Skip to main content
Parasites & Vectors logoLink to Parasites & Vectors
. 2022 Dec 16;15:471. doi: 10.1186/s13071-022-05595-y

An overview of the trypanosomatid (Kinetoplastida: Trypanosomatidae) parasites infecting several mammal species in Colombia

Adriana C Castillo-Castañeda 1, Luz H Patiño 1, Maria Fernanda Zuñiga 1, Omar Cantillo-Barraza 1,2, Martha S Ayala 3, Maryi Segura 3, Jessica Bautista 3, Plutarco Urbano 4, Jeiczon Jaimes-Dueñez 5, Juan David Ramírez 1,6,
PMCID: PMC9756507  PMID: 36522757

Abstract

Background

Trypanosomatids are among the most critical parasites for public health due to their impact on human, animal, and plant health. Diseases associated with these pathogens manifest mainly in poor and vulnerable populations, where social, environmental, and biological factors modulate the case incidence and geographical distribution.

Methods

We used Sanger and amplicon-based next-generation sequencing (NGS) in samples from different mammals to identify trypanosomatid infections in several departments in Colombia. A total of 174 DNA samples (18 humans, 83 dogs, and 73 wild mammals) were analyzed by conventional PCR using a fragment of the heat shock protein 70 (Hsp70) gene and Sanger sequenced the positive samples. Twenty-seven samples were sent for amplicon-based NGS using the same gene fragment. Data obtained were used to perform diversity analyses.

Results

One hundred and thirteen samples were positive for PCR by Hsp70 fragment; these corresponded to 22.1% Leishmania spp., 18.6% L. amazonensis, 9.7% L. braziliensis, 14.2% L. infantum, 8% L. panamensis, and 27.4% Trypanosoma cruzi. Comparison of the identified species by the two sequencing technologies used resulted in 97% concordance. Alpha and beta diversity indices were significant, mainly for dogs; there was an interesting index of coinfection events in the analyzed samples: different Leishmania species and the simultaneous presence of T. cruzi and even T. rangeli in one of the samples analyzed. Moreover, a low presence of L. braziliensis was observed in samples from wild mammals. Interestingly, to our knowledge, this is the first report of Leishmania detection in Hydrochaeris hydrochaeris (capybara) in Colombia.

Conclusions

The Hsp70 fragment used in this study is an optimal molecular marker for trypanosomatid identification in many hosts and allows the identification of different species in the same sample when amplicon-based sequencing is used. However, the use of this fragment for molecular diagnosis through conventional PCR should be carefully interpreted because of this same capacity to identify several parasites. This point is of pivotal importance in highly endemic countries across South America because of the co-circulation of different genera from the Trypanosomatidae family. The findings show an interesting starting point for One Health approaches in which coevolution and vector-host interactions can be studied.

Graphical Abstract

graphic file with name 13071_2022_5595_Figa_HTML.jpg

Supplementary Information

The online version contains supplementary material available at 10.1186/s13071-022-05595-y.

Keywords: Amplicon-based NGS, Sanger, Mammals, Trypanosomatids, Coinfection, Diversity

Background

Kinetoplastid parasites have been a primary worldwide concern for centuries, where Leishmania and Trypanosoma stand out as the most critical genera [1]. These have tremendous importance for public health because of their impact on human and animal diseases, reflected in economic losses associated with morbidity, mortality, cost overrun in health systems, and investment in prevention programs, among others [2]. Furthermore, for plants, Phytomonas spp. is associated with damage to coffee, oil palm, and coconut plantations, with economic effects due to crop failures, pesticides use, loss of cultivable fields, and biodiversity, leading to ecological imbalance [35].

Human and animal diseases associated with these pathogens have great significance for the World Health Organization (WHO), considering that they are included in the 2030 agenda for the elimination of neglected tropical diseases (NTDs) [6]. For both leishmaniasis and trypanosomiasis, poverty, vulnerability [7], environmental [8], social [913], and biological factors [1] modulate the geographic distribution of the pathogens, their vectors, and consequently the incidence of human cases. In mammals, trypanosomatids are transmitted mainly by vectors; however, oral infections represent a vital infection route in the wild transmission cycle. For Leishmania spp., transmission is by the bite of infected female phlebotomine sand flies [14], having three clinical manifestations in humans: cutaneous, mucocutaneous, and visceral leishmaniasis (VL) [15]. In the case of Trypanosoma spp., the vectorial transmission is mediated by triatomines for T. cruzi and T. rangeli and tsetse flies for T. brucei, causing asymptomatic infections or acute disease that can evolve to a chronic phase in humans [1]. The severity of these parasitic diseases has been related to the infecting species, infection route, patient's immunological response, comorbidities, and treatment opportunities [16, 17].

Sanger sequencing has helped the study of Leishmania spp., Trypanosoma spp., their vectors, and their feeding preferences [1824]. Indeed, Asia and the Mediterranean basin have reported the presence of Trypanosoma spp. DNA in phlebotomines [2527]. Also, Sanger technology has helped determine the causal agents of leishmaniasis and trypanosomiasis in urban and periurban transmission cycles [24, 2832]. Likewise, the DNA of trypanosomatids has also been identified in several mammals of the sylvatic cycle, such as rodents [3335], didelphids [36, 37], marsupials [38], bats [3943], and primates [44, 45]. Such analyses in vectors and reservoirs are highly relevant for public health, considering they allow determining the incidence of parasitic species in the transmission hotspots and their geographical distribution as well as the study of the genetic diversity of Leishmania spp. [4649] and Trypanosoma spp. [5052] worldwide.

Easy access to next-generation sequencing (NGS) technologies and methodologies, such as amplicon-based NGS, has allowed generating and analyzing large and complete amounts of data on the parasites [5357]. For leishmaniasis expressly, this methodology has provided numerous highlights, for instance, the identification of Leishmania species in new geographic regions [58], infection indices and feeding preferences in vectors [25, 59], and identification of the most influential reservoirs in the transmission cycles [30, 40, 60, 61]. Regarding trypanosomiasis, NGS has facilitated the study of T. cruzi and T. rangeli genetic diversity [56], lineage associations in asymptomatic, acute, and chronic cases of Chagas disease [62], and identification of multiple feeding preferences in triatomines [53], among others, and detected coinfection events by different parasitic species in a single host [58, 63].

Although leishmaniasis and Chagas disease are important because of their incidence and wide geographical distribution [18, 64], there are few investigations related to the study of these agents in mammals, especially in different transmission cycles in Colombian departments, with an active circulation of the parasites. Therefore, using NGS (amplicon-based) and Sanger, we aimed to study and improve the understanding of the transmission cycles of trypanosomatids in samples obtained from different wild and domestic mammals in many departments in Colombia. This study has the additional purpose of encouraging the use of this type of research on different players in the life cycle of parasites in endemic countries, hence generating updated data useful for government stakeholders for the promotion and prevention of these diseases using a One Health context.

Methods

Samples

A total of 174 samples were included by convenience in this study: 18 from humans with VL diagnosis from the departments of Bolívar, Córdoba, Huila, La Guajira, Norte de Santander, Santander, Sucre, and Tolima; 83 of domestic dogs (Canis lupus familiaris) from Antioquia, Santander, La Guajira, Cesar, Córdoba, Huila, Norte de Santander, Santander, Sucre, and Tolima; 73 of wild mammals (Callicebus cupreus, Carollia brevicauda, Carollia perspicillata, Chinchilla lanigera, Choloepus didactylus, Coendou bicolor, Desmodus rotundus, Didelphis marsupialis, Glossophaga soricina, Hydrochaeris hydrochaeris, Myotis brandtii, Myotis martiniquensis, Odocoileus virginianus, Pecari tajacu, Phyllostomus elongatus, Phyllostomus hastatus, Proechimys roberti, and Tapirus terrestris) from Antioquia and Casanare (Fig. 1; Additional file 1: Table S1). Most departments are endemic for leishmaniasis and Chagas disease. The geographic distribution by department in Colombia is shown in the supplementary information (Additional file 2: Fig. S1).

Fig. 1.

Fig. 1

Geographical and biological distribution of the different samples analyzed in this study. Plot size is proportional to the total number of samples per department, and each mammal species is represented by a single color

Human samples were obtained from two sources: serum via venipuncture and bone marrow aspirate smear slides. From canines, these were obtained by anticoagulated total blood with EDTA (venipuncture) or serum in a dry tube. The samples were anticoagulated whole blood with EDTA or collected in FTA cards for wild mammals. All animals were captured with the minimum damage possible. The wild mammals were anesthetized with 20 mg/kg body weight ketamine (Ketalar, Parke Davis, Morris Plains, NJ, USA), and blood was obtained via venipuncture. For bats, only 300 µl whole blood was collected. All the plasma and serum samples were conserved at –80 °C until their processing; FTA cards and slides were stored at environmental temperature and humidity for optimal storage conditions.

