneum was found in aeolian sandy soil and peat soil. T. polysporum was found only in peat soil.
Table 3.
Isolation frequency of Trichoderma species in different soil types (%).
| Species | Meadow soil | Subalpine meadow soil | Aeolian sand soil | Peat soil | total |
|---|---|---|---|---|---|
| T. harzianum | 5 | 6 | 2 | 10 | 23 |
| T. rossicum | 1 | 1 | 0 | 0 | 2 |
| T. alni | 2 | 6 | 0 | 1 | 9 |
| T. zoigense | 2 | 1 | 0 | 0 | 3 |
| T. atrobrunneum | 0 | 0 | 1 | 1 | 2 |
| T. polysporum | 0 | 0 | 0 | 1 | 1 |
| T. pyramidale | 0 | 0 | 0 | 1 | 1 |
Table 4.
Isolation frequency of Trichoderma species in different soil layers (%) species.
| 0–10 | 10–20 | 20–30 | 30–50 | 50–100 | Total | |
|---|---|---|---|---|---|---|
| T. harzianum | 13 | 3 | 2 | 3 | 2 | 23 |
| T. rossicum | 1 | 0 | 0 | 1 | 0 | 2 |
| T. alni | 8 | 1 | 0 | 0 | 0 | 9 |
| T. zoigense | 2 | 0 | 1 | 0 | 0 | 3 |
| T. atrobrunneum | 2 | 0 | 0 | 0 | 0 | 2 |
| T. polysporum | 0 | 0 | 0 | 0 | 1 | 1 |
| T. pyramidale | 1 | 0 | 0 | 0 | 0 | 1 |
In regard to the different soil layers shown in Table 4, T. harzianum was widely distributed in the five soil layers at depths of 0–100 cm. T. rossicum, T. alni and T. zoigense were isolated mainly from the soil layers at depths of 0–50 cm. Both T. atrobrunneum and T. pyramidale were isolated from depths of 0–10 cm, and T. polysporum was found only in the soil layers at depths of 50–100 cm.
Regarding isolation frequency, T. harzianum was the most common of the seven species with a 23% isolation frequency, and it was therefore the dominant species in the zone, while the rare species T. polysporum and T. pyramidale had the lowest isolation frequencies at 1%.
Taxonomy
New species
Trichoderma zoigense G.S. Gong & G.T. Tang, sp. nov. (Fig. 4).
Figure 4.
Cultures and asexual morph of Trichoderma zoigense. (a–d). Cultures at 20 °C [(a) on CMD, 7 days; (b) on MEA, 4 days; (c) on PDA, 4 days; and (d) on SNA, 7 days]. (e) Conidiation tuft (CMD, 4 days). (f–k) Conidiophores and phialides (CMD, 5–7 days). (l) Chlamydospores (PDA, 8 days). (m) Conidia (CMD, 5 days). Scale bars: (e) = 2 mm; (f–m) = 10 μm.
MycoBank: MB 82114.
Typification: CHINA. SICHUAN PROVINCE: Zoige Alpine Wetland, on soil, 29 June 2013, G.S. Gong T44 (holotype CGMCC3.20145). GenBank: ITS = KX632531; TEF = KX632588; RPB2 = KX632645; ACL1 = KX632702; GPD = KX632759.
Etymology: zoigense (Latin), the specific epithet about the place where the type was found.
Description: Cultures and anamorph: optimal growth at 25 °C on all four media. On CMD after 72 h, growth is 25–28 mm at 20 °C and 28–31 mm at 25 °C. Colony is dense and has a wavy to crenate margin. Surface becomes distinctly zonate and white to grayish-green but celadon to atrovirens later, and it is granular in the center and distinctly radially downy outside and shows whitish surface hyphae and reverse-diffusing croci to pale brown pigment (Fig. 4a). Aerial hyphae are numerous to punctate and long, forming radial strands, with white mycelial patches appearing in aged cultures (Fig. 4e). Autolytic excretions are rare, with no coilings observed. Conidiation was noted after 3–4 d at 25 °C, a yellow or greenish color appears after 7 days, conidiation is effuse, and in intense tufts, erect conidiophores occur around the plug and on aerial hyphae. They are mainly concentrated along the colony center, show a white color that turns green, and then finally degenerate, with conidia often adhering in chains. Conidiophores are short and simple with asymmetric branches. Branches produce phialides directly. Phialides are generally solitary along main axes and side branches and sometimes paired in the terminal position of the main axes, sometimes in whorls of 2–3. Phialides are 4.5–10.5 × 2–5 μm ( = 7.5 ± 1.5 × 3 ± 0.5, n = 50) and 1.5–2.5 μm ( = 2 ± 0.2) wide at the base, lageniform or ampulliform, mostly uncinate or slightly curved, less straight, and often distinctly widened in the middle (Fig. 4f–k). Conidia are 3–4.5 × 2.3–4 μm ( = 3.5 ± 0.3 × 3 ± 0.3, n = 50) and initially hyaline, and they turn green and are oblong or ellipsoidal, almost with constricted sides, and smooth, eguttulate or with minute guttules, with indistinct scars (Fig. 4m).
On PDA, after 72 h, growth is 35–41 mm at 20 °C and 50–55 mm at 25 °C; and mycelium covers the plate after 5 days at 25 °C. Colonies are dense with wavy to crenate margins; and mycelia are conspicuously differentiated in width of the primary and secondary hyphae. Surface becomes distinctly zonate, yellowish-green to prasinous in color and celadon to atrovirens later, and it is farinose to granular in the center, distinctly radially downy outside, with whitish of surface hyphae and reverse-diffusing brilliant yellow to fruit-green pigment (Fig. 4c). Aerial hyphae are numerous, long and ascend several millimeters, forming radial strands, with white mycelial patches appearing in aged cultures. Autolytic excretions are rare; and no coilings are observed. Odor is indistinct or fragrant. Chlamydospores examined after 7 days at 4.5–9 × 4.5–7.5 μm ( = 6 ± 1.1 × 6 ± 0.7, n = 50), and they are terminal, intercalary, globose or ellipsoidal, and smooth (Fig. 4l). Conidiation is noted after 3–4 days and yellow or greenish after 7 days. Conidiophores are short and simple with asymmetric branches; conidia are greenish, ellipsoidal, and smooth.
On SNA, after 72 h, growth is 13–15 mm at 20 °C and, 16–21 mm at 25 °C; and mycelium covers the plate after 12–13 days at 25 °C. Colony is similar to that on CMD, with a little wave margin, although mycelia are looser and slower on the agar surface. Aerial hyphae are relatively inconspicuous and long along the colony margin. Autolytic activity and coiling are absent or inconspicuous. No diffusing pigment or distinct odor are produced (Fig. 4d). Conidiation was noted after 3–4 days at 25 °C, and many amorphous, loose white or aqua cottony tufts occur, mostly median from the plug outwards, and they are confluent to masses up and white but then turn green. After 4–5 days, conidiation becomes dense within the tufts, which are loose at their white margins with long, straight, or slightly sinuous sterile ends in the periphery. Tufts consisting of a loose reticulum with branches often at right angles, give rise to several main axes. Main axes are regular and tree-like, with few or many paired or unpaired side branches. Branches are flexuous, and phialides are solitary along the main axes and side branches, and they are sometimes paired in the terminal position of the main axes, sometimes in whorls of 2–3 that are often cruciform or in pseudo-whorls up to 4. Phialides and conidia are similar to that on CMD.
New records for China
Trichoderma atrobrunneum F. B. Rocha et al., Mycologia 107: 571, 2015 (Fig. 5).
Figure 5.
Cultures and asexual morph of Trichoderma atrobrunneum. (a–d) Cultures at 25 °C [(a) on CMD, 7 days; (b) on MEA, 4 days; (c) on PDA, 15 days; and (d) on SNA, 7 days]. (e) Conidiation tuft (SNA, 7 days). (f–i,k,l) Conidiophores and phialides (CMD, 5–7 days). (j) Conidia (CMD, 6 days). (m) Chlamydospores (PDA, 7 days). Scale bars: (e) = 2 mm; (f–m) = 10 μm.
