Anti-GRP-R monoclonal antibody antitumor therapy against neuroblastoma

Jingbo Qiao; Junquan Liu; Jillian C Jacobson; Rachael A Clark; Sora Lee; Li Liu; Zhiqiang An; Ningyan Zhang; Dai H Chung

doi:10.1371/journal.pone.0277956

. 2022 Dec 16;17(12):e0277956. doi: 10.1371/journal.pone.0277956

Anti-GRP-R monoclonal antibody antitumor therapy against neuroblastoma

Jingbo Qiao ¹, Junquan Liu ², Jillian C Jacobson ¹, Rachael A Clark ¹, Sora Lee ¹, Li Liu ³, Zhiqiang An ², Ningyan Zhang ², Dai H Chung ^1,^4,^*

Editor: Salvatore V Pizzo⁵

PMCID: PMC9757561 PMID: 36525420

Abstract

Standard treatment for patients with high-risk neuroblastoma remains multimodal therapy including chemoradiation, surgical resection, and autologous stem cell rescue. Immunotherapy has demonstrated success in treating many types of cancers; however, its use in pediatric solid tumors has been limited by low tumor mutation burdens. Gastrin-releasing peptide receptor (GRP-R) is overexpressed in numerous malignancies, including poorly-differentiated neuroblastoma. Monoclonal antibodies (mAbs) to GRP-R have yet to be developed but could serve as a potential novel immunotherapy. This preclinical study aims to evaluate the efficacy of a novel GRP-R mAb immunotherapy against neuroblastoma. We established four candidate anti-GRP-R mAbs by screening a single-chain variable fragment (scFv) library. GRP-R mAb-1 demonstrated the highest efficacy with the lowest EC₅₀ at 4.607 ng/ml against GRP-R expressing neuroblastoma cells, blocked the GRP-ligand activation of GRP-R and its downstream PI3K/AKT signaling. This resulted in functional inhibition of cell proliferation and anchorage-independent growth, indicating that mAb-1 has an antagonist inhibitory role on GRP-R. To examine the antibody-dependent cellular cytotoxicity (ADCC) of GRP-R mAb-1 on neuroblastoma, we co-cultured neuroblastoma cells with natural killer (NK) cells versus GRP-R mAb-1 treatment alone. GRP-R mAb-1 mediated ADCC effects on neuroblastoma cells and induced release of IFNγ by NK cells under co-culture conditions in vitro. The cytotoxic effects of mAb-1 were confirmed with the secretion of cytotoxic granzyme B from NK cells and the reduction of mitotic tumor cells in vivo using a murine tumor xenograft model. In summary, GRP-R mAb-1 demonstrated efficacious anti-tumor effects on neuroblastoma cells in preclinical models. Importantly, GRP-R mAb-1 may be an efficacious, novel immunotherapy in the treatment of high-risk neuroblastoma patients.

Introduction

Neuroblastoma is the most common extracranial solid tumor of early childhood [1, 2]. High-risk neuroblastoma is designated based on the demonstration of clinically advanced stage or the presence of metastasis, age greater than 18 months at diagnosis, MYCN oncogene amplification, histology, and/or chromosomal ploidy [3]. The current standard therapy for high-risk neuroblastoma includes multi-agent chemotherapy induction and surgical resection of the primary tumor, consolidation chemotherapy, autologous stem cell rescue, and radiation therapy followed by treatment with anti-ganglioside-2 (GD2) immunotherapy, cytokines, and cis-retinoic acid [4]. High-risk group of neuroblastoma accounts for approximately 15% of cancer-related mortality in children with a five-year survival rate of less than 40% [1]. Therefore, there is an unmet need for a more effective novel treatment strategy against this deadly pediatric cancer.