DNA extraction

All the biological samples collected were processed using the High Pure PCR Template Preparation Kit (Roche Life Science, Mannheim, Germany) following the protocol described by the manufacturer. The slide samples were submerged in xylol to clean the immersion oil traces; next, 200 µl lysis buffer was added for 10 min, and the smear was carefully removed and put into a microtube to start the DNA extraction. DNA concentration was determined using NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA), and the DNA quality and integrity were checked through gel electrophoresis in agarose 1%. Samples were conserved at -80 °C until processing.

Molecular test and Trypanosoma species identification by Sanger sequencing

As previously reported, a 337-bp region of the Hsp70 gene for both Trypanosoma and Leishmania was amplified by conventional PCR [65, 66]. Amplicon products were analyzed by gel electrophoresis in 2% agarose. Those products with gel band presence (positive for Hsp70) were purified with EXOSAP (Affymetrix, Santa Clara, CA, USA) and sent for sequencing by the dideoxy-terminal method in an automated capillary sequencer (AB3730; Applied Biosystem, Foster City, CA, USA). The sequences were submitted to BLASTn using the NCBI platform [65]. Subsequently, the DNA of all the samples identified with some species of Leishmania that met the quality requirements for Novogene were sent for amplicon-based sequencing by Illumina. Additionally, 60% of the samples were BLAST-identified as T. cruzi, and ten samples from canines with visceral leishmaniasis diagnosis were also sent for sequencing. In the first scenario to assess the co-infection, when Sanger sequencing identified T. cruzi as the main infecting parasite, the second validated the possibility that amplicon-based NGS had more power to detect target reads.

Amplicon-based next-generation sequencing

Genomic DNA (> 200 ng/μl) from humans, canines, and wild mammals was sent to amplicon-based sequencing by Illumina (Novogene, Beijing, China). The primers used were the same for the conventional PCR, forward (5'AGGTGAAGGCGACGAACG) and reverse (5'CGCTTGTCCATCTTTGCGTC), following the protocol, as reported before [58].

Bioinformatics analysis

The FASTA files from the Hsp70 raw sequences were filtered using QIIME software [67], considering the parameters described before [53]. Then, barcode trimming and forward and reverse sequence merging were made. Then, another quality filter was made for the merged files. The reads that passed the quality filters were compared against an in-house database, which contains sequences for the Hsp70 337-bp fragment of kinetoplastids available in GenBank [58]. The database includes species of Leishmania, Trypanosoma, and Leptomonas. The local BLASTn was made with a threshold of 95% identity and an e-value of 10. Of those species that matched, only the ones with abundance of the total reads per sample of > 3% significance were considered. Quantitative results were plotted using R software version 3.6.2 and the Sankey diagram package available at www.online.visu-alparadigm.com.

Statistical analysis

The qualitative variables were clustered by frequency and proportions according to the parasite species and coinfection patterns depending on the data obtained from amplicon-based sequencing. Considering the normality of the data, a Chi-square test (χ²) was made to analyze the relation between mammal-parasite and origin (department)-parasites. The statistical analysis was executed in R software (RStudio Team 2019). Two-sided significance tests and P-value < 0.05 were established. Moreover, to analyze the correspondence among the parasites reported by hsp70 sequencing by Sanger and the amplicon-based sequencing, a kappa (κ) coefficient was calculated using STATA11 with 0.05 significance.

Results

Trypanosomatid identification by Sanger sequencing

Overall, 64.9% of the total samples used in the study (113/174) had amplification for Hsp70 by conventional PCR (Additional file 1: Table S1), of which 12.2% (14/18) were from humans, 40.4% (46/83) from canines, and 47.4% (54/73) from wild mammals. Results obtained from BLASTn (Fig. 2; Additional file 3: Table S2) show that Colombia has a wide variety of Leishmania species, mainly in the departments with co-circulation of T. cruzi. For mammal species, L. infantum (71.4%) and L. amazonensis (21.4%) were the most frequent species in human samples with VL diagnosis; for canines, they were L. amazonensis (26.1%), L. braziliensis (17.4%), and Leishmania spp. (21.8%). For wild mammals, they were T. cruzi (47.2%) and Leishmania spp. (26.4%), L. amazonensis (11.3%), and L. braziliensis (5.7%) (Fig. 2). Furthermore, considering the origin of the samples, a high diversity of parasitic species was found for each animal, T. cruzi and Leishmania spp. being the most prevalent, with 27.4% and 22.1%, respectively (Fig. 2). The former was more frequent in Casanare, where the samples were collected mostly from bats.

Fig. 2.

Fig. 2

Results of the biological and geographical distribution of trypanosomatid species identified by Sanger sequencing. A Parasite species found for each animal analyzed per department (B). Plot size is proportional to the total number of samples analyzed per department. For each plot from panel (B), the size of the inner joining line among mammals (lower half) and parasite species (upper half) is proportional to sample number. Each parasite species is represented by a single color

Hsp70 sequencing by amplicon-based NGS analysis

Only 118 samples met the requirement of the DNA concentration (≥ 200 ng/μl) for Illumina, of which 22.9% (27/118) were optimal for analysis. Subsequent sequencing of the 337-bp Hsp70 fragment by Illumina generated between 134,316 and 179,347 paired-end reads. The bioinformatic analysis revealed that for 96.2% of the samples (26/27), > 85% of the reads had a minimum coverage > q20 (initial quality filter). The exception was a canine from Sucre (R95), in which only 41% of the reads successfully passed the initial quality control. Furthermore, the taxonomic assignment made with local BLASTn was performed with high-quality reads per sample using > 38% of the reads generated at the beginning for almost all cases. Unexpectedly, the taxonomic assignation for animal samples C334, C335, PUC07, and SAC382 (Fig. 3) resulted in individual matches for 35, 108, 608, and 234 reads with the species included in the database used.

Fig. 3.

Fig. 3

Leishmania and Trypanosoma species correspondence reported by Sanger sequencing and reads obtained by amplicon-based NGS from human samples (A), dogs (B), and wild mammals (C). The size of the inner joining line among samples and parasites is proportional to the reads percentage found in the analyzed sample. Each parasite species is represented by a single color

Concordance between Sanger and amplicon-based NGS results

It is known that the two sequencing methods used in this study have different methodological principles, scope, and output. However, we compared whether the species (unique) obtained with Sanger were included or not in the unique or multiple species obtained with amplicon-based NGS. We showed a general concordance between the two sequencing techniques of 97% and a kappa coefficient of 0.8–1.0 by comparing the identified species.

In amplicon-based NGS analysis, coinfection events in VL patients' samples and canines were frequent

The coinfection events were more frequent in human and canine samples compared to samples from wild mammals. Coinfection was identified from the human samples (5/7); infection frequency by L. infantum was 85.8%, L. amazonensis 42.6%, L. braziliensis, L. panamensis, and L. naiffi 28.6%, with 14.3% for L. lindenbergi along with T. cruzi. Double infection events were detected: T. cruzi/L. infantum (1 sample) and L. amazonensis/L. infantum (2 samples) and multiple infection by L. infantum/L. braziliensis/L. panamensis/L. naiffi and L. amazonensis/L. braziliensis/L. panamensis/L.naiffi/L. lindenbergi in the same patient (Fig. 3A); a single infection by L. infantum in humans was present in 28.6% (2/7) of the samples, in concordance with Sanger reports. Canine samples presented a wide diversity of Leishmania species, with a single infection in around 50%, T. cruzi infection in three samples, L. infantum and L. mexicana in one sample each, and triple infection by T. cruzi/T. rangeli/L. infantum in a canine from Santander; the samples from Sucre showed multiple infections: L. braziliensis/L. panamensis/L. naiffi and two canines by T. cruzi/L. amazonensis/L. braziliensis and T. cruzi/L. infantum/L. braziliensis, respectively (Fig. 3B).

Trypanosoma cruzi prevails in wild mammals

One hundred percent of wild mammals had reads for T. cruzi in the amplicon-based NGS. Double infection by T. cruzi with L. panamensis or L. braziliensis was present in three samples and triple infection by T. cruzi along with L. braziliensis/L. panamensis in one sample. Single infection by T. cruzi was present in 44.4% of the samples (Fig. 3C).

Statistical analysis

The statistical analysis did not reveal statistically significant differences between the coinfection and single-infection groups analyzed (Mann-Whitney-Wilcoxon test, P = 0.07, 0.87, and 0.566) or among species (Kruskal-Wallis test, P = 0.31, 0.195 and 0.567).

Chi-squared tests and Fisher exact tests were performed to evaluate a potential association between the categorical variables and for the relation between department and species (P = 0.038) and chi-squared test (P = 0.022) for parasite species vs. mammal.

Diversity analysis

Analyzing the alpha diversity of the samples by amplicon-based NGS, statistically significant differences among the three groups were analyzed (Shannon index: P < 0.0001; Simpson index P = 0.0001). Humans and dogs presented the most diversity (Shannon index 1.14, 1.17 for humans and 1.04 for canines) and dominance (Simpson index 0.64 and 0.62, respectively) compared with the wild mammals where the obtained values were close to zero (Additional file 4: Table S3). This comparison revealed statistically significant differences in alpha diversity between humans and wild mammals and dogs and wild mammals.