Specimen examined: CHINA. SICHUAN PROVINCE: Zoige Alpine Wetland, on soil, 29 June 2013, G.S. Gong T42 (holotype CGMCC.20167). GenBank: ITS = KX632514; TEF = KX632571; RPB2 = KX632628; ACL1 = KX632685; GPD = KX632742.
Description: Cultures and anamorph: optimal growth at 25 °C on all media. On CMD, after 72 h, growth is 35–37 mm at 20 °C and 46–53 mm at 25 °C; mycelium covers the plate after 5–6 days at 25 °C. Colonies show distinct zonation. Mycelia are loose and thin; hyphae are narrow, sinuous and often form strands on the margin (Fig. 5a). Aerial hyphae are slight, forming a thin white to green downy fluffy or floccose mat. The light brown or brown pigment is observed, with no distinct odor noted. Conidiophores are pyramidal, often with opposing and somewhat widely spaced branches, with the main axis and each branch terminating in a cruciate, sometimes verticillate, whorl of up to four phialides. Phialides are ampulliform to lageniform and 4.9–7.6 × 2.2–3.0 μm ( = 6 ± 0.7 × 2.5 ± 0.2, n = 50) and 1.5–2.5 μm ( = 1.5 ± 0.3) wide at the base (Fig. 5f–i,k,l). Conidia are 2.5–4 × 2.5–3.5 μm ( = 3 ± 0.3 × 3 ± 0.2, n = 50), yellow to green, smooth, and circular to ellipsoidal (Fig. 5j).
On PDA, after 72 h, growth is 41–43 mm at 20 °C and 50–55 mm at 25 °C; and mycelium covers the plate after 5–6 days at 25 °C. Colonies show indistinct zonation. Mycelia are dense, opaque, and thick; hyphae are wide, sinuous and often form strands on the margin (Fig. 5c). Margin is thick and defined. Aerial hyphae are abundant and form a thick green downy mat. Conidiation forms abundantly within 4 days in broad concentric rings. Chlamydospores examined after 7 days are 5–9 × 5.5–8.5 μm ( = 6.5 ± 0.9 × 6.5 ± 0.9, n = 30), globose when terminal, smooth, and intercalary (Fig. 5m).
On SNA, after 72 h, growth is 33–35 mm at 20 °C and 38–40 mm at 25 °C; and mycelium covers the plate after 7–8 days at 25 °C. Colonies show distinct zonation. Mycelia are thin and yellow to green; hyphae are wide and sinuous, with indistinct strands on the margin (Fig. 5d). Margin is thin and ill-defined. Aerial hyphae are slight, forming a thin green downy fluff appearing in the colony (Fig. 5e). Diffusing pigment was observed in a ring, and no distinct odor was noted. Conidiation is similar to CMD.
Accepted species previously reported in China
Trichoderma alni Jaklitsch, Mycologia 100: 799. 2008 (Fig. 6).
Figure 6.
Cultures and asexual morph of Trichoderma alni. (a–d). Cultures after 7 days at 25 °C [(a) on CMD; (b) on MEA; (c) on PDA; and (d) on SNA]. € Coilings of aerial hyphae (PDA, 6 days). (f–j,l). Conidiophores and phialides (CMD, 5–7 days). (k) Conidiation tuft (PDA, 7 days). (m) Conidia (CMD, 6 days). (n,o) Chlamydospores (PDA, 7 days). Scale bars: (e–j,l–o) = 10 μm; (k) = 2 mm.
Description: Cultures and anamorph: Optimum growth at 25 °C on all media; no growth at 35 °C. On CMD, after 72 h, growth of 34–36 mm at 20 °C and 50–51 mm at 25 °C; and mycelium covers the plate after 5–6 days at 25 °C. Colonies show distinct zonation. Mycelia are loose and thin; hyphae are narrow and sinuous and often form strands on the margin (Fig. 6a). Aerial hyphae are slight and form a thin white to green downy, fluffy or floccose mat. No diffusing pigment or distinct odor is noted. Conidiophores are hyaline and thick, with side branches on several levels at the base of the elongations that are mostly paired and in right angles with phialides in whorls of 3–5. Phialides are 5.5–11.5 × 2–3.5 μm ( = 8 ± 1.4 × 2.5 ± 0.4, n = 50) and 1.5–2.5 μm ( = 2 ± 0.4) wide at the base, often short and wide, and ampulliform (Fig. 6f–j,l). Conidia are 3–4 × 2.5–3.5 μm ( = 3.5 ± 0.2 × 3 ± 0.2, n = 50), dark green, smooth, and ellipsoidal (Fig. 6m).
On PDA, after 72 h, growth is 33–35 mm at 20 °C and 41–43 mm at 25 °C; and mycelium covers the plate after 6–7 days at 25 °C. Colonies show indistinct zonation. Mycelia are dense, opaque, and thick; hyphae are wide, sinuous and often form strands on the margin (Fig. 6c). Margin is thin and ill defined. Aerial hyphae are slight, coiled (Fig. 6e), forming a thin white to green downy, fluffy or floccose mat (Fig. 6k). Chlamydospores examined after 7 days are 6–9.5 × 5–8 μm ( = 7.5 ± 0.9 × 7 ± 0.9, n = 30), globose to oval when terminal, and smooth, and few are intercalary (Fig. 6n,o).
On SNA, after 72 h, growth is 18–19 mm at 20 °C and 28–32 mm at 25 °C; and mycelium covers the plate after 6–7 days at 25 °C. Colonies show distinct zonation. Mycelia are thin and yellow to green; hyphae are wide and sinuous and show indistinct strands on the margin (Fig. 6d). Margin is thin and ill-defined. Aerial hyphae are slight and form a thin white downy, fluffy, or floccose mat appearing in distal parts of the colony. No diffusing pigment or distinct odor was noted. Conidiation is similar to CMD.
Trichoderma harzianum Rifai, Mycol. Pap. 116: 38, 1969 (Fig. 7).
Figure 7.
Cultures and asexual morph of Trichoderma harzianum. (a–d) Cultures after 7 days at 20 °C [(a) on CMD; (b) on MEA; (c) on PDA; and (d) on SNA]. (e) Conidiation tuft (CMD, 7 days). (f–j) Conidiophores and phialides (CMD, 5–7 days). (k) Conidia (CMD, 5 days). (l,m) Chlamydospores (PDA, 7 days). Scale bars: (e) = 2 mm; (f–m) = 10 μm.
Description: Cultures and anamorph: optimal growth at 25 °C on all media. On CMD, after 72 h, growth is 34–38 mm at 20 °C and 46–53 mm at 25 °C; mycelium covers the plate after 5–6 days at 25 °C. Colonies show distinct zonation. Mycelia are loose and thin; hyphae are narrow, sinuous, and often form strands on the margin (Fig. 7a). Aerial hyphae are abundant and radiating and form thick green downy, fluffy, or floccose mats (Fig. 7e). No diffusing pigment, but fragrant odor noted. Conidiophores are pyramidal with opposing branches, with each branch terminating in a cruciate whorl of up to four or five phialides. Phialides are frequently solitary or in a whorl of three or four. Phialides are ampulliform to lageniform and often constricted below the tip to form a narrow neck of 4.5–8 × 2–3.5 μm ( = 6 ± 0.8 × 2.5 ± 0.3, n = 50) and 1–2.5 μm ( = 2 ± 0.3) wide at the base (Fig. 7f–j). Conidia are subglobose to ovoid, 3–4.5 × 2.5–3.3 μm ( = 3.5 ± 0.3 × 3 ± 0.2, n = 50), laurel-green to bright green, smooth, and ellipsoidal (Fig. 7k).