Immunotherapy has proven successful in treating both adult and pediatric cancers [5–11]. Many pediatric solid tumors, including neuroblastoma, have low tumor mutation burdens and decreased or absent surface human leukocyte antigen (HLA) expression that has traditionally rendered them immunologically “cold” [12]. In addition, intensive chemotherapy can further compromise innate and adaptive immune responses [12]. Recently, ch14.18, a monoclonal antibody (mAb) targeting GD2, a ganglioside expressed on neurons, melanocytes, and peripheral nerve fibers, has demonstrated success in clinical treatment by prolonging survival [13–15]. Recent clinical trials have demonstrated improved outcomes with ch14.18 treatment, in combination with interleukin (IL)-2, with or without granulocyte macrophage colony stimulating factor (GM-CSF), and isotretinoin [13, 16]. Furthermore, inhibition of programmed cell death protein 1 (PD-1) has been found to augment the ch14.18-induced immune response against neuroblastoma [17]. Moreover, combination treatment with the anti-GD2 mAb, dinutuximab, has been found to prolong survival in in vivo mouse models [18]. Monoclonal antibody-based immunotherapy is an important strategy for targeted cancer therapy and recent studies suggest that the identification of additional, novel therapeutic targets may improve treatment outcomes for children with neuroblastoma [5, 9, 19].

Gastrin-releasing peptide receptor (GRP-R) is a G protein-coupled receptor (GPCR) that is overexpressed on the membranes of dysplastic cells in numerous cancers, including neuroblastoma [20, 21]. GPCRs, such as GRP-R, possess seven transmembrane domains and four extracellular domains which facilitate key roles in numerous biologic processes including inflammation and cancer. We have previously demonstrated that GRP-R is upregulated in poorly-differentiated neuroblastoma, promoting oncogenesis via activation of the PI3K/AKT signaling pathway, and plays an important role in the stabilization of the oncoprotein N-myc [22, 23]. N-myc has been shown to contribute to the tumor immunosuppressive environment and cancer immune escape in neuroblastoma [24]. Overexpression of GRP-R has been shown to enhance the stability of the oncoprotein N-myc, whereas knockdown of GRP-R destabilized N-myc in MYCN-amplified neuroblastoma cells [25]. Silencing of GRP-R also decreased the activation of AKT2 in the PI3K/AKT pathway, thereby inhibiting mTOR and contributing to the induction of autophagy and decreased tumor growth [26]. Interference of GRP/GRP-R-induced signaling has also been shown to inhibit vascular endothelial growth factor (VEGF)-dependent tumor angiogenesis [27]. In addition to these findings, the location of GRP-R on the tumor cell membrane suggests GRP-R would be an ideal and accessible target for a novel anti-cancer therapy. Furthermore, its extracellular domains (one N-terminus and three extracellular loops) could serve as epitope targets for antibodies, making GRP-R an ideal immune recognition molecule. Hence, we hypothesized that GRP-R could serve as a novel immunotherapeutic target and we sought to evaluate whether GRP-R mAbs could efficaciously inhibit tumorigenesis and metastasis, as well as eliminate residual tumors in high-risk neuroblastoma using in vitro and in vivo neuroblastoma tumor models.

Materials and methods

Antibodies and reagents

Humanized antitumor GRP-R mAb production and initial evaluation were completed by Dr. Ningyan Zhang’s group at the University of Texas Health Science Center at Houston. Isotype control antibody (N1-25) is an in-house evaluated monoclonal antibody [28]. GRP-R polyclonal antibody was purchased from Abcam (ab39963, Cambridge, MA). The four peptides of the GRP-R extracellular domains were synthesized with a biotin-tag at the N-terminus by GenScript Biotech (Piscataway, NJ).

Primary antibodies against pAKT (ser473, #9271), AKT (#4685), pH3 (ser10, #3377), Granzyme B (#46890), and pStat1 (Y701, #9171) were purchased from Cell Signaling Technology (Danvers, MA). The primary antibodies of β-actin and GAPDH were from Sigma-Aldrich (St. Louis, MO). Secondary goat anti-human IgG antibody was purchased from Invitrogen (# A18811). Secondary goat anti-mouse and anti-rabbit antibodies were obtained from Santa Cruz Biotechnology, Inc (Santa Cruz, CA). Antibody of PD-L1 (#329702) and IFNγ were purchased from BioLegend (San Diego, CA). Bombesin (BBS) was purchased from Tocris Bioscience (Minneapolis, MN). Human IL-2 was purchased from Pepro Tech (Cranbury, NJ). IFNγ DuoSet ELISA kit was purchased from R&D Systems (Minneapolis, MN). Flu-4 Direct^™ Calcium Assay Kit was from Invitrogen (Eugene, OR).