Discussion

The diversity of Leishmania species found using Hsp70 amplicons by Sanger sequencing agree with those expected for patients with VL diagnosis (Additional file 3: Table S2), which historically have been L. infantum for the Americas [6870]. We also found L. amazonensis in patient samples from La Guajira, Santander, and Bolívar (Fig. 2), an atypical event that has been previously reported in humans [71] and dogs [72, 73]. For humans, L. major and L. tropica have been the principal non-L. donovani complex species reported in the Old World, while in the Americas they have been L. braziliensis, L. mexicana, and L. amazonensis. In both geographical contexts, HIV is the main factor described for coinfection events in immunocompromised patients [74]. In La Guajira, the samples collected came from a new hotspot of VL in Hatonuevo municipality, in which L. amazonensis was detected in both humans and canines (Additional file 3: Table S2). This allowed us to consider the potential existence of a new VL hotspot solely associated with L. amazonensis, even though further investigations must include more comprehensive sampling, vectors, and parasite isolation to prove L. amazonensis's capacity for visceral tropism.

We also found a high diversity of Leishmania species in dogs and wild mammals, besides the presence of T. cruzi in animals from the different departments of Colombia (Fig. 2). The latter has high prevalence in regions highly endemic for Chagas disease [75, 76] such as Casanare. These findings showed that, regarding the NTD elimination programs focused on vector control and diagnosis/treatment in humans, the pathogen transmission remains enzootic [77]. The above is alarming considering the increasing sylvatic niche fragmentation, which also increases the risk of outbreaks, sylvatic parasite species circulation in urban transmission cycles, and the adaptation of the pathogens according to the availability of vectors and hosts [78, 79]. This problem has been acknowledged and studied in endemic regions in the Brazilian Amazon, keeping in mind their local context and associated variables to strengthen One Health intervention programs [80].

Furthermore, the presence of different Leishmania species is related to Colombia's high biodiversity [81], where the vectors' diversity and ecological niches [44, 82] allow the maintenance of L. panamensis, L. amazonensis, and L. braziliensis in sylvatic, urban, and periurban transmission cycles. Additionally, differently than expected for L. braziliensis and L. panamensis (the most prevalent species of cutaneous leishmaniasis in active military populations) [58, 83], we found a low number of wild mammals infected with these species in Antioquia. On the other hand, L. amazonensis predominates, and L. infantum was identified in Pecari tajacu (collared peccary) and Choloepus didactylus (Linnaeus's two-toed sloth). In all Hydrochaeris hydrochaeris (Capybara) samples, L. amazonensis, L. panamensis, and Leishmania spp. were identified, as previously reported in other countries [84, 85]. This represents the first report in Colombia highlighting the need to conduct studies on this species, which represents an exotic source of consumable meat in the region.

For Casanare, T. cruzi was the main trypanosomatid detected. Leishmania was identified in four animals (3 L. braziliensis and 1 L. amazonensis) (Fig. 2A). These findings suggest that the vector species distribution could determine the patterns according to specific environmental conditions, their feeding preferences, and the availability of specific reservoirs [8689]. Therefore, by analyzing the data for Antioquia (Fig. 2; Additional file 3: Table S2), the possibility can be suggested that the lack of identification of L. braziliensis was determined by the mammal species sampled in this study, while for Casanare, the hypothesis could explain how, despite finding bats infected with L. braziliensis and L. amazonensis (Figs. 2, 3C) and the presence of the circulation of Lutzomyia gomezi in the department [90], no autochthonous cases of leishmaniasis have been reported according to official data from the Colombian Disease Surveillance System (SIVIGILA). It can be assumed that the phlebotomines play an essential role in disease modeling in humans and the maintenance of the parasite’s enzootic cycle, as has been demonstrated in endemic regions for cutaneous and visceral leishmaniasis in Brazil, Spain, and Iran [9193]. However, a broader sampling and inclusion of more mammals, as well as the parallel study of phlebotomine circulation, distribution, and feeding preferences, are needed.

Additionally, two human and canine samples from Sucre presented the highest diversity index (Additional file 4: Table S3), where we identified coinfection events with L. naiffi and L. lindenbergi (Fig. 3A, B), as recently reported [58, 63]. The high species richness of Leishmania in a single individual could be associated with the proximity of dwellings to forests, with a circulation of different vector species such as Lu. longipalpis, Lu. evansi, and Lu. gomezi [90, 94], human and canine mobilization to the forests to search for natural resources, and military and illegal groups in this country zone [9, 63, 65, 83]. All these factors make the vector-human-reservoir-pathogen interaction more accessible, maintaining the zoonotic and enzootic transmission cycles of Leishmania spp. Some authors have concluded, for instance, that the circulating phlebotomine sand fly species are critical for the vectorial transmission of Leishmania spp. [95]; likewise, the mammals' role in parasite transmission concerns the vector, their meal preferences, and feeding behavior [96, 97].

Considering the identified parasite species versus those expected in wild mammals and coinfection events, a new scenario is opening showing the need for research on the following topics: (i) the role of domestic/wild mammals and vectors in the maintenance of transmission cycles, which has been studied and proposed in mathematical models for different vector-borne diseases [98100]; (ii) the domiciliation transition of vectors in specific areas, phenomena highly relevant for American trypanosomiasis and VL in recent years [101103]; (iii) the possibility of the genetic recombination of the different actors implicated in the parasites’ life cycle, not just for the vector context [104106]. The latter must transcend the world view of human diseases and recognize their importance and the veterinary diseases that must be equally prioritized in the public health systems [107]. Therefore, considering our results, we highlight the relevance and usefulness of transmission scenarios in Casanare, Antioquia, and Sucre to understand these phenomena's ecological dynamics better.

On the other hand, we found coinfection by L. infantum, T. rangeli, and T. cruzi in a canine in Santander (Fig. 3B), a department with a high incidence of Chagas disease. It is known that T. cruzi and T. rangeli share mammal hosts, and their geographical distribution overlaps with the finding of infected mammals and triatomines [108, 109]. This triple coinfection was previously reported in Tamandua tetradactyla, a wild mammal [110]. In humans, even though T. cruzi-T. rangeli coinfection affects Chagas disease diagnosis, the cases are underestimated as T. rangeli has been detected in primates, bats, rodents, marsupials, and dogs in Brazil, Colombia, and Venezuela [110, 113118].

It is relevant to discuss the benefits and limitations of amplicon-based sequencing and the specificity of the Hsp70 gene fragment used. In the first place, NGS technologies and the inclusion of new methodologies, such as amplicon-based ones, offer benefits in cost reduction and obtain quick and sensitive high-throughput data [117, 118], allowing the use of different target genes simultaneously [119, 120]. The time between sample processing and data collection is less than for conventional PCR and Sanger sequencing [121]. One of the critical points in sequencing success is the pre-analytics phase; therefore, the samples used in this study (serum, total blood, and bone marrow aspirate smear) determined the DNA integrity and concentration, which directly influence the success of NGS sequencing [122, 123]. Moreover, the biological influence of parasitic load in mammals and the copy number of the Hsp70 gene should be considered. This explains the sample percentage that could be evaluated by amplicon-based sequencing (Fig. 3; Additional file 3: Table S2). Second, the Hsp70 gene allows the identification of Leishmania and Trypanosoma [124], which is an advantage for studying samples from endemic regions for both parasites.

Nevertheless, the Hsp70 gene sensitivity is not optimal for use as a diagnostic marker. One of our limitations was not being able to include more sensitive markers, such as satellite DNA for T. cruzi [125] or 18S for Leishmania [126], to determine whether those 60 samples were indeed negative. However, we want to emphasize that the main objective was to depict the infective species, so we chose the Hsp70 marker. Finally, considering the rising availability of data from outstanding databases such as NCBI, searching for a more sensitive genetic marker to discriminate among these trypanosomatid species through Illumina sequencing or even Oxford Nanopore should be prioritized.

Conclusions

The present study describes the infection by trypanosomatids in samples from humans, dogs, and wild mammals, using Sanger and amplicon-based sequencing of a coding fragment of the Hsp70 gene. We confirmed the vast diversity of Leishmania species found in the different samples obtained in many departments of Colombia, the presence of T. cruzi in bats and dogs, and the occurrence of coinfections.

Supplementary Information

13071_2022_5595_MOESM1_ESM.pdf (121.4KB, pdf)

Additional file 1: Fig. S1. Map showing the different departments and the capital district of Colombia.

13071_2022_5595_MOESM2_ESM.pdf (224.3KB, pdf)

Additional file 2: Table S1. Information on collected samples per department, sample code, and mammal species.

13071_2022_5595_MOESM3_ESM.pdf (248.3KB, pdf)

Additional file 3: Table S2. BLASTn results for the 337bp Hsp70 gene fragment of the samples analyzed herein.

13071_2022_5595_MOESM4_ESM.pdf (523.7KB, pdf)

Additional file 4: Table S3. Shannon and Simpson index values from the different species found in the analyzed samples by amplicon-based NGS.

Acknowledgements

We thank Dirección de Investigación e Innovación from Universidad del Rosario for providing the publication fees fo this manuscript. We also thank Natalia Velasquez-Ortiz for editing the English of the manuscript.

