Abstract
Background
IL‐10 is thought to play an important role in preventing inflammatory bowel disease (IBD), although its efficacy is limited in IBD inflammation treatment. The purpose of this study is to investigate the association between SNP polymorphism in the promoter region of the IL‐10 gene and Crohn's disease (CD).
Methods
In 86 children with CD disease and 142 healthy controls, polymorphisms of three SNPs (rs3790622, rs1800872, and rs1800896) in the IL‐10 promoter region were successfully identified. The risk alleles, genotypes, and haplotypes were also analyzed in the CD patient group and the control group. 2 × 2 chi‐square test was used to identify whether there is a statistically significant association between CD risk and SNP polymorphisms.
Results
According to the chi‐square test results, only the polymorphism of rs1800872 was associated with pediatric CD. T allele in rs1800872 showed a high risk for pediatric CD (Pearson χ 2 p = 0.030). TT genotype of rs1800872 was associated with a higher risk of CD in the pediatric population (OR 1.986, 95% CI 1.146–3.442, p = 0.020, TT vs. TG + GG). Finally, a risk haplotype GTT (rs3790622‐rs1800872‐rs1800896) in IL‐10 was found (OR 1.570, 95% CI 1.054–2.341, p = 0.028).
Conclusions
Our data suggested that T allele, TT genotype, and haplotype GTT in rs1800872 were associated with the susceptibility to pediatric CD in China.
Keywords: Crohn's disease, disease risk, genetic association, IL‐10, polymorphisms
T allele, TT genotype, and haplotype GTT in rs1800872 were associated with the susceptibility to pediatric CD in China.
1. INTRODUCTION
As an inflammatory bowel disease (IBD), Crohn's disease (CD) is known for its complex etiology and serious family life impairment, including psychological health. 1 It was once recognized as no known cure for inflammation that may involve any part of the gastrointestinal tract. 2 CD was reported with a high incidence in western countries. 3 , 4 In recent years, the incidence of CD has been gradually increasing in China. 5 , 6 Despite the low incidence of CD in China, the rising momentum of this complex disease in children still raises public concerns in the country. Because young CD patients, especially pediatric patients, are at higher risk of obstinacy or recurrence. 7
Till now, the exact genetic mechanism of CD remains unclear. Given many clues in hand, a deep insight into high‐risk genes is urgently needed. The disease is featured with familial aggregation, which means the disease appears more frequently than expected in specific families. 8 According to European and American literature statistics, the first‐blood relatives of patients with CD or ulcerative colitis are at 10 times higher risk of developing the same disease. 9 Although the pathogenesis of CD is not well understood, it is well accepted that CD is highly related to genetic predisposition, environmental triggers, and the interaction between infection and the immunity system.
Thanks to large‐scale international cooperation, more than 200 genes were found as high‐risk genes for CD (or IBD) by using the technology of genome‐wide association analysis. 10 , 11 The IL‐10 −/− mice were more susceptible to CD. 12 , 13 , 14 Kucharzik et al. 15 revealed the relationship between the IL‐10 level and the activity of CD and ulcerative colitis through gene studies, and Wu et al. 16 also confirmed the association between IL‐10 polymorphism and IBD. Schmit et al. 17 found that recombinant human IL‐10 could downregulate the secretion of TNFA by lamina propria monocytes in patients with CD. The evidence suggests that the expression regulation of IL‐10 strongly correlates with the incidence of CD. Here, we explored the association of 3 SNPs located in the promoter region of IL‐10 with pediatric CD in China.
2. MATERIALS AND METHODS
2.1. Subjects
A total of 86 CD patients and 142 healthy controls were enrolled in this study from February 2019 to February 2021. All 86 cases from the Children's Hospital of Zhejiang University School of Medicine were diagnosed with CD using standard criteria 18 and their disease site and behavior classification were determined according to Montreal 19 and Pairs criteria. 20 Among the 86 CD patients with a mean age of 10.2 ± 3.6 years. There was an obvious male preponderance in the patients (68.6%). Most children had ileocolonic disease (L3 ± L4, 61.6%) and inflammatory disease (B1, 94.2%) at diagnosis. The detailed clinical characteristics of patients and controls together are provided in Table 1.
TABLE 1.