On PDA, after 72 h, growth is 41–43 mm at 20 °C and 50–55 mm at 25 °C; and mycelium covers the plate after 5–6 days at 25 °C. Colonies show distinct zonation. Mycelia are dense, opaque, and thick; hyphae are wide and sinuous and often form strands on the margin (Fig. 7c). Margin is thick and ill defined. Aerial hyphae are abundant and radiating and form thick green downy, fluffy or floccose mats. Chlamydospores examined after 7 days are 5.5–9 × 5.5–9.0 μm ( = 7 ± 0.8 × 7 ± 0.8, n = 30), globose to oval when terminal and smooth, showing an almost unobserved intercalary (Fig. 7l,m).
On SNA, after 72 h, growth is 33–35 mm at 20 °C and 38–40 mm at 25 °C; and mycelium covers the plate after 7–8 days at 25 °C. Colonies show distinct zonation. Mycelia are thin and green; hyphae are narrow and sinuous and show indistinct strands on the margin (Fig. 7d). Margin is thin and ill defined. Aerial hyphae are slight and form a thick downy, fluffy, or floccose mat appearing in the colony. No diffusing pigment or distinct fragrant odor was noted. Conidiation was similar to CMD.
Trichoderma polysporum Rifai, Mycol. Pap. 116: 18, 1969 (Fig. 8).
Figure 8.
Cultures and asexual morph of Trichoderma polysporum. (a–d) Cultures at 20 °C [(a) on CMD, 7 days; (b) on MEA, 15 days; (c) on PDA, 15 days; and (d) on SNA, 15 days]. (i) Conidiation tuft (PDA, 15 days). (e–h,j) Conidiophores and phialides (CMD, 5–7 days). (k) Chlamydospores (CMD, 7 days). (l) Conidia (PDA, 6 days). Scale bars: (i) = 2 mm; (e–h,j) = 10 μm.
Description: Cultures and anamorph: optimal growth at 20 °C on all media, no growth at 35 °C. On CMD, after 72 h, growth is 14–16 mm at 20 °C and 9–12 mm at 25 °C; and mycelium covers the plate after 9–10 days at 20 °C. A colony is hyaline, thin and loose, with little mycelium on the agar surface, and it is indistinctly zonate but becomes zonate by conidiation in white tufts after 4–5 d and grass green to green after 6 days (Fig. 8a). Aerial hyphae are long and dense and forming little greenish aggregates that are granular to pulvinate. No pigment or odor. Conidiation noted after 4–5 days, and it is white to greenish, with sterile smooth to rough helical elongations in the distal zones from pustules. Conidiophores are hyaline and thick with side branches on several levels at the base of the elongations that are mostly paired and at right angles with phialides in whorls of 2–5. Phialides are 5–10.5 × 2.5–4 μm ( = 7 ± 1.9 × 3.5 ± 0.4, n = 50) and 2–4 μm ( = 3 ± 0.5) wide at the base, often short and wide and ampulliform (Fig. 8e–h,j). Conidia are 2.5–4 × 2–3 μm ( = 3.5 ± 0.4 × 2.5 ± 0.2, n = 50), hyaline, smooth, and ellipsoidal (Fig. 10l).
Figure 10.
Cultures and asexual morph of Trichoderma rossicum. (a–d) Cultures after 7 days at 25 °C [(a) on CMD; (b) on MEA; (c) on PDA; and (d) on SNA]. € Conidiation tuft (PDA, 7 days). (f–h,j,k) Conidiophores and phialides (CMD, 5–7 days). (i) Elongations (CMD, 6 days). (l,n) Conidia (CMD, 6 days). (m) Chlamydospores (PDA, 7 days). Scale bars: (e) = 2 mm; (f–n) = 10 μm.
On PDA, after 72 h, growth is 24–26 mm at 20 °C and 13–16 mm at 25 °C; and mycelium covers the plate after 8–9 days at 20 °C. A colony is densest, distinctly zonate, and grass green to spearmint green; mycelia are conspicuously dense; and surface hyphae form radial strands (Fig. 8c). Aerial hyphae are long and dense and form greenish aggregates that are granular to pulvinate (Fig. 8i). No diffusing pigment and odor. Chlamydospores examined after 7 days are 5.5–9 × 5–7.5 μm ( = 7 ± 0.9 × 6 ± 0.6, n = 30), globose to oval when terminal, and smooth, with an almost unobserved intercalary (Fig. 8k).
On SNA, growth is approximately 7 mm/day at 20 °C and 5 mm/day at 25 °C; and mycelium covers the plate after 10 days at 20 °C. A colony is hyaline, thin, and loose, with little mycelium on the agar surface, not or indistinctly zonate, but becomes zonate by conidiation in white tufts after 4–5 days; and the margin is downy by long aerial hyphae, which degenerating/dissolving soon (Fig. 8d).
Trichoderma pyramidale W. Jaklitsch & P. Chaverri, Mycologia 107: 581, 2015 (Fig. 9).
Figure 9.
Cultures and asexual morph of Trichoderma pyramidale. (a–d) Cultures at 25 °C [(a) on CMD, 7 days; (b) on MEA, 4 days; (c) on PDA, 4 days; and (d) on SNA, 4 days]. (e) Conidiation tuft (PDA, 7 days). (f–j) Conidiophores and phialides (CMD, 5–7 days). (k) Conidia (CMD, 6 days). (l) Chlamydospores (PDA, 7 days). Scale bars: (e) = 2 mm; (f–l) = 10 μm.
Description: Cultures and anamorph: optimal growth at 25 °C on all media, with little growth at 35 °C. On CMD, after 72 h, growth is 29–32 mm at 20 °C and 48–53 mm at 25 °C; and mycelium covers the plate after 5–6 days at 25 °C. Colonies show distinct zonation. Mycelium is loose and thin; hyphae are narrow, sinuous, and often form strands on the margin (Fig. 9a). Aerial hyphae are slight, forming a thin white to green downy, fluffy or floccose mat. Brown pigment is shown, but no distinct odor noted. Conidiophores are hyaline and thick with side branches on several levels at the base of the elongations that are mostly paired and at right angles with phialides in whorls of 3–5. Phialides are 5–9.5 × 2.5–3 μm ( = 7 ± 1.1 × 3 ± 0.3, n = 50) and 1–2.5 μm ( = 1.5 ± 0.3) wide at the base and often short, wide, and ampulliform (Fig. 9f–j). Conidia are 2.5–4 × 2.5–3.5 μm ( = 3.5 ± 0.3 × 3 ± 0.2, n = 50), green, smooth, and ellipsoidal (Fig. 9k).
On PDA, after 72 h, growth is 41–43 mm at 20 °C and 50–55 mm at 25 °C; and mycelium covers the plate after 5–6 days at 25 °C. Colonies show indistinct zonation. Mycelia are dense, opaque, and thick; hyphae are wide, sinuous and often form strands on the margin (Fig. 9c). Margin is thin and ill defined. Aerial hyphae are slight and form a thin white to green downy, fluffy or floccose mat (Fig. 9e). Chlamydospores examined after 7 days are 5.5–10 × 5.5–10 μm ( = 7 ± 0.9 × 7 ± 0.9, n = 30), globose to oval when terminal or intercalary, and smooth (Fig. 9l).
On SNA, after 72 h, growth is 33–35 mm at 20 °C and 38–40 mm at 25 °C; and mycelium covers the plate after 7–8 days at 25 °C. Colonies show distinct zonation. Mycelium is thin, yellow to green; hyphae are wide, sinuous, with indistinct strands on the margin (Fig. 9d). Margin is thin and ill defined. Aerial hyphae are slight and form a thin white downy, fluffy or floccose mat in distal parts of the colony. No diffusing pigment or distinct odor noted. Conidiation similar to CMD.
Trichoderma rossicum Bissett et al., Canad. J. Bot. 81: 578, 2003 (Fig. 10).