Abbreviations

ANLA

Autoridad Nacional de Licencias Ambientales (National Authority for Environmental Licenses)

INS

Instituto Nacional de Salud (National Health Institute)

NGS

Next-generation sequencing

NTD

Neglected tropical diseases

VBD

Vector-borne diseases

VL

Visceral leishmaniasis

WHO

World Health Organization

Author contributions

ACC and JDR: designed the study, conducted the analysis, and drafted the manuscript. ACC: extracted the DNA, performed the PCR, sequencing and analyzed the data. LHP: analyzed the data. OC: Provided samples and analyzed the data. MSA: Provided samples and analyzed the data. JB, JJ, MS, PU: Provided samples. All authors read and approved the final manuscript.

Funding

Open Access funding provided by Colombia Consortium. This work was funded by Dirección de Investigación e Innovación and the Research Fund for Undergraduate Students from the Faculty of Natural Sciences, Universidad del Rosario.

Availability of data and materials

All data generated or analyzed during this study are included in this published article and its supplementary information files. Sanger sequence data to GenBank code BankIt2630585: OP611209OP611320. Amplicon-based NGS data to ENA, project accession: PRJEB56730 and submission accession: ERA18523751.

Declarations

Ethics approval and consent to participate

The samples of patients and some domestic dogs analyzed in this study belong to the cryobank of the Parasitology Group, Instituto Nacional de Salud-INS (National Reference Laboratory in Colombia), and were authorized for use according to National Law 9–1979, decrees 786–1990 and 2323–2006. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. ANLA (Autoridad Nacional de Licencias Ambientales) permit no. 01749 and ethical approval from the Animal Ethics Committee from the Universidad de Antioquia, act No. 113 of 2017.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Adriana C. Castillo-Castañeda, Email: adrianac.castillo@urosario.edu.co

Luz H. Patiño, Email: luzh.patino@urosario.edu.co

Maria Fernanda Zuñiga, Email: mariaf.zuniga@urosario.edu.co.

Omar Cantillo-Barraza, Email: omarcantillo@gmail.com.

Martha S. Ayala, Email: mayalas@ins.gov.co

Maryi Segura, Email: msegura@ins.gov.co.

Jessica Bautista, Email: jbautista@ins.gov.co.

Plutarco Urbano, Email: plurbanus@gmail.com.

Jeiczon Jaimes-Dueñez, Email: jeiczon.jaimes@campusucc.edu.co.

Juan David Ramírez, Email: juand.ramirez@urosario.edu.co.