Clinical characteristics of CD group and control group
| Characteristic | Patients (n = 86) | Controls (n = 142) |
|---|---|---|
| Age at diagnosis | ||
| A1a, n (%) | 22 (25.6) | 39 (27.5) |
| A1b, n (%) | 64 (74.4) | 103 (72.5) |
| Mean (±SD) | 10.2 (±3.6) | 9.4 (±2.5) |
| Gender, n (%) | ||
| Females | 27 (31.4) | 49 (34.5) |
| Males | 59 (68.6) | 93 (65.5) |
| Disease behavior, n (%) | ||
| B1 | 81 (94.2) | |
| B2 + B3 | 5 (5.8) | |
| Disease location, n (%) | ||
| L1 ± L4 | 9 (10.5) | |
| L2 ± L4 | 6 (7.0) | |
| L3 ± L4 | 53 (61.6) | |
| L4 only | 11 (12.8) | |
| Unknown | 7 (8.1) | |
| Perianal lesion, n (%) | 23 (26.7) | |
Abbreviations: A1a, diagnosed with Crohn's disease <10 years old; A1b, diagnosed with Crohn's disease 10–17 years old; B1, uncomplicated inflammatory disease; B2, occurrence of constant luminal narrowing; B3, occurrence of bowel preformation; CD, Crohn's disease; L1, ileal; L2, colonic; L3, ileocolonic; L4, upper gastrointestinal; Perianal lesion, 23 of 86 CD patients were also diagnosed with the perianal lesion.
2.2. Genotyping
DNA isolation, SNP selection, and SNP genotyping were performed according to the instruction as described by Xu et al. 21 Briefly, DNA was extracted from 200 μl blood in EDTA vials following the DNA extraction kit instruction (Tissuebank Biotechnology co, LTD). SNP genotyping was finished on the sequence Mass ARRAY platform (sequence). PCR primers sequences for IL‐10 rs1800872 were 5′‐GTGGGCTAAATATCCTCAAAGTTC‐3′ (sense) and 5′‐AGCATATAAGAAGCTTTCAGCAAG‐3′ (antisense). The primers for IL‐10 rs3790622 were 5′‐ACGTTGGATGGCACTCTACATGAGGGAAAC‐3′ (sense) and 5′‐ACGTTGGATGTTCTCCCCACTGTAGACATC‐3′ (antisense) and the primers for IL‐10 rs1800896 were 5′‐AAAGTTTAAAAGATGGGGTGGAAG‐3′ (sense) and 5′‐CTTACCTTCTACACACACACACAC‐3′ (antisense).
2.3. Statistical analysis
Pearson's chi‐square (χ 2) test (or Fisher's exact test) was used to compare categorical variables, such as genotype and allele frequencies between patients and controls. The frequencies of allele and genotype were also compared between patients with and without clinical features of CD. The odds ratio (OR) and 95% confidence interval (CI) were calculated for every explanatory variable. Each SNP was tested for agreement with the Hardy–Weinberg equilibrium (HWE) using a goodness‐of‐fit chi‐square (χ 2) test before analysis. Linkage‐disequilibrium (LD), and haplotypes were performed by using Haploview version 4.2 software. p < 0.05 was considered as a significant difference. SPSS software package (revision 22.0) was used for statistical analysis.
3. RESULTS
3.1. Gene polymorphisms in CD patients and healthy children
All three studied SNPs were in HWE in both patient and control groups (p > 0.05). Then polymorphisms of three SNPs located in the IL‐10 promoter region were detected, and allelic association tests of the three SNPs with CD were examined by using χ 2 test (Table 2). Among the three SNPs, rs1800872, associated with CD, was identified. T allele in rs1800872 showed a high risk for pediatric CD (Pearson χ 2 p = 0.030). However, the other two SNPs, rs3790622 and rs1800896, did not archive statistical significance (p‐value 0.512 and 0.239, respectively). And then, the genotype association was also analyzed for the SNP of rs1800872. Compared with the frequency of TG + GG genotypes in rs1800872, the frequency of TT genotype in the patient group was significantly higher (OR 1.986, 95% CI 1.146–3.442, p = 0.020). In another word, TT genotype of rs1800872 had a higher risk of developing pediatric CD in the recessive inheritance model. The frequency of each genotype in the other two SNPs (rs3790622 and rs1800896) showed no statistical difference between the patient and control groups.