Description: Cultures and anamorph: optimal growth at 25 °C on all media. On CMD, growth of 10–11 mm/day at 20 °C and 15–17 mm/day at 25 °C; and mycelium covers the plate after 6–7 days at 20 °C. Colony is dense with a wavy margin, and the surface becomes distinctly zonate (Fig. 10a). Aerial hyphae are numerous, long, elongate, and villiform in the plate (Fig. 10i). No diffusing pigment or odor. Autolytic activity is variable, and coilings are scarce or inconspicuous. Conidiation noted after 3–4 days at 20 °C. Conidiation is effuse and in intense tufts that are hemispherical or irregular, and they show wide wheel grain banding that is gray green to deep green. Conidiophores radiate from the reticulum and are broad, straight, sinuous or helically twisted, show distally slightly pointed elongations, taper from the main axes to top branches, and present primary branches arranged in pairs or in whorls of 2–3, with secondary branches to solitary. Phialides are 4.5–14 × 2.5–4 μm ( = 7 ± 1.5 × 3.5 ± 0.3, n = 50) and 2–3.5 μm ( = 3 ± 0.4) wide at the base, ampulliform, and in whorls of 3–6 (Fig. 10f–h,j,k). Conidia are 3.5–5.5 × 2.5–4 μm ( = 4.5 ± 0.5 × 3 ± 0.2, n = 50), short cylindrical, and a gray color when single and pea green to yellow green in a group (Fig. 10l,n).
On PDA, growth is 12–15 mm/day at 20 °C, 12–16 mm/day at 25 °C; and mycelium covers the plate after 4–5 days at 25 °C. Colony is denser with a wavy margin than that on CMD, and the surface is distinctly zonate (Fig. 10c). Aerial hyphae are numerous, long, and villiform to pulvinate in the plate. No diffusing pigment and odor (Fig. 10e). Autolytic activity is variable, coilings are scarce or inconspicuous. Chlamydospores examined after 7 days are 6.5–9.5 × 6–9 μm ( = 7 ± 1.0 × 7 ± 0.9, n = 30), terminal and intercalary, globose or ellipsoidal, and smooth (Fig. 10m).
On SNA, growth is 8–13 mm/day at 20 °C and 8–12 mm/day at 25 °C; and mycelium covers the plate after 6–7 day at 25 °C. Colony is hyaline, thin and dense; and mycelium degenerate rapidly (Fig. 10d). Aerial hyphae are inconspicuous, autolytic activity is scant, and coilings are distinct. Conidiation noted after approximately 4 days and starts in white fluffy tufts spreading from the center to form concentric zones, and they compact to pustules with a white to greenish color.
Discussion
To characterize the biodiversity and establish the species composition of Trichoderma associated with soil in the Zoige alpine wetland ecological region of Southwest China, morphological characteristics and multilocus phylogenetic analyses were performed to identify 80 strains as T. harzianum (48 strains, 60%), T. alni (15 strains, 18.75%), T. zoigense (a new species, 8 strains, 10%), T. rossicum (4 strains, 5%), T. atrobrunneum (3 strains, 3.75%), T. polysporum (1 strain, 1.25%) and T. pyramidale (1 strain, 1.25%). This is the first comprehensive report on the population structure of Trichoderma in the Zoige alpine wetland. A specialized analysis of Trichoderma from 100 soil samples shows a high richness of the Trichoderma species in this region and indicates the presence of latent resources, due to their complex natural environment and unique climatic conditions. Zoige alpline wetland is generally considered the most important carbon sink ecosystem, in which soil microflora and fungi play vital roles in biogeochemical cycles. So, we should focus on Trichoderma species that contributes to carbon (nutrient) cycles and other functions in Zoige alpine wetlands in subsequent studies.
In this study, the high throughput amplicon sequencing (HTAS) approach based on ITS have used to evaluate species diversity of Trichoderma spp., but showed ineffectively. 13 OTUs of Trichoderma spp. were obtained from 11 soil samples. However, because the single ITS region is not accurate for determining species of Trichoderma, the diversity of the genus remains unclear based on the high-throughput sequencing results. Therefore, the data have not been shown in the study.
Although many studies have focused on identifying Trichoderma, identifying Trichoderma species based on only morphological characteristics remains difficult. Amplifying four universal fungal genes, gpd, acl1, rpb2 and tef1, showed that the gpd gene could divide approximately the 57 representative strains into 4 clades, which were precisely aligned with the previous 4 morphological groups. The gpd gene was suitable for categorizing large groups but was not helpful for the accurate identification of speciation within the Trichoderma complex71. In fact, any single gene among acl1, rpb2 and tef1 can play an essential role in identifying Trichoderma species but cannot accurately distinguish Trichoderma at the species level. Notably, although the primer pair EF1-728F and TEF1LLErev for tef1 was helpful, it did not always successfully amplify all tested DNA materials. Admittedly, many factors affect PCR amplification, not all of which can be attributed to primers, among which the quality of DNA may also be one of the factors. Phylogenetic studies of many species have proven that the most accurate method of species identification is to combine phylogenetic analysis with morphological phenotypic characteristics. In this study, when the genes acl1, rpb2 and tef1 were used in multilocus phylogenetic analysis, the phylogenetic relationships among taxa were consistent with those identified in previous studies in which the phylogenetic tree was built based on the genes rpb2 and tef1 either singly or in combination46,47,49,56.
We found that the Longibrachiatum clade contained a new species, T. zoigense, which was phylogenetically distinct from any other species of Trichoderma (Fig. 2) and provided a low level of support for relationships with T. citrinoviride (C.P.K. 2005) and T. saturnisporum (ATCC 18,903) (Fig. 2, MPBP = 62%). Compared to their morphological characteristics of the above two species, T. zoigense was challenging to distinguish from T. citrinoviride and T. saturnisporum by colony and spores. However, T. zoigense produced yellow pigment dispersion and a fragrance in all tested media and easily produced chlamydospores42,46,47,52,71.
The results of our studies demonstrated significant differences in the abundance and distribution of Trichoderma species isolated in the Zoige alpine wetland natural region. T. harzianum showed the highest abundance among the species isolated from five soil layers and four soil types, implying that this species had good adaptability and could survive under most environmental conditions. Only T. polysporum was isolated at a soil depth of 50–100 cm, indicating that it prefers to live in a low-temperature environment72. In general, it is assumed that some Trichoderma species have stricter requirements for the growth environment and, thus, a narrower range for survival73.
Conclusion
In conclusion, seven Trichoderma species were identified from 100 soil samples collected from Zoige alpine wetland ecological regions, and T. harzianum was the preponderant species. The recognition of Trichoderma zoigense was described for the first time as a new species, and T. atrobrunneum as a new record for China was found. The results of our research will provide a reference for a greater understanding of soil microorganisms, ecological rehabilitation and reconstruction, and as microbial resources in the Zoige alpine wetland.
Materials and methods
Study region
The Zoige alpine wetland (32° 10′ ~ 34° 10′ N, 101° 45′ ~ 103° 55′ E) is located in the northwest part of Sichuan Province in China and on the eastern edge of the Qinghai-Tibet Plateau and has an average altitude of 3400 m above sea level and an area of 19,600 km2. It is a relatively pristine natural area with an annual temperature of 0.6–1.0 °C and an annual precipitation level of 580–860 mm. The cold, humid weather slows the decomposition of the soil organic matter and facilitates its accumulation in the soil74–76. Peat soil, meadow soil, subalpine meadow soil and aeolian sandy soil are extensively developed and the most common soil types in this area, because of its unique ecological conditions.
Isolates and specimens
A total of 100 soil samples were collected across a range of soil types (peat soil, meadow soil, subalpine meadow soil and aeolian sandy soil) and soil layers (depth 0–10, 10–20, 20–30, 30–50, and 50–100 cm) in the Zoige alpine wetland ecological regions. Global positioning system technology (GPS Map 76; Garmin Ltd, USA) was used to determine the sampling locations. After removal of vegetation debris, approximately 300 g of each soil sample was immediately placed in a sterile plastic bag in a cooler, transported to the laboratory within 48 h and then stored at 4 °C.