References

  • 1.Rodrigues JCF, Godinho JLP, de Souza W. Biology of human pathogenic trypanosomatids: epidemiology, lifecycle and ultrastructure. In: Santos ALS, Branquinha MH, d’Avila-Levy CM, Kneipp LF, Sodré CL, editors. Proteins proteomics and proteomics in leishmania and trypanosoma. Dordrecht: Springer Netherlands; 2014. [Google Scholar]
  • 2.WHO. WHO Factsheet Vector-borne diseases. 2014. https://www.who.int/campaigns/world-health-day/2014/fact-sheets/en/
  • 3.Bartolomé C, Buendía M, Benito M, De la Rúa P, Ornosa C, Martín-Hernández R, et al. A new multiplex PCR protocol to detect mixed trypanosomatid infections in species of Apis and Bombus. J Invertebr Pathol. 2018;154:37–41. doi: 10.1016/j.jip.2018.03.015. [DOI] [PubMed] [Google Scholar]
  • 4.Ganyukova AI, Frolov AO, Malysheva MN, Spodareva VV, Yurchenko V, Kostygov AY. A novel endosymbiont-containing trypanosomatid Phytomonas borealis sp n from the predatory bug Picromerus bidens (Heteroptera: Pentatomidae) Folia Parasitol. 2019 doi: 10.14411/fp.2020.004. [DOI] [PubMed] [Google Scholar]
  • 5.Onchuru TO, Martinez AJ, Kaltenpoth M. The cotton stainer’s gut microbiota suppresses infection of a cotransmitted trypanosomatid parasite. Mol Ecol. 2018;27:3408–3419. doi: 10.1111/mec.14788. [DOI] [PubMed] [Google Scholar]
  • 6.World Health Organization. Ending the neglect to attain the Sustainable Development Goals: a road map for neglected tropical diseases 2021–2030. Overview. Washintong; 2021 p. 7. https://www.who.int/publications/i/item/9789240010352.
  • 7.Abras A, Ballart C, Fernández-Arévalo A, Pinazo M-J, Gascón J, Muñoz C, et al. Worldwide control and management of Chagas disease in a new era of globalization: a close look at congenital Trypanosoma cruzi infection. Clin Microbiol Rev. 2022;35:e00152–e221. doi: 10.1128/cmr.00152-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.da Silva NAB, de Oliveira EF, Encina CCC, de Figueiredo HR, Paranhos FAC, de Oliveira AG. Effects of El Niño-Southern oscillation on human visceral leishmaniasis in the Brazilian State of Mato Grosso do Sul. Mem Inst Oswaldo Cruz. 2020;115:e190298. doi: 10.1590/0074-02760190298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Berry I, Berrang-Ford L. Leishmaniasis, conflict, and political terror: a spatio-temporal analysis. Soc Sci Med. 2016;167:140–149. doi: 10.1016/j.socscimed.2016.04.038. [DOI] [PubMed] [Google Scholar]
  • 10.Grillet ME, Hernández-Villena JV, Llewellyn MS, Paniz-Mondolfi AE, Tami A, Vincenti-Gonzalez MF, et al. Venezuela’s humanitarian crisis, resurgence of vector-borne diseases, and implications for spillover in the region. Lancet Infect Dis. 2019;19:e149–e161. doi: 10.1016/S1473-3099(18)30757-6. [DOI] [PubMed] [Google Scholar]
  • 11.Rodríguez-Morales AJ, Suárez JA, Risquez A, Villamil-Gómez WE, Paniz-Mondolfi A. Consequences of Venezuela’s massive migration crisis on imported malaria in Colombia, 2016–2018. Travel Med Infect Dis. 2019;28:98–99. doi: 10.1016/j.tmaid.2019.02.004. [DOI] [PubMed] [Google Scholar]
  • 12.Suarez J, Carreño L, Paniz-Mondolfi A, Marco-Canosa F, Freilij H, Riera J, et al. Infectious diseases, social, economic and political crises, anthropogenic disasters and beyond: Venezuela 2019—implications for public health and travel medicine. 2018;1:73–93.
  • 13.Valero NNH, Uriarte M. Environmental and socioeconomic risk factors associated with visceral and cutaneous leishmaniasis: a systematic review. Parasitol Res. 2020;119:365–384. doi: 10.1007/s00436-019-06575-5. [DOI] [PubMed] [Google Scholar]
  • 14.Afrin F, Khan I, Hemeg HA. Leishmania-Host Interactions—an Epigenetic Paradigm. Front Immunol. 2019;10:492. doi: 10.3389/fimmu.2019.00492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Alemayehu B, Alemayehu M. Leishmaniasis: A review on parasite, vector and reservoir host. Health Sci J. 2017. http://www.hsj.gr/medicine/leishmaniasis-a-review-on-parasite-vector-and-reservoir-host.php?aid=20131. Accessed on 21 Oct 2019.
  • 16.de Castro Neto AL, da Silveira JF, Mortara RA. Comparative analysis of virulence mechanisms of trypanosomatids pathogenic to humans. Front Cell Infect Microbiol. 2021;11:669079. doi: 10.3389/fcimb.2021.669079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Elmahallawy EK, Alkhaldi AAM, Saleh AA. Host immune response against leishmaniasis and parasite persistence strategies: a review and assessment of recent research. Biomed Pharmacother. 2021;139:111671. doi: 10.1016/j.biopha.2021.111671. [DOI] [PubMed] [Google Scholar]
  • 18.Ferro C, López M, Fuya P, Lugo L, Cordovez JM, González C. Spatial Distribution of Sand Fly Vectors and Eco-Epidemiology of Cutaneous Leishmaniasis Transmission in Colombia. PLOS ONE. 2015;10:e0139391. doi: 10.1371/journal.pone.0139391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.González C, Cabrera OL, Munstermann LE, Ferro C. Distribución de los vectores de Leishmania infantum (Kinetoplastida: Trypanosomatidae) en Colombia. Biomedica. 2012;26:64. doi: 10.7705/biomedica.v26i1.1501. [DOI] [PubMed] [Google Scholar]
  • 20.Paternina-Gómez M, Díaz-Olmos Y, Paternina LE, Bejarano EE. Alta prevalencia de infección por Leishmania (Kinetoplastidae: Trypanosomatidae) en caninos del norte de Colombia. Biomédica. 2013. http://www.revistabiomedica.org/index.php/biomedica/article/view/780. Accessed on 26 Apr 2020. [DOI] [PubMed]
  • 21.Gürtler RE, Cecere MC, Lauricella MA, Cardinal MV, Kitron U, Cohen JE. Domestic dogs and cats as sources of Trypanosoma cruzi infection in rural northwestern Argentina. Parasitology. 2007;134:69–82. doi: 10.1017/S0031182006001259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kamdem CN, Tiofack AAZ, Mewamba EM, Ofon EA, Gomseu EBD, Simo G. Molecular identification of different trypanosome species in tsetse flies caught in the wildlife reserve of Santchou in the western region of Cameroon. Parasitol Res. 2020;119:805–813. doi: 10.1007/s00436-020-06606-6. [DOI] [PubMed] [Google Scholar]
  • 23.Ribeiro G, dos Santos CGS, Lanza F, Reis J, Vaccarezza F, Diniz C, et al. Wide distribution of Trypanosoma cruzi-infected triatomines in the State of Bahia. Brazil Parasit Vectors. 2019;12:604. doi: 10.1186/s13071-019-3849-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Rodriguez F, Luna BS, Calderon O, Manriquez-Roman C, Amezcua-Winter K, Cedillo J, et al. Surveillance of Trypanosoma cruzi infection in Triatomine vectors, feral dogs and cats, and wild animals in and around El Paso county Texas, and New Mexico. PLoS Negl Trop Dis. 2021;15:e0009147. doi: 10.1371/journal.pntd.0009147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Abbate JM, Maia C, Pereira A, Arfuso F, Gaglio G, Rizzo M, et al. Identification of trypanosomatids and blood feeding preferences of phlebotomine sand fly species common in Sicily Southern Italy. PLOS ONE. 2020;15:e0229536. doi: 10.1371/journal.pone.0229536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Buatong J, Dvorak V, Thepparat A, Thongkhao K, Koyadun S, Siriyasatien P, et al. Phlebotomine sand flies in Southern Thailand: entomological survey, identification of blood meals and molecular detection of Trypanosoma spp. Insects. 2022;13:197. doi: 10.3390/insects13020197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Srisuton P, Sunantaraporn B, Sor-suwan B, et al. Detection of Leishmania and Trypanosoma DNA in field-caught sand flies from endemic and non-endemic areas of leishmaniasis in Southern Thailand. Insects. 2019;10:238. doi: 10.3390/insects10080238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Castelli G, Bruno F, Reale S, Catanzaro S, Valenza V, Vitale F. Molecular Diagnosis of Leishmaniasis: Quantification of Parasite Load by a Real-Time PCR Assay with High Sensitivity. Pathogens. 2021;10:865. doi: 10.3390/pathogens10070865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Dantas-Torres F, Solano-Gallego L, Baneth G, Ribeiro VM, de Paiva-Cavalcanti M, Otranto D. Canine leishmaniosis in the old and new worlds: unveiled similarities and differences. Trends Parasitol. 2012;28:531–538. doi: 10.1016/j.pt.2012.08.007. [DOI] [PubMed] [Google Scholar]
  • 30.Dantas-Torres F, Miró G, Baneth G, Bourdeau P, Breitschwerdt E, Capelli G, et al. Canine Leishmaniasis control in the context of one health. Emerg Infect Dis. 2019;25:1–4. doi: 10.3201/eid2512.190164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Eloy LJ, Lucheis SB. Hemoculture and polymerase chain reaction using primers TCZ1/TCZ2 for the diagnosis of canine and feline trypanosomiasis. ISRN Vet Sci. 2012;2012:1–6. doi: 10.5402/2012/419378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Hassan-Kadle AA, Ibrahim AM, Nyingilili HS, Yusuf AA, Vieira RFC. Parasitological and molecular detection of Trypanosoma spp. in cattle, goats and sheep in Somalia. Parasitology. 2020;147:1786–1791. doi: 10.1017/S003118202000178X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Cássia-Pires R, Boité MC, D’Andrea PS, Herrera HM, Cupolillo E, Jansen AM, et al. Distinct Leishmania Species Infecting Wild Caviomorph Rodents (Rodentia: Hystricognathi) from Brazil. PLoS Negl Trop Dis. 2014;8:e3389. doi: 10.1371/journal.pntd.0003389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.de Ferreira EC, Cruz I, Cañavate C, de Melo LA, Pereira AAS, Madeira FAM, et al. Mixed infection of Leishmania infantum and Leishmania braziliensis in rodents from endemic urban area of the New World. BMC Vet Res. 2015;11:71. doi: 10.1186/s12917-015-0392-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kassahun A, Sadlova J, Dvorak V, Kostalova T, Rohousova I, Frynta D, et al. Detection of Leishmania donovani and L. tropica in Ethiopian wild rodents. Acta Trop. 2015;145:39–44. doi: 10.1016/j.actatropica.2015.02.006. [DOI] [PubMed] [Google Scholar]