TABLE 2.
Association of SNP polymorphisms with CD
| SNP ID | Allele | Genotype frequency, n (%) | Allele 1 vs 2 | Genotype 11 vs 22 | Genotype (11 + 12) vs 22 | Genotype 11 vs (12 + 22) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Pediatric CD patients | Control | |||||||||||||||||
| 1 a | 2 | 11 | 12 | 22 | Total | 11 | 12 | 22 | Total | χ 2 | p‐value | OR (95% CI) | p‐value | OR (95% CI) | p‐value | OR (95% CI) | p‐value | |
| rs3790622 | G | A | 72 (83.7) | 14 (16.3) | 0 (0.0) | 86 | 114 (80.3) | 27 (19.0) | 1 (0.7) | 142 | 0.538 | 0.512 | 0.613 (0.547–0.687) | 1.000 | 0.621 (0.561–0.688) | 1.000 | 1.263 (0.623–2.559) | 0.598 |
| rs1800872 | T | G | 55 (64.0) | 25 (29.0) | 6 (7.0) | 86 | 67 (47.2) | 62 (43.7) | 13 (9.1) | 142 | 4.832 | 0.030 | 1.779 (0.634–4.987) | 0.325 | 1.344 (0.491–3.677) | 0.629 | 1.986 (1.146–3.442) | 0.020* |
| rs1800896 | T | C | 78 (90.7) | 8 (9.3) | 0 (0.0) | 86 | 124 (87.3) | 16 (11.3) | 2 (1.4) | 142 | 1.68 | 0.239 | 0.614 (0.550–0.685) | 0.525 | 0.619 (0.559–0.686) | 0.528 | 1.371 (0.569–3.303) | 0.526 |
Abbreviations: CI, 95% confidence interval; OR, odds ratio.
Denotes the risk allele.
Statistically significant (p < 0.05).
Then, LD analysis was performed in CD patients and healthy controls using the halpoview 4.2 software. The three polymorphic sites of IL‐10 gene were in a state of linkage disequilibrium with one another in all participants (for rs1800872 and rs1800896, D′ = 1.0, r2 = 0.173; for rs1800872 and rs3790622, D′ = 1.0, r2 = 0.039; for rs1800896 and rs3790622, D′ = 1.0, r2 = 0.007). As the haplotype analysis results showed in Table 3, the most frequent haplotypes for rs3790622, rs1800872, and rs1800896 were GTT in both CD and control groups. And the GTT haplotype frequency in the CD group was 68.6%, higher than the figure of 58.2% in the control group (OR 1.570, 95% CI 1.054–2.341, p = 0.028). However, the other two SNPs haplotype frequencies showed no statistical difference between CD and control groups.
TABLE 3.
Haplotype frequencies of IL‐10 in CD and control groups
| Haplotypes (rs3790622, rs1800872, rs1800896) | CD, n = 86 | Control, n = 142 | OR (95% CI) | p‐value |
|---|---|---|---|---|
| n (%) | n (%) | |||
| GTT | 118 (68.6) | 165.25 (58.2) | 1.570 (1.054–2.341) | 0.028* |
| GGT | 31 (18.0) | 71.25 (25.1) | 0.656 (0.409–1.053) | 0.104 |
| ATT | 14.5 (8.4) | 23.75 (8.4) | 1.009 (0.510–1.996) | 1.000 |
Abbreviations: CI, 95% confidence interval; OR, odds ratio.
Statistically significant (p < 0.05).
3.2. Gene polymorphisms in A1a group and A1b group
According to the age diagnosed with CD. We divided our patients into two groups. A1a group diagnosed with CD <10 years. A1b group diagnosed with CD at 10–17 years old. As shown in Table S1, there were no significant differences in genotype between A1a and A1b groups in all the three SNPs (rs3790622, rs1800872, and rs1800896) (p > 0.05). As shown in Table S2, the haplotype analysis results of the IL‐10 gene of the three SNPs (rs3790622, rs1800872, and rs1800896) indicate no significant differences between A1a and A1b groups. Our results suggest that age at diagnosis is not associated with CD risk.