Cell lines and culture

The human neuroblastoma cell lines BE(2)-C, SK-N-AS, SH-SY5Y, SHEP, SK-N-DZ, and LAN-1 were purchased from the American Type Culture Collection (Manassas, VA). Cells were maintained in Rockwell Park Memorial Institute (RPMI) culture medium 1640 with 10% fetal bovine serum at 37°C in a humidified atmosphere consisting of 5% CO2 and 95% air. Our laboratory previously established the stable luciferase-expressing neuroblastoma cell lines, BE(2)-C/Luc and SK-N-AS/Luc, which were selected and cultured in zeocin (50 μg/ml) contained medium. BE(2)-C/shCON, which functioned as a control and GRP-R shRNA knock-down cells (shGRP-R) were both established previously [26]. Natural killer (NK) cells were purchased from Lonza, cultured in Lymphocyte Growth Media-3 (LGM-3, Lonza), and stimulated by IL-2 (100 U/ml) supplemented in the media. NK cell purity was confirmed with flow cytometry by staining for CD3^-CD56⁺. These activated NK cells were then used for GRP-R mAb-mediated antibody-dependent cellular cytotoxicity (ADCC) assays.

Phage library panning and antibody expression

The processes of phage library panning and antibody expression were previously reported [28]. In this study, a mixture of four peptides of GRP-R extracellular domains was used for panning. Briefly, the antigen peptides were coated on a MaxiSorp immune tube overnight and blocked with 5% milk. Then the pre-blocked phage library was incubated with the coated antigen for two hours, and the phage binders were eluted with triethylamine. The antigen-bound phages were screened using enzyme-linked immunosorbent assay (ELISA) and detected using HRP-conjugated mouse-anti-M13 antibody (Santa Cruz, sc-53004). The positive phage clones were constructed into full IgG1 heavy and light chain backbones in a mammalian expression vector for expression in HEK293 cells as we previously reported [28]. IgG antibodies were purified from HEK293 expression culture supernatants using Protein A affinity resin.

Enzyme-linked immunosorbent assay

A high binding Corning 96-well plate was coated with 5 μg/mL of streptavidin (SA) overnight at 4°C. After SA was aspirated, 100 μL of GRP-R-E1 (5 μg/mL) was added and incubated at room temperature (RT) for one hour. The wells were washed with PBST three times and 100 μL of three-fold serial diluted antibodies were added and the wash was repeated after one hour. Then the anti-human IgG Fab2 HRP-conjugated antibody was diluted 1:5000 and added for incubation at RT for one hour. Following the washing step, TMB substrate was added and incubated for approximately 8 minutes at RT. The reaction was stopped with 50 μL of 1 M H₂SO₄ and the OD450 nm was read using a spectrophotometer (Molecular Devices). EC₅₀ values were estimated using a three-parameter nonlinear fitting model using GraphPad Prizm, v8.1.

Affinity measurement with biolayer interferometry

The affinity of antibodies was measured by 8-channel Octet RED96 system (ForteBio). The SA sensors were saturated with 100 nM of GRP-R antigen and followed by incubation in kinetics buffer. Then the loaded sensors were exposed to antibodies in a series of three-fold titrations. The kinetic buffer without antibody was used as correction. The KD values were obtained by fitting the data to a 1:1 binding model.

Cytotoxicity assay and IFNγ releasing measurement

Luciferase-expressing BE(2)-C/Luc and SK-N-AS/Luc cells were plated onto a 96-well white plate (Falcon #353296) at 3,000 and 6,000 cells/well, respectively, for culturing overnight. Then, GRP-R mAb-1 at 2 μg/ml alone, NK cells alone, or GRP-R mAb-1 at 2 μg/ml combined with NK cells, were added to the cultured cells. The ratio of effector cells (NK cells) to target cells (BE(2)-C/Luc) was 2:1. The cells were incubated at 37°C in a humidified atmosphere of 5% CO₂ for 4 hours. Luciferin was added to the cell culture medium at a final concentration of 150 ng/ml for 5 minutes. The luminescent signal was then read using the Cytation 5 Cell Imaging Multi-Mode reader (BioTek, Winooski, VT). The cultured medium in the above setup was collected for detection of IFNγ secretion via NK cells using the DuoSet ELISA Development System (IFNγ: DY285, R&D Systems, Minneapolis, MN) according to the manufacturer’s protocol.