  • 36.Nantes WAG, Santos FM, de Macedo GC, Barreto WTG, Gonçalves LR, Rodrigues MS, et al. Trypanosomatid species in Didelphis albiventris from urban forest fragments. Parasitol Res. 2021;120:223–231. doi: 10.1007/s00436-020-06921-y. [DOI] [PubMed] [Google Scholar]
  • 37.Velez ID, Travi BL, Jaramillo C, Montoya J, Segura I, Zea A, et al. Didelphis marsupialis, an Important Reservoir of Trypanosoma (Schizotrypanum) cruzi and Leishmania (Leishmania) chagasi in Colombia. Am J Trop Med Hyg. 1994;50:557–565. doi: 10.4269/ajtmh.1994.50.557. [DOI] [PubMed] [Google Scholar]
  • 38.Keatley S, Botero A, Fosu-Nyarko J, Pallant L, Northover A, Thompson RCA. Species-level identification of trypanosomes infecting Australian wildlife by high-resolution melting—real time quantitative polymerase chain reaction (HRM-qPCR) Int J Parasitol Parasites Wildl. 2020;13:261–268. doi: 10.1016/j.ijppaw.2020.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Kassahun A, Sadlova J, Benda P, Kostalova T, Warburg A, Hailu A, et al. Natural infection of bats with Leishmania in Ethiopia. Acta Trop. 2015;150:166–170. doi: 10.1016/j.actatropica.2015.07.024. [DOI] [PubMed] [Google Scholar]
  • 40.Medkour H, Davoust B, Dulieu F, Maurizi L, Lamour T, Marié J-L, et al. Potential animal reservoirs (dogs and bats) of human visceral leishmaniasis due to Leishmania infantum in French Guiana. PLoS Negl Trop Dis. 2019;13:e0007456. doi: 10.1371/journal.pntd.0007456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.de Oliveira FM, Costa LHC, de Barros TL, Rauschkolb KIPK, Colombo FA, de Carvalho C, et al. First detection of Leishmania spp DNA in Brazilian bats captured strictly in urban areas. Acta Trop. 2015;150:176–181. doi: 10.1016/j.actatropica.2015.07.010. [DOI] [PubMed] [Google Scholar]
  • 42.Ardila MM, Carrillo-Bonilla L, Pabón A, Robledo SM. Surveillance of phlebotomine fauna and Didelphis marsupialis (Didelphimorphia: Didelphidae) infection in an area highly endemic for visceral leishmaniasis in Colombia. Biomedica. 2019;39:252–264. doi: 10.7705/biomedica.v39i2.3905. [DOI] [PubMed] [Google Scholar]
  • 43.Godfrey SS, Keatley S, Botero A, Thompson CK, Wayne AF, Lymbery AJ, et al. Trypanosome co-infections increase in a declining marsupial population. Int J Parasitol Parasit Wildl. 2018;7:221–227. doi: 10.1016/j.ijppaw.2018.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.González C, León C, Paz A, López M, Molina G, Toro D, et al. Diversity patterns, Leishmania DNA detection, and bloodmeal identification of Phlebotominae sand flies in villages in northern Colombia. PLoS ONE. 2018;13:e0190686. doi: 10.1371/journal.pone.0190686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.López M, Erazo D, Hoyos J, León C, Fuya P, Lugo L, et al. Measuring spatial co-occurrences of species potentially involved in Leishmania transmission cycles through a predictive and fieldwork approach. Sci Rep. 2021;11:6789. doi: 10.1038/s41598-021-85763-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Carvalho FS, Albuquerque GR, Carneiro PLS, Wenceslau AA. Genetic variability of Leishmania infantum in naturally infected dogs in the state of Bahia. Brazil Rev Bras Parasitol Veterinária. 2017;26:389–394. doi: 10.1590/s1984-29612017037. [DOI] [PubMed] [Google Scholar]
  • 47.Gouzelou E, Haralambous C, Amro A, Mentis A, Pratlong F, Dedet J-P, et al. Multilocus microsatellite typing (MLMT) of strains from Turkey and cyprus reveals a novel monophyletic L. donovani sensu lato group. PLoS Negl Trop Dis. 2012;6:e1507. doi: 10.1371/journal.pntd.0001507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Nemati S, Fazaeli A, Hajjaran H, Khamesipour A, Anbaran MF, Bozorgomid A, et al. Genetic diversity and phylogenetic analysis of the Iranian Leishmania parasites based on HSP70 gene PCR-RFLP and sequence analysis. Korean J Parasitol. 2017;55:367–374. doi: 10.3347/kjp.2017.55.4.367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Ramírez JD, Hernández C, León CM, Ayala MS, Flórez C, González C. Taxonomy, diversity, temporal and geographical distribution of cutaneous leishmaniasis in Colombia: a retrospective study. Sci Rep. 2016;6:28266. doi: 10.1038/srep28266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Calzada JE, Samudio F, de Juncá C, Pineda V, Burleigh BA, Saldaña A. Genetic diversity of Trypanosoma cruzi in Panama inferred by multi-locus sequence typing of mitochondrial genes. Microorganisms. 2022;10:287. doi: 10.3390/microorganisms10020287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Velásquez-Ortiz N, Hernández C, Herrera G, Cruz-Saavedra L, Higuera A, Arias-Giraldo LM, et al. Trypanosoma cruzi infection, discrete typing units and feeding sources among Psammolestes arthuri (Reduviidae: Triatominae) collected in eastern Colombia. Parasit Vectors. 2019;12:157. doi: 10.1186/s13071-019-3422-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Weber JS, Ngomtcho SCH, Shaida SS, Chechet GD, Gbem TT, Nok JA, et al. Genetic diversity of trypanosome species in tsetse flies (Glossina spp.) in Nigeria. Parasit Vectors. 2019;12:481. doi: 10.1186/s13071-019-3718-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Arias-Giraldo LM, Muñoz M, Hernández C, Herrera G, Velásquez-Ortiz N, Cantillo-Barraza O, et al. Identification of blood-feeding sources in panstrongylus, psammolestes, rhodnius and triatoma using amplicon-based next-generation sequencing. Parasit Vectors. 2020;13:434. doi: 10.1186/s13071-020-04310-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Flaherty BR, Barratt J, Lane M, Talundzic E, Bradbury RS. Sensitive universal detection of blood parasites by selective pathogen-DNA enrichment and deep amplicon sequencing. Microbiome. 2021;9:1. doi: 10.1186/s40168-020-00939-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Grubaugh ND, Gangavarapu K, Quick J, Matteson NL, De Jesus JG, Main BJ, et al. An amplicon-based sequencing framework for accurately measuring intrahost virus diversity using PrimalSeq and iVar. Genome Biol. 2019;20:8. doi: 10.1186/s13059-018-1618-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Maiguashca Sánchez J, Sueto SOB, Schwabl P, Grijalva MJ, Llewellyn MS, Costales JA. Remarkable genetic diversity of Trypanosoma cruzi and Trypanosoma rangeli in two localities of southern Ecuador identified via deep sequencing of mini-exon gene amplicons. Parasit Vectors. 2020;13:252. doi: 10.1186/s13071-020-04079-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Moreno Y, Moreno-Mesonero L, Amorós I, Pérez R, Morillo JA, Alonso JL. Multiple identification of most important waterborne protozoa in surface water used for irrigation purposes by 18S rRNA amplicon-based metagenomics. Int J Hyg Environ Health. 2018;221:102–111. doi: 10.1016/j.ijheh.2017.10.008. [DOI] [PubMed] [Google Scholar]
  • 58.Patiño LH, Castillo-Castañeda AC, Muñoz M, Jaimes JE, Luna-Niño N, Hernández C, et al. Development of an amplicon-based next-generation sequencing protocol to identify leishmania species and other trypanosomatids in Leishmaniasis endemic areas. Microbiol Spectr. 2021;9:e00652–e721. doi: 10.1128/Spectrum.00652-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Abbasi I, Nasereddin A, Warburg A. Development of a next-generation DNA sequencing-based multi detection assay for detecting and identifying Leishmania parasites, blood sources, plant meals and intestinal microbiome in phlebotomine sand flies. Acta Trop. 2019;199:105101. doi: 10.1016/j.actatropica.2019.105101. [DOI] [PubMed] [Google Scholar]
  • 60.de Oliveira GE, Filipe M, de Macedo GC, Barreto WTG, Campos JBV, Meyers AC, et al. Maintenance of Trypanosoma cruzi, T evansi and Leishmania spp by domestic dogs and wild mammals in a rural settlement in Brazil-Bolivian border. Int J Parasitol Parasites Wildl. 2018;7:398–404. doi: 10.1016/j.ijppaw.2018.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Sevá AP, Ovallos FG, Amaku M, Carrillo E, Moreno J, Galati EAB, et al. Canine-Based Strategies for Prevention and Control of Visceral Leishmaniasis in Brazil. PLoS ONE. 2016;11:e0160058. doi: 10.1371/journal.pone.0160058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Llewellyn MS, Messenger LA, Luquetti AO, Garcia L, Torrico F, Tavares SBN, et al. Deep sequencing of the Trypanosoma cruzi GP63 surface proteases reveals diversity and diversifying selection among chronic and congenital Chagas disease patients. PLoS Negl Trop Dis. 2015;9:e0003458. doi: 10.1371/journal.pntd.0003458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Castillo-Castañeda A, Patiño LH, Muñoz M, Ayala MS, Segura M, Bautista J, et al. Amplicon-based next-generation sequencing reveals the co-existence of multiple Leishmania species in patients with visceral leishmaniasis. Int J Infect Dis. 2022;115:35–38. doi: 10.1016/j.ijid.2021.11.029. [DOI] [PubMed] [Google Scholar]
  • 64.PAHO W. Epidemiological Report of the Americas. Leishmaniases . 2019 Mar p. 8. Report No.: 7. http://iris.paho.org/xmlui/handle/123456789/50505.