3.3. Gene polymorphisms in CD patients with or without perianal lesion
Depending on the CD patients with or without perianal lesions, we divided the cases into two groups. Three IL‐10 polymorphisms (rs3790622, rs1800872, and rs1800896) in CD patients with perianal lesions and CD patients without perianal lesions are shown in Tables S3 and S4. There were no significant differences in genotype and haplotype between the two groups (p > 0.05). Our data indicate that with or without perianal lesions are not associated with CD risk.
4. DISCUSSION
In case–control genetic association analysis, the selection of the patient and control groups has a huge effect on the outcomes. CD is highly related to genetic background, age, race, and diet habits. For example, recent studies figured out that a higher intake of dietary fiber leads to a lower risk for CD. 22 , 23 Here the genetic association study only focused on pediatric CD patients. There is no denying that the number of pediatric patients 86 is small, but pediatric CD patients are more difficult to enroll and more valuable as the CD ratio in children is apparently smaller than in adults. Pediatric CD patients are more likely caused by genetic effects. Therefore, we speculated that there was a higher chance of identifying genetic effects in the pediatric CD group in the case–control genetic association study.
This study investigated whether SNP polymorphism in the IL‐10 promoter region is associated with the occurrence of CD in Chinese Han children. The results showed that the SNP rs1800872 had both G and T alleles, and the T allele increased the risk of CD in children. The homozygous TT genotype in the SNP rs1800872 faces a higher risk for CD, while homozygous GG and heterozygous GT could result in a lower occurrence of CD. Further haplotype analysis showed that the odds ratio of haplotype GTT was 1.570 (p = 0.028), indicating that this haplotype was more prone to CD. Other haplotypes had no statistical difference between CD and control groups, meaning that these haplotypes were not associated with CD risk.
The association between IL‐10 polymorphism and CD in children is not surprising. IL‐10 was first discovered by Fiorentino et al. 24 in 1989. Th2 cell clone secretes a new immune mediator, which is thought to inhibit the overreaction of inflammatory cells effectively. It plays an important role in maintaining tissue homeostasis during infection and inflammation by inhibiting excessive inflammatory response, enhancing natural immunity, and promoting tissue repair mechanisms. IL‐10 is considered as an important anti‐inflammatory cytokine in IBD. Jarry et al. 25 revealed that the loss of IL‐10 in intestinal epithelial cells leads to the downregulation of immunosuppressive gene BCL3 and upregulation of expression of IL‐17, IFN‐γ, and TNFα, thus directly damaging the intestinal mucosal barrier. More and more studies have shown that IL‐10 plays an important role in maintaining the immune regulation of intestinal mucosa, and abnormal intestinal mucosal barrier function is one of the key factors in the pathogenesis of IBD. IL‐10 can antagonize the production of inflammatory factors and maintain the integrity of the intestinal mucosal barrier, thus reducing the occurrence and progression of IBD. Moreover, studies have shown that enhancing the expression of IL‐10 in vivo or supplementing IL‐10 can prevent the occurrence of enteritis. It is thought that SNPs (rs18000872 and rs1800896) in the IL‐10 promoter region influence the expression of IL‐10 and are strongly associated with altered levels of circulating IL‐10, thereby influencing the organism's immune response. 26 Fowler et al. 27 reported that a relationship with disease severity showed a significant association of higher producing IL10‐1082G and TNFa‐857C alleles with stricturing behavior. In our study, we did not detect a correlation between rs1800896 SNP polymorphism and pediatric CD or CD severity, which may be related to differences in the population. In conclusion, it is logically possible that the abnormality of the IL‐10 gene or its polymorphism affects the occurrence and progression of CD.