Flow cytometry

GRP-R mAb binding affinity was evaluated by flow cytometry. BE(2)-C/shCON and shGRP-R cells were detached using cell dissociation buffer (Gibco #13151014). After washing them with 1% bovine serum albumin (BSA) in PBS, cells were incubated with primary antibody for 60 minutes at 4°C. After washing with 1% BSA in PBS, cells were incubated with Alexa Fluor 488 –tagged secondary antibody for 30 minutes at 4°C. Human IgG1 non-binder antibody was used for isotype binding control. PD-L1 membrane expression was evaluated by staining cells with primary PD-L1 antibody (Biolegends, #329702), followed by anti-mouse Alexa Fluor 594 conjugated secondary antibody staining. Stained cells were analyzed with the flow cytometer (BD Accuri C6+, BD Biosciences, Franklin Lakes, NJ).

Cell growth and anchorage-independent growth assay

Neuroblastoma cells were plated onto 96-well plates at 3,000–6,000 cells/well for overnight. GRP-R mAbs-1 was added to the culture media at various concentrations for 72 hours. The cell growth rate was measured using the Cell Counting Kit-8 (Dojindo Molecular Technologies, Inc, Rockville, MD). For the anchorage-independent growth assay, cells were trypsinized and resuspended in RPMI medium 1640 containing 0.4% agarose and 5% FBS. BE(2)-C cells were overlaid onto a bottom layer of solidified 0.8% agarose in RPMI medium 1640 containing 5% FBS and incubated for 2 weeks. Colonies were formed in the soft agar and stained with 0.05% crystal violet, photographed, and quantified.

Immunoblotting

Cells were collected using cell lysis buffer and denatured protein samples were prepared for immunoblotting. Equal amounts of protein were loaded and separated by NuPAGE 4–12% Bis-Tris gel, followed by transfer onto PVDF membranes (Bio-Rad, Hercules, CA, USA). Membranes were blocked with 5% nonfat milk in TBS-T for 1 hour at room temperature. The blots were then incubated with antibodies against the human target proteins by using rabbit or mouse anti-human antibodies (1:500–2000 dilution) overnight at 4°C. Anti-rabbit or anti-mouse secondary antibodies conjugated with HRP were incubated for 1 hour and visualized using an enhanced chemiluminescence detection system (PerkinElmer, Waltham, MA, USA).

Immunohistochemistry and immunofluorescence staining

Immunohistochemical (IHC) staining was performed using DAKO EnVision+ System-HRP from Dako North America, Inc. (Carpinteria, CA). Mouse neuroblastoma xenografts were excised and fixed in 10% buffered formalin overnight and embedded in paraffin wax. Tumor sections (5 μm) were mounted on glass slides. Samples were deparaffinized and rehydrated. The antigen was retrieved using 0.01 M sodium-citrate buffer (pH 6.0) at a sub-boiling temperature for 10 minutes after boiling in a microwave oven. To block endogenous peroxidase activity, the sections were incubated with 3% hydrogen peroxide for 5 minutes. After 1 hour of pre-incubation in 5% normal goat serum to prevent nonspecific staining, the samples were incubated with the primary antibody against GRP-R or Granzyme B at 4°C overnight. They were then washed with buffer three times for 5 minutes each and incubated with secondary antibody for 30 minutes at RT. Sections were developed with the DAB reagent. The reaction was terminated by immersing slides in dH₂O, and sections were counterstained with hematoxylin. Slides were then dehydrated with ethanol and xylene. Coverslips were mounted and slides were left to dry. The IHC images were taken using a Cytation 5 Cell Imaging Multi-Mode reader. For tumor cell mitosis detection using immunofluorescence, paraffin-embedded sections were stained with anti-human phospho-Histone H3 (Ser10) antibody followed by Alexa Fluor 568 Dye (Life Technologies, Grand Island, NY). DAPI was used for staining nuclei. Images were captured using a Cytation 5 Cell Imaging Multi-Mode reader.