  • 65.Patino LH, Mendez C, Rodriguez O, Romero Y, Velandia D, Alvarado M, et al. Spatial distribution, Leishmania species and clinical traits of Cutaneous Leishmaniasis cases in the Colombian army. PLoS Negl Trop Dis. 2017;11:e0005876. doi: 10.1371/journal.pntd.0005876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Sandoval-Ramírez CM, Hernández C, Teherán AA, Gutierrez-Marin R, Martínez-Vega RA, Morales D, et al. Complex ecological interactions across a focus of cutaneous leishmaniasis in Eastern Colombia: novel description of Leishmania species, hosts and phlebotomine fauna. R Soc Open Sci. 2020;7:200266. doi: 10.1098/rsos.200266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 2010;7:335–336. doi: 10.1038/nmeth.f.303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Franssen SU, Durrant C, Stark O, Moser B, Downing T, Imamura H, et al. Global genome diversity of the Leishmania donovani complex. Elife. 2020;9:e51243. doi: 10.7554/eLife.51243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Kuhls K, Alam MZ, Cupolillo E, Ferreira GEM, Mauricio IL, Oddone R, et al. Comparative microsatellite typing of new world Leishmania infantum reveals low heterogeneity among populations and its recent old world origin. PLoS Negl Trop Dis. 2011;5:e1155. doi: 10.1371/journal.pntd.0001155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Leblois R, Kuhls K, François O, Schönian G, Wirth T. Guns, germs and dogs: on the origin of Leishmania chagasi. Infect Genet Evol. 2011;11:1091–1095. doi: 10.1016/j.meegid.2011.04.004. [DOI] [PubMed] [Google Scholar]
  • 71.Aleixo JA, Nascimento ET, Monteiro GR, Fernandes MZ, Ramos AMO, Wilson ME, et al. Atypical American visceral leishmaniasis caused by disseminated Leishmania amazonensis infection presenting with hepatitis and adenopathy. Trans R Soc Trop Med Hyg. 2006;100:79–82. doi: 10.1016/j.trstmh.2005.06.025. [DOI] [PubMed] [Google Scholar]
  • 72.Tolezano JE, Uliana SRB, Taniguchi HH, Araújo MFL, Barbosa JAR, Barbosa JER, et al. The first records of Leishmania (Leishmania) amazonensis in dogs (Canis familiaris) diagnosed clinically as having canine visceral leishmaniasis from Araçatuba county, São Paulo state. Brazil Vet Parasitol. 2007;149:280–284. doi: 10.1016/j.vetpar.2007.07.008. [DOI] [PubMed] [Google Scholar]
  • 73.Valdivia HO, Zorrilla VO, Espada LJ, Perez JG, Razuri HR, Vera H, et al. Diversity, distribution and natural Leishmania infection of sand flies from communities along the interoceanic highway in the Southeastern Peruvian Amazon. PLoS Negl Trop Dis. 2021;15:e0009000. doi: 10.1371/journal.pntd.0009000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Abdoli A, Maspi N, Ghaffarifar F, Nasiri V. Viscerotropic leishmaniasis: a systematic review of the case reports to highlight spectrum of the infection in endemic countries. Parasitol Open. 2018;4:e11. doi: 10.1017/pao.2018.9. [DOI] [Google Scholar]
  • 75.Hernández C, Cucunubá Z, Flórez C, Olivera M, Valencia C, Zambrano P, et al. Molecular diagnosis of Chagas disease in Colombia: parasitic loads and discrete typing units in patients from acute and chronic phases. PLoS Negl Trop Dis. 2016;10:e0004997. doi: 10.1371/journal.pntd.0004997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.INS. Informe de evento: Enfermedad de Chagas 2018. Bogotá: Instituto Nacional de Salud; 2019.
  • 77.Jansen AM, das Xavier SCC, Roque ALR. Trypanosoma cruzi transmission in the wild and its most important reservoir hosts in Brazil. Parasit Vectors. 2018;11:502. doi: 10.1186/s13071-018-3067-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Bilheiro AB, da Rosa JA, de Oliveira J, Belintani T, Fontes G, Medeiros JF, et al. First Report of Natural Infection with Trypanosoma cruzi in Rhodnius montenegrensis (Hemiptera, Reduviidae, Triatominae) in Western Amazon. Brazil Vector-Borne Zoonotic Dis. 2018;18:605–610. doi: 10.1089/vbz.2018.2266. [DOI] [PubMed] [Google Scholar]
  • 79.Bilheiro AB, da Costa GS, da Araújo MS, Ribeiro WAR, Medeiros JF, Camargo LMA. Identification of blood meal sources in species of genus Rhodnius in four different environments in the Brazilian Amazon. Acta Trop. 2022;232:106486. doi: 10.1016/j.actatropica.2022.106486. [DOI] [PubMed] [Google Scholar]
  • 80.de Sousa PH, Scofield A, Júnior PSB, dos Lira SD, de Sousa SJ, Chaves JF, et al. Chagas disease in urban and peri-urban environment in the Amazon: Sentinel hosts, vectors, and the environment. Acta Trop. 2021;217:105858. doi: 10.1016/j.actatropica.2021.105858. [DOI] [PubMed] [Google Scholar]
  • 81.Ramírez-Chaves H, Suárez Castro A, González-Maya J. Cambios recientes a la lista de mamíferos de Colombia. Mammal Notes. 2016;3:1–9. doi: 10.47603/manovol3n1.1-9. [DOI] [Google Scholar]
  • 82.Gómez-Bravo A, German A, Abril M, Scavuzzo M, Salomón OD. Spatial population dynamics and temporal analysis of the distribution of Lutzomyia longipalpis (Lutz & Neiva, 1912) (Diptera: Psychodidae: Phlebotominae) in the city of Clorinda, Formosa. Argentina Parasit Vectors. 2017;10:352. doi: 10.1186/s13071-017-2296-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Correa-Cárdenas CA, Pérez J, Patino LH, Ramírez JD, Duque MC, Romero Y, et al. Distribution, treatment outcome and genetic diversity of Leishmania species in military personnel from Colombia with cutaneous leishmaniasis. BMC Infect Dis. 2020;20:938. doi: 10.1186/s12879-020-05529-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Ferrer E, García H, Bolivar A, Cañizales I, Guerrero R, Herrera L. First molecular detection of Trypanosoma cruzi, T. rangeli and Leishmania spp. in capybaras. Vet Parasitol Reg Stud Rep. 2021;23:100516. doi: 10.1016/j.vprsr.2020.100516. [DOI] [PubMed] [Google Scholar]
  • 85.da Silva YSGN, da Silva e SD, da Silva SAC, Silva RBS, de Oliveira PRF, Mota RA, et al. Molecular and serological detection of Leishmania infantum, Toxoplasma gondii, and Leptospira spp in free-ranging capybaras (Hydrochoerus hydrochaeris) from the Atlantic forest. Eur J Wildl Res. 2021;67:13. doi: 10.1007/s10344-020-01452-4. [DOI] [Google Scholar]
  • 86.Kumari D, Singh K. Exploring the paradox of defense between host and Leishmania parasite. Int Immunopharmacol. 2022;102:108400. doi: 10.1016/j.intimp.2021.108400. [DOI] [PubMed] [Google Scholar]
  • 87.Mirzaei A, Rouhani S, Kazerooni P, Farahmand M, Parvizi P. Molecular detection and conventional identification of leishmania species in reservoir hosts of zoonotic cutaneous leishmaniasis in Fars Province south of Iran. Iran J Parasitol. 2013;8:280–288. [PMC free article] [PubMed] [Google Scholar]
  • 88.Palatnik-de-Sousa CB, Day MJ. One Health: the global challenge of epidemic and endemic leishmaniasis. Parasit Vectors. 2011;4:197. doi: 10.1186/1756-3305-4-197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Tsokana CN, Sokos C, Giannakopoulos A, Mamuris Z, Birtsas P, Papaspyropoulos K, et al. First evidence of Leishmania infection in European brown hare (Lepus europaeus) in Greece: GIS analysis and phylogenetic position within the Leishmania spp. Parasitol Res. 2016;115:313–321. doi: 10.1007/s00436-015-4749-8. [DOI] [PubMed] [Google Scholar]
  • 90.Castillo-Castañeda A, Herrera G, Ayala MS, Fuya P, Ramírez JD. Spatial and temporal variability of visceral leishmaniasis in Colombia, 2007 to 2018. Am J Trop Med Hyg. 2021;105:144–155. doi: 10.4269/ajtmh.21-0103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Golpayegani AA, Moslem AR, Akhavan AA, Zeydabadi A, Mahvi AH, Allah-Abadi A. Modeling of environmental factors affecting the prevalence of zoonotic and anthroponotic cutaneous, and zoonotic visceral leishmaniasis in foci of Iran: a remote sensing and GIS based study. J Arthropod-Borne Dis. 2018;12:41–66. [PMC free article] [PubMed] [Google Scholar]
  • 92.Risueño J, Ortuño M, Pérez-Cutillas P, Goyena E, Maia C, Cortes S, et al. Epidemiological and genetic studies suggest a common Leishmania infantum transmission cycle in wildlife, dogs and humans associated to vector abundance in Southeast Spain. Vet Parasitol. 2018;259:61–67. doi: 10.1016/j.vetpar.2018.05.012. [DOI] [PubMed] [Google Scholar]
  • 93.Salgueiro MM, Pimentel MIF, Miranda LFC, Cunha SRR, Oliveira LFA, Lyra MR, et al. Parasite species variation and impact of spatial displacement of the population on cutaneous leishmaniasis in Rio de Janeiro, Brazil. Trans R Soc Trop Med Hyg. 2022;116:70–79. doi: 10.1093/trstmh/trab088. [DOI] [PubMed] [Google Scholar]
  • 94.Estrada LG, Ortega E, Vivero RJ, Bejarano EE, Cadena H. Development of Lutzomyia evansi immature stages in peridomiciliary environment in a leishmaniasis urban focus in the Colombian Caribbean. Acta Trop. 2020;208:105523. doi: 10.1016/j.actatropica.2020.105523. [DOI] [PubMed] [Google Scholar]
  • 95.Chajbullinova A, Votypka J, Sadlova J, Kvapilova K, Seblova V, Kreisinger J, et al. The development of Leishmania turanica in sand flies and competition with L. major. Parasit Vectors. 2012;5:219. doi: 10.1186/1756-3305-5-219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.de Rodrigues OA, Pinheiro GRG, Tinoco HP, Loyola ME, Coelho CM, Dias ES, et al. Competence of non-human primates to transmit Leishmania infantum to the invertebrate vector Lutzomyia longipalpis. PLoS Negl Trop Dis. 2019;13:e0007313. doi: 10.1371/journal.pntd.0007313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Serafim TD, Coutinho-Abreu IV, Oliveira F, Meneses C, Kamhawi S, Valenzuela JG. Sequential blood meals promote Leishmania replication and reverse metacyclogenesis augmenting vector infectivity. Nat Microbiol. 2018;3:548–555. doi: 10.1038/s41564-018-0125-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Funk S, Nishiura H, Heesterbeek H, Edmunds WJ, Checchi F. Identifying transmission cycles at the human-animal interface: the role of animal reservoirs in maintaining gambiense human African trypanosomiasis. PLoS Comput Biol. 2013;9:e1002855. doi: 10.1371/journal.pcbi.1002855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99.Lambin EF, Tran A, Vanwambeke SO, Linard C, Soti V. Pathogenic landscapes: Interactions between land, people, disease vectors, and their animal hosts. Int J Health Geogr. 2010;9:54. doi: 10.1186/1476-072X-9-54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Veeresha P, Malagi NS, Prakasha DG, Baskonus HM. An efficient technique to analyze the fractional model of vector-borne diseases. Phys Scr. 2022;97:054004. doi: 10.1088/1402-4896/ac607b. [DOI] [Google Scholar]