However, for CD, genetic risk prediction is still in the exploratory stage, and no highly correlated loci have been identified so far, which is of low clinical efficacy. For example, in a meta‐analysis based on 1890 IBD patients and 2929 controls, polymorphism of rs3021097 (C‐819 T) in IL‐10 was significantly associated with CD, but not statistically associated with IBD. 16 In a study of CD patients aged from 5 to 20 in Montreal, Canada, the genotype frequency of SNPs rs1800896, rs3021097, and rs1800872 in IL‐10 were not associated with CD, but the GCC haplotype was associated with the colonic location, and ACC haplotypes were associated with terminal ileum location in CD. 28 In addition to IL‐10, SNPs rs3810936, rs6478108, and rs6478109 of TNFSF15 gene were extremely significantly correlated with CD in Korean children, and their OR values were all over 5. 29 Therefore, many researchers believe that CD susceptibility is the result of the interaction of many minor genes. As more and more related genes are identified, there is an opportunity to improve CD risk prediction. This study demonstrates that the incidence of childhood CD is statistically correlated with the SNP rs1800872 of IL‐10 in Chinese Han children, which can support the risk prediction of CD. However, the low occurrence of CD adds difficulty to predicting the CD risk. Therefore, there is still a huge gap between rs1800872 polymorphism mentioned in the article and the risk prediction of CD, which can only be limited before dietary habits and CD surveys of family members and other factors are taken into consideration.
The goal of this study is to collect more information about genetic association with CD, and we will continue to do so in the future. Thus, the genetic regulatory network of CD can be constructed to reveal the possible drug targets and finally achieve a better treatment effect of CD.
FUNDING INFORMATION
The study was funded by the National Natural Science Foundation of China, Grant/Award Number: 81971422.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
Supporting information
Tables S1–S4
ACKNOWLEDGMENT
We thank all the patients and volunteers for participating in this study.
Sun A, Li W, Shang S. Association of polymorphisms in the IL‐10 promoter region with Crohn's disease. J Clin Lab Anal. 2022;36:e24780. doi: 10.1002/jcla.24780
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.
REFERENCES
- 1. Ananthakrishnan AN, Khalili H, Pan A, et al. Association between depressive symptoms and incidence of Crohn's disease and ulcerative colitis: results from the Nurses' Health Study. Clin Gastroenterol Hepatol. 2013;11(1):57‐62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Roda G, Chien Ng S, Kotze PG, et al. Crohn's disease. Nat Rev Dis Primers. 2020;6(1):22. [DOI] [PubMed] [Google Scholar]
- 3. Van Assche G, Dignass A, Panes J, et al. The second European evidence‐based consensus on the diagnosis and management of Crohn's disease: definitions and diagnosis. J Crohns Colitis. 2010;4(1):7‐27. [DOI] [PubMed] [Google Scholar]
- 4. Gajendran M, Loganathan P, Catinella AP, Hashash JG. A comprehensive review and update on Crohn's disease. Dis Mon. 2018;64(2):20‐57. [DOI] [PubMed] [Google Scholar]
- 5. Zheng JJ, Shi XH, Zhu XS, Huangfu HF, Guo ZR. A comparative study of incidence and prevalence of Crohn's disease in mainland China in different periods. Zhonghua Nei Ke Za Zhi. 2011;50(7):597‐600. [PubMed] [Google Scholar]
- 6. Zhao J, Ng SC, Lei Y, et al. First prospective, population‐based inflammatory bowel disease incidence study in mainland of China: the emergence of “western” disease. Inflamm Bowel Dis. 2013;19(9):1839‐1845. [DOI] [PubMed] [Google Scholar]
- 7. Von Allmen D. Pediatric Crohn's disease. Clin Colon Rectal Surg. 2018;31(2):80‐88. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Santos MPC, Gomes C, Torres J. Familial and ethnic risk in inflammatory bowel disease. Ann Gastroenterol. 2018;31(1):14‐23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Orholm M, Munkholm P, Langholz E, Nielsen OH, Sørensen TIA, Binder V. Familial occurrence of inflammatory bowel disease. N Engl J Med. 1991;324(2):84‐88. [DOI] [PubMed] [Google Scholar]