RNA isolation and quantitative polymerase chain reaction with RT-PCR

Total RNA was isolated and purified using a Trizol Reagent (Thermo Scientific). The High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA) was used to synthesize complementary DNA. Reverse transcription polymerase chain reaction (RT-PCR) was performed using iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA), and data were collected with a CFX96 instrument (Bio-Rad). Results were normalized to an endogenous control, glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Amplification was performed for 40 cycles of 30 seconds at 95°C, 30 seconds at 55°C, and 40 seconds at 72°C. Primers used to detect the expression of qPCR were the following: PD-L1-fw: TGGTGTAGCACTGACATTCA; PD-L1-rv: TCCAATGCTGGATTACGTCT; and GAPDH-fw: CCACTCCTCCACCTTTGAC; GAPDH-rv: ACCCTGTTGCTGTAGCCA.

Cytotoxicity assay in murine xenograft model

All studies were approved by the Institutional Animal Care and Use Committee (IACUC) at UT Southwestern Medical Center. All animals were maintained in a pathogen-free environment at Animal Resource Center facility of UT Southwestern Medical Center. BE(2)-C/Luc human neuroblastoma cells at 1 x 10⁶ cells/100 ul of HBSS medium were injected subcutaneously into the flanks of 4–6 week old male athymic nude mice for tumor formation. When subcutaneous tumors formed and were visible at a diameter of approximately 7 mm, the mice were randomized to four treatment groups: IgG (4 mg/kg), GRP-R mAb (4 mg/kg), IgG plus NK cells (0.1 million), or GRP-R mAb plus NK cells (0.1 million). Mice were treated twice per week for three weeks. Mice were monitored daily for xenograft formation, stress or suffering. Tumor growth was assessed by measuring the two greatest perpendicular tumor diameters with vernier digital calipers (Neiko Tools USA). Xenograft volumes were estimated using the following formula: [(length × width²)/2]. Weight and tumor volume were recorded biweekly. Mice were euthanized four weeks after injection when they met institutional euthanasia criteria for tumor volume greater than 2000 mm³, 20% loss of body weight, and ulceration or severe necrosis of tumor. Mice were euthanized with CO₂ asphyxiation followed by cervical dislocation. The tumors were excised, weighed, and fixed in 10% buffered formalin. Tumor tissues were further processed for embedding in paraffin, sectioned, and stained with hematoxylin and eosin at the Molecular Pathology Core Histology Service Center at UT Southwestern Medical Center.

Statistical analysis and experimental analysis

All experiments were repeated in triplicate. The scoring index and relative expression values were expressed as mean ± SEM; statistical analyses were performed using Student’s t-test for comparisons between the groups. A p-value of < 0.05 was considered significant.

Results

GRP-R mAb production

A GRP-R mAb screen was performed as summarized in Fig 1A. Four peptides of the GRP-R extracellular domains (E1, E2, E3, and E4) with a biotin-tag at the N-terminus were synthesized and used as antigens to screen the phage library for scFv binders (Fig 1B). We initially obtained four mAbs against the extracellular domain 1 (E1) of GRP-R. These four scFvs (mAb-1, mAb-17, mAb-21, and mAb-44) were cloned into a mammalian expression vector for antibody production as previously reported [29]. The purified antibodies were electrophorized on SDS-PAGE at non-reduced (-DTT) conditions, heavy chain (55 kDa) and light chain (25 kDa) were separated at reduced conditions (+DTT) (Fig 1C). The KD values were obtained by fitting the data to a 1:1 binding model (S1 Fig). The EC₅₀ of each mAb was determined with titration ELISA (Fig 1D), and the binding specificity was confirmed (S2 Fig). Our results showed that GRP-R mAb-1 has the highest efficacy with the lowest EC₅₀ at 4.607 ng/ml and was a potential candidate for further functional studies.