Soil fungi were isolated using the suspension plating method77. Briefly, suspensions (1 mL) of various dilutions (10–1, 10–2 and 10–3) were placed on 90 mm diameter petri plates and Martin medium was then added and mixed evenly with the suspension. The plates were kept in the dark at 25 °C for 5 days, and the colonies of fungi were observed and counted. Three replicates were performed for each concentration. According to the colony characteristics, the purified fungal colonies were transferred onto potato dextrose agar (PDA) and kept in tube slants and glycerol for further taxonomic identification. The specimens were deposited in the Fungal Herbarium of Sichuan Agricultural University, with accession numbers of T1–T80. Moreover, the holotype of new species and new record species were deposited in China General Microbiological Culture Collection Center (CGMCC), with accession numbers CGMCC3.20145 and CGMCC3.20167.
Morphology and growth rate
Cultures were prepared and maintained as described previously46,78. Cultures used for the study of asexual morph micromorphology were grown on PDA, on CMD (cornmeal agar supplemented with 2% (w/v) D (+)-glucose-monohydrate) containing 0.02% (w/v) streptomycin sulfate (Solarbio, China) and 0.02% (w/v) neomycin sulfate (Solarbio), on SNA (low-nutrient agar)68,79 or occasionally on MEA (2% malt extract, 2% agar–agar) at 20 °C or 25 °C under a 12 h/12 h light/dark cycle with cool white fluorescent light during the light period.
Fungal colony characteristics were observed on the CMD, PDA, MEA and SNA media and grown under 12 h of white light and 12 h of darkness at 20 °C and 25 °C. Colony textures and the presence or absence of exudates were recorded using a stereomicroscope (OLYMPUS SZX16, Japan). Colony morphologies were observed weekly with a digital camera (Nikon D3100, Japan). Micromorphological characteristics were observed after 3–7 days or 14 days of cultivation, and microscopic observations were performed in 3% KOH. Chlamydospores were measured from 7 to 30-day-old cultures on CMD or SNA plates under a compound microscope using a 100 × objective. The following characteristics of each isolate were measured: length and width of conidia (n = 50), length of phialides (n = 50), width of phialides at the base (n = 50), and width of phialides at the widest point (n = 50). Nomarski differential interference contrast (DIC) was used for observations and measurements, and data were gathered using a Carl Zeiss microscope (Axio Imager Z2, Germany). Colors were determined with Methuen’s Handbook of Colour.
To identify the optimal growth temperature and differentiate growth rates of the species, 3 representative strains or all strains (≤ 3 in total) for each species were selected to determine the growth rate on CMD at five temperature levels (15 °C, 20 °C, 25 °C, 30 °C and 35 °C) as described previously with minor modifications46. The strains were pre-grown on PDA for 48 h or 72 h at 25 °C. For new cultures, 5-mm agar blocks were cut from the margin of the colonies and transferred to fresh medium from the edge of the 9-cm petri dish. The maximum colony radius was measured every day until the plates were entirely covered with mycelium. The growth rate was calculated by linear regression of t versus r (t = time of incubation and r = radius measured from the edge of the agar plug).
Molecular characterization
DNA samples of representative isolates of 57 morphotypes, which were chosen according to the morphological and cultural characteristics, were extracted from pure cultures (72 h at 25 °C) for phylogenetic analysis as described by Barnes et al.80. Part of the nuclear rDNA ITS region was amplified by PCR using the primer pair ITS1 5′ TCCGTAGGTGAACCTGCGG3 and ITS4 5′ TCCTCCGCTTATTGATATGC81. A 1-kb fragment of RNA polymerase II subunit B (rpb2) was amplified using the primer pair fRPB2-5f 5′ GAYGAYMGWGATCAYTTYGG and fRPB2-7cr 5′ CCCATRGCTTGYTTRCCCAT82. A 1.2-kb fragment of translation elongation factor 1 alpha (tef1) was amplified using the primer pair EF1-728F 5′ CATCGAGAAGTTCGAGAAGG83 and TEF1LLErev 5′ AACTTGCAGGCAATGTGG78. A 0.9-kb fragment of the larger subunit of ATP citrate lyase (acl1) was amplified using the primers acl1-230up 5′ AGCCCGATCAGCTCATCAAG and acl1-1220low 5′ CCTGGCAGCAAGATCVAGGAAGT84. A 0.4-kb fragment of a partial sequence of the glyceraldehyde-3-phosphate dehydrogenase (gpd) gene region was amplified using the primers GDF1 5′ GCCGTCAACGACCCCTTCATTGA and GDR1 5′ GGGTGGAGTCGTACTTGAGCATGT85,86. The PCR mixtures (30 μL) contained 1 μL of genomic DNA (approximately 100 ng), 1 μL of each primer (10 mM), 12 μL of sterile deionized water, and 15 μL of 2 × PCR MasterMix (TIANGEN Co., China). Amplifications were performed in an Eppendorf PCR amplifier (Mastercycler nexus X2, Germany). PCR products were sequenced with an ABI 3730xl DNA Analyzer by Sangon Biotech (Shanghai, China).
Phylogenetic analyses
For approximate identification, all sequences of the 57 strains listed in Table 2 were compared with the NCBI sequence database using the BLAST algorithm. The two markers (ITS and gpd) sequenced in the present study were analyzed separately.ClustalX87 aligned their closest matches, and a distance tree was built with the neighbor-joining (NJ) algorithm in MEGA v. 6.0 with 1000 bootstrap replicates81,88. Combined rpb2, tef1 and acl1 gene sequences were analyzed based on a multilocus dataset. Finally, a phylogenetic analysis was performed for the sequences of a total of 101 strains obtained from the present study or other references in previous studies and complemented with GenBank sequences46,47.
Maximum parsimony (MP) analyses of the combined DNA matrix was performed with PAUP* v. 4.0 b1089 using 1000 replicates of a heuristic search with the random addition of sequences. All molecular characteristics were unordered and given equal weight, and all gaps were treated as missing data. The stability of clades was evaluated by bootstrap analysis with 1000 replicates. Descriptive tree statistics for parsimony (tree length [TL], consistency index [CI], retention index [RI], related consistency [RC] and homoplasy index [HI]) were calculated.
Relationship with ecological factors
The isolation frequency was calculated at the species level using the following formula:
where F is the isolation frequency (%), n is the number of species isolated from soil samples, and N is the number of total soil samples. The relationships between the isolation frequency, soil types, and soil layers were subsequently analyzed.
Supplementary Information
Acknowledgements
We would like to thank Wang, J.Y., Peng, D. D., Ye, M. P., Xie, W. J., Qi, X. B., Sun, X. F. and Liu, F. L. at Sichuan Agricultural University for collecting material and providing methods.
Author contributions
G.T.T. designed the experiment, analyzed the data, and prepared the writing-original draft. Y.L. and Y.Z. analyzed the data and revised the manuscript. Y.H.Z. and X.J.Z. performed the micrograph. X.L.C. revised the manuscript. S.R.Z. collected the samples and reviewed the manuscript. G.S.G. designed the experiment and reviewed the manuscript. All authors read and approved the final manuscript.
Funding
This study was funded by Sichuan Maize Innovational Team of Industry Technology System of Modern Agriculture (Grant no. sccxtd-2020-02).
Data availability
All DNA sequences generated in this study have been registered to GenBank(https://www.ncbi.nlm.nih.gov). Supplementary material contains GenBank accessions of the sequences generated at STable1, and other raw data. The holotype of new species and new record species were deposited in China General Microbiological Culture Collection Center (CGMCC), with accession numbers CGMCC3.20145 and CGMCC3.20167.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
These authors contributed equally: Gui-Ting Tang and Ying Li.
Contributor Information
Shi-Rong Zhang, Email: srzhang01@aliyun.com.