  • 101.Lago R de JM do, Sousa IDB de, Albuquerque LP de A, Moraes FC, Aquino DMC de. Aspectos de uma área endêmica para leishmaniose visceral em um município no Maranhão, Brasil. Rev Epidemiol E Controle Infecção. 2020. https://online.unisc.br/seer/index.php/epidemiologia/article/view/15109. Accessed on 6 Jun 2022.
  • 102.de Montes ACOA, González-Martínez A, Chan-González R, Ibarra-López P, Smith-Ávila S, Córdoba-Aguilar A, et al. Signs of urban evolution? Morpho-functional traits co-variation along a nature-urban gradient in a Chagas disease vector. Front Ecol Evol. 2022;10:805040. doi: 10.3389/fevo.2022.805040. [DOI] [Google Scholar]
  • 103.Ocaña-Mayorga S, Bustillos JJ, Villacís AG, Pinto CM, Brenière SF, Grijalva MJ. Triatomine feeding profiles and Trypanosoma cruzi Infection, Implications in Domestic and Sylvatic Transmission Cycles in Ecuador. Pathogens. 2021;10:42. doi: 10.3390/pathogens10010042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104.Lypaczewski P, Matlashewski G. Leishmania donovani hybridisation and introgression in nature: a comparative genomic investigation. Lancet Microbe. 2021;2:e250–e258. doi: 10.1016/S2666-5247(21)00028-8. [DOI] [PubMed] [Google Scholar]
  • 105.Rogozin IB, Charyyeva A, Sidorenko IA, Babenko VN, Yurchenko V. frequent recombination events in Leishmania donovani: mining population data. Pathogens. 2020;9:572. doi: 10.3390/pathogens9070572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 106.Van den Broeck F, Savill NJ, Imamura H, Sanders M, Maes I, Cooper S, et al. Ecological divergence and hybridization of Neotropical Leishmania parasites. Proc Natl Acad Sci. 2020;117:25159–25168. doi: 10.1073/pnas.1920136117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107.World Health Organization. Multisectoral approach to the prevention and control of vector-borne diseases: a conceptual framework [Internet]. Geneva: World Health Organization; 2020. https://apps.who.int/iris/handle/10665/331861
  • 108.Dario MA, Pavan MG, Rodrigues MS, Lisboa CV, Kluyber D, Desbiez ALJ, et al. Trypanosoma rangeli genetic, mammalian hosts, and geographical diversity from five Brazilian biomes. Pathogens. 2021;10:736. doi: 10.3390/pathogens10060736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 109.Ramirez LE, Lages-Silva E, Alvarenga-Franco F, Matos A, Vargas N, Fernandes O, et al. High prevalence of Trypanosoma rangeli and Trypanosoma cruzi in opossums and triatomids in a formerly-endemic area of Chagas disease in Southeast Brazil. Acta Trop. 2002;84:189–198. doi: 10.1016/S0001-706X(02)00185-7. [DOI] [PubMed] [Google Scholar]
  • 110.De Araújo VAL, Boité MC, Cupolillo E, Jansen AM, Roque ALR. Mixed infection in the anteater Tamandua tetradactyla (Mammalia: Pilosa) from Pará State, Brazil: Trypanosoma cruzi, T. rangeli and Leishmania infantum. Parasitol. 2013;140:455–460. doi: 10.1017/S0031182012001886. [DOI] [PubMed] [Google Scholar]
  • 111.Da Maia SF, Junqueira ACV, Campaner M, Rodrigues AC, Crisante G, Ramirez LE, et al. Comparative phylogeography of Trypanosoma rangeli and Rhodnius (Hemiptera: Reduviidae) supports a long coexistence of parasite lineages and their sympatric vectors. Mol Ecol. 2007;16:3361–3373. doi: 10.1111/j.1365-294X.2007.03371.x. [DOI] [PubMed] [Google Scholar]
  • 112.Vallejo GA, Guhl F, Carranza JC, Lozano LE, Sánchez JL, Jaramillo JC, et al. kDNA markers define two major Trypanosoma rangeli lineages in Latin-America. Acta Trop. 2002;81:77–82. doi: 10.1016/S0001-706X(01)00186-3. [DOI] [PubMed] [Google Scholar]
  • 113.das Xavier SCC, Roque ALR, Bilac D, de Araújo VAL, da Neto SFC, Lorosa ES, et al. Distantiae transmission of Trypanosoma cruzi: a new epidemiological feature of acute chagas disease in Brazil. PLoS Negl Trop Dis. 2014;8:e2878. doi: 10.1371/journal.pntd.0002878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 114.Espinosa-Álvarez O, Ortiz PA, Lima L, Costa-Martins AG, Serrano MG, Herder S, et al. Trypanosoma rangeli is phylogenetically closer to old world trypanosomes than to Trypanosoma cruzi. Int J Parasitol. 2018;48:569–584. doi: 10.1016/j.ijpara.2017.12.008. [DOI] [PubMed] [Google Scholar]
  • 115.Saldaña A, Santamaría AM, Pineda V, Vásquez V, Gottdenker NL, Calzada JE. A darker chromatic variation of Rhodnius pallescens infected by specific genetic groups of Trypanosoma rangeli and Trypanosoma cruzi from Panama. Parasit Vectors. 2018;11:423. doi: 10.1186/s13071-018-3004-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 116.Vallejo G, Guhl F, Carranza JC, Herrera C, Urrea D, Falla A, et al. Trypanosoma cruzi population variability in Colombia: possible coevolution in different vector species. Rev Soc Bras Med Trop. 2009;42:38–45. [Google Scholar]
  • 117.Chihi A, O’Brien Andersen L, Aoun K, Bouratbine A, Stensvold CR. Amplicon-based next-generation sequencing of eukaryotic nuclear ribosomal genes (metabarcoding) for the detection of single-celled parasites in human faecal samples. Parasite Epidemiol Control. 2022;17:e00242. doi: 10.1016/j.parepi.2022.e00242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 118.Gupta S, Mortensen MS, Schjørring S, Trivedi U, Vestergaard G, Stokholm J, et al. Amplicon sequencing provides more accurate microbiome information in healthy children compared to culturing. Commun Biol. 2019;2:291. doi: 10.1038/s42003-019-0540-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 119.Chaorattanakawee S, Korkusol A, Tippayachai B, Promsathaporn S, Poole-Smith BK, Takhampunya R. Amplicon-based next generation sequencing for rapid identification of rickettsia and ectoparasite species from entomological surveillance in Thailand. Pathogens. 2021;10:215. doi: 10.3390/pathogens10020215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 120.Tonge DP, Pashley CH, Gant TW. Amplicon –based metagenomic analysis of mixed fungal samples using proton release amplicon sequencing. PLoS ONE. 2014;9:e93849. doi: 10.1371/journal.pone.0093849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 121.Ma L, Jakobiec FA, Dryja TP. A review of next-generation sequencing (NGS): applications to the diagnosis of ocular infectious diseases. Semin Ophthalmol. 2019;34:223–231. doi: 10.1080/08820538.2019.1620800. [DOI] [PubMed] [Google Scholar]
  • 122.Cravero K, Medford A, Pallavajjala A, Canzoniero J, Hunter N, Chu D, et al. Biotinylated amplicon sequencing: a method for preserving DNA samples of limited quantity. Pract Lab Med. 2018;12:e00108. doi: 10.1016/j.plabm.2018.e00108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 123.Medinger R, Nolte V, Pandey RV, Jost S, Ottenwälder B, Schlötterer C, et al. diversity in a hidden world: potential and limitation of next-generation sequencing for surveys of molecular diversity of eukaryotic microorganisms. Mol Ecol. 2010;19:32–40. doi: 10.1111/j.1365-294X.2009.04478.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 124.Rodrigues DC, Silva R, Rondinelli E, Ürményi TP. Trypanosoma cruzi: modulation of HSP70 mRNA stability by untranslated regions during heat shock. Exp Parasitol. 2010;126:245–253. doi: 10.1016/j.exppara.2010.05.009. [DOI] [PubMed] [Google Scholar]
  • 125.Hernández C, Salazar C, Brochero H, Teherán A, Buitrago LS, Vera M, et al. Untangling the transmission dynamics of primary and secondary vectors of Trypanosoma cruzi in Colombia: parasite infection, feeding sources and discrete typing units. Parasit Vectors. 2016;9:620. doi: 10.1186/s13071-016-1907-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 126.Filgueira CPB, Moreira OC, Cantanhêde LM, de Farias HMT, Porrozzi R, Britto C, et al. Comparison and clinical validation of qPCR assays targeting Leishmania 18S rDNA and HSP70 genes in patients with American tegumentary leishmaniasis. PLoS Negl Trop Dis. 2020;14:e0008750. doi: 10.1371/journal.pntd.0008750. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

13071_2022_5595_MOESM1_ESM.pdf (121.4KB, pdf)

Additional file 1: Fig. S1. Map showing the different departments and the capital district of Colombia.

13071_2022_5595_MOESM2_ESM.pdf (224.3KB, pdf)

Additional file 2: Table S1. Information on collected samples per department, sample code, and mammal species.

13071_2022_5595_MOESM3_ESM.pdf (248.3KB, pdf)

Additional file 3: Table S2. BLASTn results for the 337bp Hsp70 gene fragment of the samples analyzed herein.

13071_2022_5595_MOESM4_ESM.pdf (523.7KB, pdf)

Additional file 4: Table S3. Shannon and Simpson index values from the different species found in the analyzed samples by amplicon-based NGS.

Data Availability Statement

All data generated or analyzed during this study are included in this published article and its supplementary information files. Sanger sequence data to GenBank code BankIt2630585: OP611209OP611320. Amplicon-based NGS data to ENA, project accession: PRJEB56730 and submission accession: ERA18523751.


Articles from Parasites & Vectors are provided here courtesy of BMC

RESOURCES