Inhibitory effects of GRP-R mAb on human neuroblastoma cells

Increased GRP-R expression is associated with the aggressive phenotype of neuroblastoma [20]. Immunoblotting was used to evaluate for GRP-R expression in six human neuroblastoma cell lines. We found that GRP-R was expressed in the MYCN-amplified cell lines BE(2)-C, LAN-1 and SK-N-DZ, and the non MYCN-amplified cell lines, SHEP, SHSY5Y and SK-N-AS (Fig 2A). We examined the binding specificity of GRP-R antibodies by flow cytometry in BE(2)-C cells (shCON), as well as in GRP-R silenced BE(2)-C cells (shGRP-R) (Fig 2B). Our results showed that mAb-1, mAb-21 and mAb-44 demonstrated histogram shift in mean fluorescence intensity (MFI) between shCON and shGRP-R cells (Fig 2C), and that mAb-1 has the highest value of fluorescence intensity at 644,000 (Fig 2D). In addition, we obtained four human neuroblastoma patient-derived xenografts (PDXs) from the Children’s Oncology Group (COG) derived from patients with stage IV, high-risk disease, and stained them with GRP-R mAbs. Tissue samples stained with the secondary antibody alone were used as a negative control. Our results revealed that GRP-R mAb-1 binds to neuroblastoma PDX tissue with high specificity, as demonstrated by the positive staining of the cytoplasm membrane, with the absence of brown staining on tissues treated with the secondary antibody alone (Fig 2E). Thus, the GRP-R mAb-1 was selected for further in vitro and in vivo functional studies.

Fig 2 — (A) GRP-R expression was detected by immunoblotting in six human neuroblastoma cell lines. β-actin was used for protein loading control. (B) GRP-R knock down with shRNA was confirmed with immunoblotting. GAPDH was used for protein loading control. (C) The antibody binding assay was carried out with control cells BE(2)-C/shCON and GRP-R knockdown cells BE(2)-C/shGRP-R by flow cytometry. Total cell number 5 × 10⁵ was analyzed. Primary antibody concentration was 25 μg/ml. Secondary antibody (tagged with Alexa Fluor 488) concentration was 5 μg/ml. (D) The mean fluorescence intensity (MFI) in BE(2)-C/shCON and shGRP-R cells was quantified. (E) Immunohistochemical staining on neuroblastoma PDX tissue with GRP-R mAb-1, showed the specific staining of GRP-R on cytoplasmic membrane (dark brown on the cytoplasmic membrane, top left), and the absence of staining of negative control with secondary antibody only (top right). Exogenously expressed GRP-R-GFP was localized on cytoplasmic membrane (bottom left) and GFP alone was non-specifically distributed in cytoplasm.

GRP-R mAb-1 blocks bombesin-induced PI3K/AKT activation and inhibits cell proliferation and anchorage-independent growth

GRP, the ligand of GRP-R, functions as a mitogen to induce cell cycle progression through activation of the PI3K/AKT pathway. To examine the GRP-R mAb-1 inhibitory function on GRP/GRP-R downstream signaling and neuroblastoma tumor cell growth, we pretreated BE(2)-C/shCON and shGRP-R cells with GRP-R mAb-1 (1 μg/ml) one hour prior to bombesin (a GRP analog) treatment. As shown in Fig 3A, GRP-R mAb-1 inhibited bombesin-induced activation of PI3K/AKT, as indicated by a decreased phosphorylated AKT level. The same result was obtained using SK-N-AS cells (Fig 3B). Furthermore, GRP-R mAb-1 reduced the BBS stimulated downstream intracellular Ca²⁺ releasing signals (Fig 3C).

Fig 3 — (A) GRP-R mAb-1 inhibited BBS-mediated activation of AKT in BE(2)-C cells. The phosphorylation of AKT (S473) was detected by immunoblotting assay in BE(2)-C cells. The cells were pretreated with GRP-R mAb-1 at 1 mg/ml for 60 minutes, then treated with BBS at 100 nM for 15 minutes (left). The level of pAKT (s473) was normalized to total AKT with ImageJ (right). (B) GRP-R mAb-1 inhibited BBS-mediated activation of AKT in SK-N-AS cells. The phosphorylation of AKT (S473) was detected by immunoblotting assay in SK-N-AS cells. The cells were pretreated with GRP-R mAb or its isotype control IgG for 60 minutes, followed by BBS at 100 nM for 5–120 minutes (left). The level of pAKT (s473) was normalized to total AKT with ImageJ (right). (C) GRP-R mAb-1 reduced BBS-stimulated intracellular Ca²⁺ release signals. SK-N-AS cells were treated with BBS at 100 nM for 30 minutes. The calcium response was subsequently analyzed with Flu-4 Direct^™ Calcium Assay Kit. The green fluorescence signal indicated the released intracellular Ca²⁺ in SK-N-AS cells (left). The mean of green fluorescence intensity was quantified with Gen5 Software (right). (D) GRP-R mAb-1 inhibited neuroblastoma tumor cell growth. BE(2)-C cells were treated with GRP-R mAb-1 and cultured for 4 days. Cell growth was measured with CCK-8 kit. (E) GRP-R mAb-1 decreased the capability of anchorage-independent in BE(2)-C cells. The cells were cultured in soft agar with or without GRP-R mAb-1 (1 μg/ml) for 2 weeks. Data represent mean ± STDEV; * = p<0.05 vs. CON.