Guo-Shu Gong, Email: guoshugong@sicau.edu.cn.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-022-25223-0.
References
- 1.Mueller GM, Bills GF, Foster MS. Biodiversity of Fungi: Inventory and Monitoring Methods. Elsevier Academic Press; 2004. pp. 280–302. [Google Scholar]
- 2.Gadd GM. Geomycology: Biogeochemical transformations of rocks, minerals, metals and radionuclides by fungi, bioweathering and bioremediation. Mycol. Res. 2007;111:3–49. doi: 10.1016/j.mycres.2006.12.001. [DOI] [PubMed] [Google Scholar]
- 3.Hollister EB, Schadt CW, Palumbo AV, Ansley RJ, Boutton TW. Structural and functional diversity of soil bacterial and fungal communities following woody plant encroachment in the southern Great Plains. Soil. Biol. Biochem. 2010;42:1816–1824. doi: 10.1016/j.soilbio.2010.06.022. [DOI] [Google Scholar]
- 4.James AW, Brain CS, Neil JM, Alan CG. Species and organ specificity of fungal endophytes in herbaceous grassland plants. J. Ecol. 2012;100:1085–1092. doi: 10.1111/j.1365-2745.2012.01997.x. [DOI] [Google Scholar]
- 5.Tedersoo L, Bahram M, Toots M, Diedhiou AG, Henkel TW, Kjoller R, Morris MH, Nara K, et al. Towards global patterns in the diversity and community structure of ectomycorrhizal fungi. Mol. Ecol. 2012;21:4160–4170. doi: 10.1111/j.1365-294X.2012.05602.x. [DOI] [PubMed] [Google Scholar]
- 6.Wardle DA, Yeates GW, Barker GM, Bonner KI. The influence of plant litter diversity on decomposer abundance and diversity. Soil. Biol. Biochem. 2006;38:1052–1062. doi: 10.1016/j.soilbio.2005.09.003. [DOI] [Google Scholar]
- 7.Singh BK, Munro S, Potts JM, Millard P. Influence of grass species and soil type on rhizosphere microbial community structure in grassland soils. Appl. Soil. Ecol. 2007;36:147–155. doi: 10.1016/j.apsoil.2007.01.004. [DOI] [Google Scholar]
- 8.Nguyen NH, Williams LJ, Vincent JB, Stefanski A, Cavender-Bares J, Messier C, Paquette A, Gravel D, Reich PB, Kennedy PG. Ectomycorrhizal fungal diversity and saprotrophic fungal diversity are linked to different tree community attributes in a field-based tree experiment. Mol. Ecol. 2016;25:4032. doi: 10.1111/mec.13719. [DOI] [PubMed] [Google Scholar]
- 9.Yao XM, Lv GZ, Yang H, Zhao Z-H, Chen R. Studies of fungal flora in forest soil of Changbai Mountains. J. Fungal. Res. 2007;5:43–46. [Google Scholar]
- 10.Tian JQ, Wu B, Chen H, Jiang N, Kang XM, Liu XZ. Patterns and drivers of fungal diversity along an altitudinal gradient on Mount Gongga, China. J. Soils. Sediments. 2017;17:2856–2865. doi: 10.1007/s11368-017-1701-9. [DOI] [Google Scholar]
- 11.Atanasova, L., Druzhinina, I. S., Jaklitsch. W. M. Two hundred Trichoderma species recognized on the basis of molecular phylogeny. In Trichoderma: Boil Applications CABI, Wallingford, USA, 10–42 (2013).
- 12.Kredics, L., Hatvani, L., Naeimi, S., Kormoczi, P., Manczinger, L., Vagvolgyi, C., Irina, D. Biodiversity of the genus Hypocrea/Trichoderma in different habitats. In Biotechnology and Biology of Trichoderma 3–24 (Elsevier, 2014).
- 13.Bissett J, Gams W, Jaklitsch W, Gary JS. Accepted Trichoderma names in the year 2015. Ima. Fungus. 2015;6:263–295. doi: 10.5598/imafungus.2015.06.02.02. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Nelson EE. Occurrence of Trichoderma in a Douglas-fir soil. Mycologia. 1982;74:280–284. doi: 10.1080/00275514.1982.12021502. [DOI] [Google Scholar]
- 15.Samuels GJ. Trichoderma: A review of biology and systematics of the genus. Mycol. Res. 1996;100:923–935. doi: 10.1016/S0953-7562(96)80043-8. [DOI] [Google Scholar]
- 16.Reese ET, Mandels M. Rolling with the times: Production and applications of Trichoderma reesei cellulase. Annu. Rep. Ferment Processes (U.S.). 1984;7:1–20. doi: 10.1016/B978-0-12-040307-3.50006-8. [DOI] [Google Scholar]
- 17.Hjeljord L, Tronsmo A. Trichoderma and Gliocladium in biological control: An overview. Trichoderma Gliocladium. 1998;2:131–151. [Google Scholar]
- 18.Yedidia I, Srivastva AK, Kapulnik Y, Chet I. Effect of Trichoderma harzianum on microelement concentrations and increased growth of cucumber plants. Plant. Soil. 2001;235:235–242. doi: 10.1023/A:1011990013955. [DOI] [Google Scholar]
- 19.Sivasithamparam K, Ghisalberti EL. Secondary metabolism in Trichoderma and Gliocladium. Trichoderma Gliocladium Basic Biol. Taxon. Genet. 1998;1:139–191. [Google Scholar]
- 20.Hanada, R.E., Souza, T. J., Pomella, A. W. V., Hebbar, K. P., Pereira, J. O., Ismaiel, A., Samuels, G. J. Trichoderma martiale sp. nov., a new endophyte from sapwood of Theobroma cacao with a potential for biological control. Mycol. Res. 112, 1335–1343 (2008). [DOI] [PubMed]
- 21.Woo SL, Ruocco M, Vinale F. Trichoderma-based products and their widespread use in agriculture. J. Open. Mycol. 2014;8:1. doi: 10.2174/1874437001408010071. [DOI] [Google Scholar]
- 22.Shenouda ML, Ambilika M, Skellam E, Cox RJ. Heterologous expression of secondary metabolite genes in Trichoderma reesei for waste valorization. J. Fungi. 2022;8:355–368. doi: 10.3390/jof8040355. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Cai F, Chen W, Wei Z, Pang G, Li RX, Ran W, Shen QR. Colonization of Trichoderma harzianum strain SQR-T037 on tomato roots and its relationship to plant growth, nutrient availability and soil microflora. Plant. Soil. 2015;388:337–350. doi: 10.1007/s11104-014-2326-z. [DOI] [Google Scholar]
- 24.Andreolli M, Lampis S, Brignoli P, Vallini G. Trichoderma longibrachiatum Evx1 is a fungal biocatalyst suitable for the remediation of soils contaminated with diesel fuel and polycyclic aromatic hydrocarbons. Environ. Sci. Pollut. Res. 2016;23:9134–9143. doi: 10.1007/s11356-016-6167-6. [DOI] [PubMed] [Google Scholar]
- 25.Degani, O., Dor, S. Trichoderma biological control to protect sensitive maize hybrids against late wilt disease in the field. J. Fungi.7, 315 (2021). [DOI] [PMC free article] [PubMed]
- 26.Ferreira FV, Musumeci MA. Trichoderma as biological control agent: Scope and prospects to improve efficacy. World. J. Microbiol. Biotechnol. 2021;37:90. doi: 10.1007/s11274-021-03058-7. [DOI] [PubMed] [Google Scholar]
- 27.Doi, Y. A revision of Hypocreales with cultural observation I. Some Japanese species of Hypocrea and Podostroma. Bull. Nat.9, 345–357 (1966).