- 10. Liu JZ, van Sommeren S, Huang HL. Association analyses identify 38 susceptibility loci for inflammatory bowel disease and highlight shared genetic risk across populations. Nat Genet. 2015;47(9):979‐986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Jostins LM, Ripke S, Weersma RK, et al. Host‐microbe interactions have shaped the genetic architecture of inflammatory bowel disease. Nature. 2012;491(7422):119‐124. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Hibi T, Ogata H, Sakuraba A. Animal models of inflammatory bowel disease. J Gastroenterol. 2002;37:409‐417. [DOI] [PubMed] [Google Scholar]
- 13. Lazarus R, Klimecki WT, Palmer LJ, et al. Single‐nucleotide polymorphisms in the interleukin‐10 gene: differences in frequencies, linkage disequilibrium patterns, and haplotypes in three United States ethnic groups. Genomics. 2002;80(2):223‐228. [DOI] [PubMed] [Google Scholar]
- 14. Warle MC, Farhan A, Metselaar HJ, et al. Are cytokine gene polymorphisms related to in vitro cytokine production profifiles? Liver Transpl. 2003;9(2):170‐181. [DOI] [PubMed] [Google Scholar]
- 15. Kucharzik T, Stoll R, Lügering N, Domschke W. Circulating antiinflammatory cytokine IL‐10 in patients with inflammatory bowel disease (IBD). Clin Exp Immunol. 1995;100(3):452‐456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Wu H, Guo J, He Y, Yin H, Shu J. Relationship between IL‐10 gene ‐819C/T polymorphism and the risk of inflammatory bowel disease: a meta‐analysis. Afr Health Sci. 2016;16(3):866‐872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Schmit A, Carol M, Robert F, et al. Dose‐effect of interleukin‐10 and its immunoregulatory role in Crohn's disease. Eur Cytokine Netw. 2002;13(3):298‐305. [PubMed] [Google Scholar]
- 18. Sands BE. From symptom to diagnosis: clinical distinctions among various forms of intestinal inflammation. Gastroenterology. 2004;126(6):1518‐1532. [DOI] [PubMed] [Google Scholar]
- 19. Silverberg MS, Satsangi J, Ahmad T, et al. Toward an integrated clinical, molecular and serological classification of inflammatory bowel disease: report of a Working Party of the 2005 Montreal World Congress of Gastroenterology. Can J Gastroenterol. 2005;19(Suppl A):5A‐36A. [DOI] [PubMed] [Google Scholar]
- 20. Levine A, Griffiths A, Markowitz J, et al. Pediatric modification of the Montreal classification for inflammatory bowel disease: the Paris classification. Inflamm Bowel Dis. 2011;17(6):1314‐1321. [DOI] [PubMed] [Google Scholar]
- 21. Xu H, Jiang G, Shen H, et al. The association between genetic variation in interleukin‐10 gene and susceptibility to Henoch‐Schönlein purpura in Chinese children. Clin Rheumatol. 2017;36(12):2761‐2767. [DOI] [PubMed] [Google Scholar]
- 22. Goens D, Dejan M. Role of diet in the development and management of Crohn's disease. Curr Gastroenterol Rep. 2020;22(4):19. [DOI] [PubMed] [Google Scholar]
- 23. Verburgt CM, Ghiboub M, Benninga MA, de Jonge WJ, van Limbergen JE. Nutritional therapy strategies in pediatric Crohn's disease. Nutrients. 2021;13(1):212. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Fiorentino DF, Bond MW, Mosmann TR. Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones. J Exp Med. 1989;170(6):2081‐2095. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Jarry A, Bossard C, Bou‐Hanna C, et al. Mucosal IL‐10 and TGF‐β play crucial roles in preventing LPS‐driven, IFN‐γ‐mediated epithelial damage in human colon explants. J Clin Invest. 2008;118:1132‐1142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Turner DM, Williams DM, Sankaran D, Lazarus M, Sinnott PJ, Hutchinson IV. An investigation of polymorphism in the interleukin‐10 gene promoter. Eur J Immunogenet. 1997;24(1):1‐8. [DOI] [PubMed] [Google Scholar]
- 27. Fowler EV, Eri R, Hume G, et al. TNFα and IL10 SNPs act together to predict disease behaviour in Crohn's disease. J Med Genet. 2005;42(6):523‐528. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Sanchez R, Levy E, Costea F, Sinnett D. IL‐10 and TNF‐alpha promoter haplotypes are associated with childhood Crohn's disease location. World J Gastroenterol. 2009;15(30):3776‐3782. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Lee YJ, Kim KM, Jang JY, Song K. Association of TNFSF15 polymorphisms in Korean children with Crohn's disease. Pediatr Int. 2015;57(6):1149‐1153. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Tables S1–S4
Data Availability Statement
The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.