In order to assess the effects of GRP-R mAb-1 on cellular proliferation BE(2)-C cells were treated with GRP-R mAb-1 at increasing doses and cultured for 4 days. Cellular proliferation decreased by 30–43% compared to control cells in a dose-dependent manner (Fig 3D). As shown in Fig 3E, an anchorage-independent colony growth assay demonstrated that co-incubation of neuroblastoma cells with GRP-R mAb-1 significantly decreased the colony number by 39% in control cells (pCMV) and 50% in GRP-R overexpression cells (pCMV-GRPR). Taken together, these findings demonstrate that GRP-R mAb-1 has an antagonist role by blocking bombesin-stimulated GRP-R activation, in addition to inhibiting cellular proliferation and anchorage-independent growth.

GRP-R mAb mediates ADCC on GRP-R expressing neuroblastoma cells and induces IFNγ secretion from NK cells

Antibody therapy has therapeutic advantages over small molecule inhibitors. Antibody-dependent cellular cytotoxicity (ADCC) is one of the most important mechanisms behind the anti-tumor effect of mAbs. To evaluate the specific killing of tumor cells, a modified bioluminescence-based cytotoxicity assay was used instead of a standard chromium release assay. We previously established the stable luciferase-expressing neuroblastoma cell lines, BE(2)-C/Luc and SK-N-AS/Luc, which have been used to monitor tumor growth and metastasis using in vivo models [30, 31]. We treated BE(2)-C/Luc and SK-N-AS/Luc cells with GRP-R mAb-1 at 2 μg/ml alone, NK cells alone, or GRP-R mAb-1 at 2 μg/ml combined with NK cells. Our results showed that adding NK cells alone (at a ratio of 2:1 effector NK cells to target BE(2)-C/Luc) caused cell death to 58.96% of BE(2)-C/Luc cells. The addition of GRP-R mAb-1 (2 μg/ml) significantly increased cell death to 73.19% within 4 hours (Fig 4A, left panel). Representative cell images of the ADCC assay are shown in Fig 4A, right panel. In addition, we obtained similar results using the cell line SK-N-AS/Luc in an ADCC assay (Fig 4B). Our results indicate that ADCC contributes to the antitumor action of GRP-R mAb through NK cells. Interestingly, we found that the number of surviving tumor cells was slightly increased after 24 hours, compared to 4 hours post co-culture with GRP-R mAb-1 and NK cells, and the efficiency of ADCC was increased at a higher ratio (5:1) of effector NK cells to target BE(2)-C/Luc (Fig 4C). Our results indicate that the action of ADCC was inhibited after some time.

Fig 4 — (A) BE(2)-C/Luc as target cells were co-cultured with effector NK cells (E:T at 2:1) with or without GRP-R mAb-1 at 2 μg/ml for 4 hours. The percent of lysed cells was calculated by measuring the luciferase activity of survived cells in control samples and treated samples (Left). The typical cell images were taken under microscope, showing the integral and killed cells (right). (B) ADCC assay in SK-N-AS cells. SK-N-AS/Luc as target cells were co-cultured with effector NK cells (E:T at 2:1) with or without GRP-R mAb-1 at 2 μg/ml for 4 hours (Left). The typical cell images were taken using microscopy, showing the integral and killed cells (right). (C) ADCC assay in BE(2)-C cells. The cells were co-cultured with effector NK cells with or without GRP-R mAb-1 at 2 μg/ml for 24 hours. (D) The secretion of IFNγ in the co-culture media was measured with ELISA kit. BE(2)-C cells were co-cultured with NK cells (E:T at 2:1) with or without GRP-R mAb-1 (2 μg/ml) for 24 hours. Data represent mean ± STDEV; * = p<0.05 vs. CON.