- 28.Doi Y. Revision of the Hypocreales with cultural observations II. Hypocrea dichromospora, sp. Nov. and its Trichoderma state. Bull. Nat. 1968;11:185–189. [Google Scholar]
- 29.Doi Y. Revision of the Hypocreales with cultural observations IV. The genus Hypocrea and its allies in Japan (1) General part. Bull. Nat. 1969;12:693–724. [Google Scholar]
- 30.Doi Y. Some species of the genus Hypocrea. Bull. Nat. 1971;14:387–400. [Google Scholar]
- 31.Doi Y. Revision of the Hypocreales with cultural observations IV. The genus Hypocrea and its allies in Japan (2) Enumeration of the species. Bull. Nat. 1972;15:649–751. [Google Scholar]
- 32.Doi Y. Revision of the Hypocreales with cultural observations VII. The genus Hypocrea and its allied genera in South America (1) Bull. Nat. 1975;1:1–33. [Google Scholar]
- 33.Doi Y. Revision of the Hypocreales with cultural observation IX. The genus Hypocrea and its allied genera in South America (2) Bull. Nat. 1976;2:119–131. [Google Scholar]
- 34.Doi Y. Revision of the Hypocreales with cultural observations XI. Additional notes on Hypocrea and its allies in Japan (1) Bull. Nat. 1978;4:19–26. [Google Scholar]
- 35.Doi Y. Type study on Hypocrea grandis Imai and Chromocrea nigricans Imai. Bull. Nat. 1982;8:29–33. [Google Scholar]
- 36.Doi Y. A new species of Hypocrea (Ascomycota, Hypocreales) from Mikurajima Island, Japan. Mem. Nat. 2001;37:113–118. [Google Scholar]
- 37.Doi Y. Revision of the Hypocreales with cultural observations XIII. The Hypocreaceae of the Sagami Sea maritime forests, Japan. Mem. Nat. 2006;42:223–232. [Google Scholar]
- 38.Doi Y, Liu PG, Tamura M. A new species of the Hypocreales (Ascomycota) from Mt. Changbaishan, northeast China. Bull. Nat. 2001;27:57–63. [Google Scholar]
- 39.Błaszczyk L, Popiel D, Chełkowski J, Koczyk G, Samuels GJ, Sobieralski K, Siwulski M. Species diversity of Trichoderma in Poland. J. Appl. Genet. 2011;52:233–243. doi: 10.1007/s13353-011-0039-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Chaverri P, Castlebury LA, Overton BE, Samuels GJ. Hypocrea/Trichoderma: Species with conidiophore elongations and green conidia. Mycologia. 2003;95:1100–1140. doi: 10.1080/15572536.2004.11833023. [DOI] [PubMed] [Google Scholar]
- 41.Chaverri P, Castlebury LA, Samuels GJ, Geiser DM. Multilocus phylogenetic structure within the Trichoderma harzianum/Hypocrea lixii complex. Mol. Phylogenet. Evol. 2003;27:302–313. doi: 10.1016/S1055-7903(02)00400-1. [DOI] [PubMed] [Google Scholar]
- 42.Samuels GJ, Dodd SL, Lu BS, Petrini O, Schroers HJ, Druzhinina IS. The Trichoderma koningii aggregate species. Stud. Mycol. 2006;56:67–133. doi: 10.3114/sim.2006.56.03. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Jaklitsch WM, Komon M, Kubicek CP, Druzhinina IS. Hypocrea crystalligena sp. nov., a common European species with a white-spored Trichoderma anamorph. Mycologia. 2006;98:499–513. doi: 10.1080/15572536.2006.11832685. [DOI] [PubMed] [Google Scholar]
- 44.Jaklitsch WM, Kubicek CP, Druzhinina IS. Three European species of Hypocrea with reddish brown stromata and green ascospores. Mycologia. 2008;100:796–815. doi: 10.3852/08-039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Jaklitsch WM, Samuels GJ, Dodd SL, Lu BS, Druzhinina IS. Hypocrea rufa/Trichoderma viride: A reassessment, and description of five closely related species with and without warted conidia. Stud. Mycol. 2006;56:135–177. doi: 10.3114/sim.2006.56.04. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Jaklitsch WM. European species of Hypocrea Part I. The green-spored species. Stud. Mycol. 2009;63:1–91. doi: 10.3114/sim.2009.63.01. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Jaklitsch WM, Voglmayr H. Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia. Stud. Mycol. 2015;80:1–87. doi: 10.1016/j.simyco.2014.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Chaverri P, Samuels GJ, Stewart EL. Hypocrea virens sp. nov., the teleomorph of Trichoderma virens. Mycologia. 2001;93:1113–1124. doi: 10.1080/00275514.2001.12063245. [DOI] [Google Scholar]
- 49.Chaverri P, Samuels GJ. Hypocrea/Trichoderma (Ascomycota, Hypocreales, Hypocreaceae): Species with Green Ascospores. Centraalbureau voor Schimmelcultures; 2003. [Google Scholar]
- 50.Samuels GJ. Trichoderma: Systematics, the sexual state, and ecology. Phytopathology. 2006;96:195–206. doi: 10.1094/PHYTO-96-0195. [DOI] [PubMed] [Google Scholar]
- 51.Hoyos-Carvajal L, Orduz S, Bissett J. Genetic and metabolic biodiversity of Trichoderma from Colombia and adjacent neotropic regions. Fungal. Genet. Biol. 2009;46:615–631. doi: 10.1016/j.fgb.2009.04.006. [DOI] [PubMed] [Google Scholar]
- 52.Jaklitsch WM. European species of Hypocrea part II: Species with hyaline ascospores. Fungal. Divers. 2011;48:1–250. doi: 10.1007/s13225-011-0088-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Sun R, Liu Z, Fu K. Trichoderma biodiversity in China. J. Appl. Genet. 2012;53:343–354. doi: 10.1007/s13353-012-0093-1. [DOI] [PubMed] [Google Scholar]
- 54.Li QR, Tan P, Jiang YL, Hyde KD, Mckenzie EHC, Bahkali AH, Kang JC, Wang Y. A novel Trichoderma species isolated from soil in Guizhou, T. guizhouense. Mycol. Progr. 2013;12:167–172. doi: 10.1007/s11557-012-0821-2. [DOI] [Google Scholar]
- 55.Zhang GZ, Zhang XJ, Chen K, Wu XQ, Li JS, Yang HT. Trichoderma paratroviride, Chinese new record of Trichoderma. Shandong. Sci. 2015;28:35–40. [Google Scholar]
- 56.Zhu ZX, Zhuang WY. Trichoderma (Hypocrea) species with green ascospores from China. Persoonia-Mol. Phylogeny Evol. Fungi. 2015;34:113–125. doi: 10.3767/003158515X686732. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Inglis PW, Mello S, Martins I. Trichoderma from Brazilian garlic and onion crop soils and description of two new species: Trichoderma azevedoi and Trichoderma peberdyi. PLoS ONE. 2020;15:e0228485. doi: 10.1371/journal.pone.0228485. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Rodríguez MDCH, Evans HC, Abreu LMD. New species and records of Trichoderma isolated as mycoparasites and endophytes from cultivated and wild coffee in Africa. Sci. Rep. 2021;11:56–71. doi: 10.1038/s41598-021-84111-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Hewedy OA, Abdel Lateif KS, Seleiman MF, Shami A, Albarakaty FM, El-Meihy RM. Phylogenetic diversity of Trichoderma strains and their antagonistic potential against soil-borne pathogens under stress conditions. Biology. 2020;9:189. doi: 10.3390/biology9080189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Hewedy OA, El-Zanaty AM, Fahmi AI. Screening and identification of novel cellulolytic Trichoderma species from Egyptian habitats. Biotechnologia. 2020;101:117–133. doi: 10.5114/bta.2020.94771. [DOI] [Google Scholar]
- 61.Gao JQ, Zhang F, Wang CM. Distribution characteristics of soil libile carbon along water table gradient of alpine wetland soil. J. Soil. Water. Conserv. 2008;22:126–131. [Google Scholar]
- 62.Chen H, Gao YH, Yao SP, Ning WU, Wang YF, Peng L. Spatiotemporal variation of methane emissions from alpine wetlands in Zoige Plateau. Acta. Ecol. Sin. 2008;28:3425–3437. [Google Scholar]
- 63.Zhang GS, Tian JQ, Jiang N, Guo XP, Wang YF, Dong XZ. Methanogen community in Zoige wetland of Tibetan plateau and phenotypic characterization of a dominant uncultured methanogen cluster ZC-I. Environ. Microbiol. 2008;10:1850–1860. doi: 10.1111/j.1462-2920.2008.01606.x. [DOI] [PubMed] [Google Scholar]
- 64.Chen H, Wu N, Gao YH, Wang YF, Luo P, Tian JQ. Spatial variations on methane emissions from Zoige alpine wetlands of Southwest China. Sci. Total. Environ. 2009;407:1097–1104. doi: 10.1016/j.scitotenv.2008.10.038. [DOI] [PubMed] [Google Scholar]
- 65.Dai YM, Yan ZY, Jia LL, Zhang SH, Gao LH, Wei XL, Mei ZL, Liu XF. The composition, localization and function of low-temperature-adapted microbial communities involved in methanogenic degradations of cellulose and chitin from Qinghai-Tibetan Plateau wetland soils. J. Appl. Microbiol. 2016;121:163–176. doi: 10.1111/jam.13164. [DOI] [PubMed] [Google Scholar]
- 66.Ma K, Liu J, Balkovič J. Changes in soil organic carbon stocks of wetlands on China's Zoige plateau from 1980 to 2010. Ecol. Modell. 2016;327:18–28. doi: 10.1016/j.ecolmodel.2016.01.009. [DOI] [Google Scholar]
- 67.Ma K, Zhang Y, Tang SX, Liu JG. Spatial distribution of soil organic carbon in the Zoige alpine wetland, northeastern Qinghai-Tibet Plateau. CATENA. 2016;144:102–108. doi: 10.1016/j.catena.2016.05.014. [DOI] [Google Scholar]
- 68.Yuan N, Kang ZJ, Lu SE, Wang YY, Zhang XP, Gu YF. Community structures of the cold-adapted cellulose-degrading bacteria in the Zoige plateau wetland under enrichment culture conditions. J. Environ. Biol. 2016;22:402–408. [Google Scholar]
- 69.Feng SG, Zhang HX, Wang YF, Bai ZH, Zhuang GQ. Analysis of fungal community structure in the soil of Zoige Alpine Wetland. Acta. Ecol. Sin. 2009;29:260–266. doi: 10.1016/j.chnaes.2009.09.001. [DOI] [Google Scholar]
- 70.Druzhinina IS, Kopchinskiy AG, Komoń M, Bissett J, Szakacs G, Kubicek CP. An oligonucleotide barcode for species identification in Trichoderma and Hypocrea. Fungal. Genet. Biol. 2005;42:813–828. doi: 10.1016/j.fgb.2005.06.007. [DOI] [PubMed] [Google Scholar]
- 71.Druzhinina IS, Kubicek CP, Komoń-Zelazowska M, Mulaw TB, Bissett J. The Trichoderma harzianum demon: complex speciation history resulting in coexistence of hypothetical biological species, recent agamospecies and numerous relict lineages. BMC. Evol. Biol. 2010;10:94. doi: 10.1186/1471-2148-10-94. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Saumels GJ, Petrini O, Kubls K, Lieckfeldt E, Kubicek CP. The Hypocrea schweinitzii complex and Trichoderma sect. Longibrachiatum. Stud. Mycol. 1998;41:1–51. [Google Scholar]
- 73.Domsch, K. H., Gams, W., Anderson, T. H. Compendium of Soil Fungi, 2nd Taxonomically Revised Edition by W. Gams. 1–672 (IHW-Verlag Eching, 2007).
- 74.Chen JA, Qiu DL, Wang WM, Yang HM, Du FL. Effect of soil ecological environment on survival of Trichoderma. Mod. Agric. Sci. Technol. 2009;21:217–218. [Google Scholar]
- 75.Sun, G. Y., Zhang, W. F., Zhang, J. J. The Mire and Peatland of the Hengduan Mountainous Region. 352 (Science Press, 1998).
- 76.Ding WX, Cai ZC, Wang DX. Preliminary budget of methane emissions from natural wetlands in China. Atmos. Environ. 2004;38:751–759. doi: 10.1016/j.atmosenv.2003.10.016. [DOI] [Google Scholar]
- 77.Mueller GM. Biodiversity of Fungi: Inventory and Monitoring Methods. Academic Press; 2011. [Google Scholar]
- 78.Jaklitsch WM, Komon M, Kubicek CP, Druzhinina IS. Hypocrea voglmayrii sp. nov. from the Austrian Alps represents a new phylogenetic clade in Hypocrea/Trichoderma. Mycologia. 2005;97:1365–1378. doi: 10.1080/15572536.2006.11832743. [DOI] [PubMed] [Google Scholar]
- 79.Nirenberg HI. Untersuchungen uber die morphologische und biologische Differenzierung in der Fusarium-Sektion Liseola. Mitt Biol Bundesanst Land-u Forstwirtsch Berlin-Dahlem. 1976;169:1–117. [Google Scholar]
- 80.Barnes I, Roux J, Wingfield MJ. Characterization of Seiridium spp. associated with cypress canker based on ß-tubulin and Histone sequences. Plant. Dis. 2001;85:317–321. doi: 10.1094/PDIS.2001.85.3.317. [DOI] [PubMed] [Google Scholar]
- 81.Tanaka K, Hirayama K, Yonezawa H, Hatakeyama S, Harada Y, Sano T. Molecular taxonomy of bamusicolous fungi: Tetraplosphaeriaceae, a new pleosporalean family with Tetraploa-like anamorphs. Stud. Mycol. 2009;64:175–209. doi: 10.3114/sim.2009.64.10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Liu YJ, Whelen S, Hall BD. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 1999;16:1799–1808. doi: 10.1093/oxfordjournals.molbev.a026092. [DOI] [PubMed] [Google Scholar]
- 83.Carbone I, Kohn LM. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia. 1999;91:553–556. doi: 10.1080/00275514.1999.12061051. [DOI] [Google Scholar]
- 84.Gräfenhan T, Schroers HJ, Nirenberg HI, Seifert KA. An overview of the taxonomy, phylogeny, and typification of nectriaceous fungi in Cosmospora, Acremonium, Fusarium, Stilbella, and Volutella. Stud. Mycol. 2011;68:79–113. doi: 10.3114/sim.2011.68.04. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Templeton MD, Rikkerink EHA, Solon SL, Crowhurst RN. Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata. Gene. 1992;122:225–230. doi: 10.1016/0378-1119(92)90055-T. [DOI] [PubMed] [Google Scholar]
- 86.Vieira WAS, Michereff SJ, Morais MA, Hyde KD, Camara MPS. Endophytic species of Colletotrichum associated with mango in northeastern Brazil. Fungal. Divers. 2014;67:181–202. doi: 10.1007/s13225-014-0293-6. [DOI] [Google Scholar]
- 87.Thompson JD, Gibson TJ, Plewniak F. The CLUSTAL_X windows interface: Flexible strategies for multiple seRuence alignment aided by quality analysis tools. Nucleic. Acids. Res. 1997;25:4876–4882. doi: 10.1093/nar/25.24.4876. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011;28:2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Swofford, D. L. PAUP*: Phylogenetic Analysis Using Parsimony (*and other methods), v. 4.0b10. (Sinauer Associates, 2002).
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All DNA sequences generated in this study have been registered to GenBank(https://www.ncbi.nlm.nih.gov). Supplementary material contains GenBank accessions of the sequences generated at STable1, and other raw data. The holotype of new species and new record species were deposited in China General Microbiological Culture Collection Center (CGMCC), with accession numbers CGMCC3.20145 and CGMCC3.20167.