Cytokine IFNγ is one of the key factors secreted by immune cells, such as NK cells and T cells, in the tumor microenvironment [32]. Therefore, we examined the effects of IFNγ secretion in the supernatant of co-cultured BE(2)-C and NK cells, with or without GRP-R mAb-1 (2 μg/ml). Our results showed that IFNγ was detected in the supernatant of the co-culture after 24 hours, and GRP-R mAb-1 increased the secretion of IFNγ approximately 1.6-fold from 4.4 pg/ml to 7.2 pg/ml (Fig 4D).

Immune checkpoint protein PD-L1 expression in neuroblastoma cells

In the tumor microenvironment, IFNγ can induce tumor cells to express PD-L1 and PD-L2, which subsequently interact with their receptor PD-1 on immune cells, inducing apoptosis of PD-1 positive immune cells, leading to immune suppression and evasion [33]. We treated BE(2)-C and SK-N-AS cells with IFNγ at 10 ng/ml for 24 hours and found that IFNγ induced the expression of PD-L1 in both cell lines showed with histogram shift by flow cytometry analysis and fluorescent microscopy images (Fig 5A). IFNγ increased the transcriptional level of both PD-L1 and PD-L2 in BE(2)-C cells, PD-L1 expression was increased 14-fold, whereas PD-L2 expression was only increased 1.6-fold, as measured by qRT-PCR (S3 Fig).

Fig 5 — (A) PD-L1 expression on the surface of BE(2)-C and SK-N-AS cells was analyzed by flow cytometry (top) and fluorescent microscopy (bottom). Cells were treated with IFNγ (10 ng/ml) for 24 hours. (B) The total expression of PD-L1 was detected in six human neuroblastoma cell lines by immunoblotting analysis. The cells were treated with IFNγ at 0, 1, or 10 ng/ml for 24 hours. Total cell lysates were used in immunoblotting assay. β-actin was used for protein loading control. (C) The mRNA level of PD-L1 was measured by qRT-PCR and normalized to GAPDH in six human neuroblastoma cell lines. All cells were treated with IFNγ at 0, 1, or 10 ng/ml for 24 hours. (D) Phosphorylated Stat1 was measured in six neuroblastoma cell lines. All cells were treated with IFNγ at 0, 1, 10 ng/ml for 24 hours. The levels of phospho-Stat1 and GRP-R were detected with immunoblotting. β-actin was used for protein loading control.

We then examined the expression of PD-L1 in six neuroblastoma cell lines and found that the expression of PD-L1 was induced by IFNγ in a dose-dependent response in the levels of both protein (Fig 5B) and mRNA (Fig 5C), in all except SH-SY5Y cell line. The expression of PD-L2, however, demonstrated no change or a weak increase in expression in response to IFNγ treatment (S4 Fig), consistent with previous studies [34].

The activation of Stat1 upregulates the expression of PD-L1 and PD-L2 in gastric cancer [35]. In order to confirm that IFNγ induced PD-L1 via Stat1, we treated six neuroblastoma cell lines with IFNγ at two doses (1 and 10 ng/ml) for 24 hours. Our results showed that the phosphorylation of Stat1 increased in a dose-dependent fashion in response to IFNγ treatment in the BE(2)-C, SK-N-AS, SHEP, SK-N-DZ and LAN-1 cell lines (Fig 5D). However, the SH-SY5Y cells did not demonstrate activation of Stat1 in response to IFNγ. Our results suggest that IFNγ induces the expression of PD-L1 via activation of Stat1 in neuroblastoma.

GRP-R mAb-1 induced ADCC in mouse xenografts tumor tissue

To evaluate the antitumor function of GRP-R mAb in vivo, we examined the effects of treatment with GRP-R mAb, NK cells, or combination treatment with GRP-R mAb-1 and NK cells. First, we used the BE(2)-C cell line to establish xenografts in athymic nude mice as described previously [26]. Ten days after tumor cell injection, when subcutaneous tumors formed and were visible at a diameter of approximately 7 mm, GRP-R mAb-1 and NK cells were subsequently administrated into the subcutaneous tumors. The effect of GRP-R mAb-1 mediated ADCC was examined by performing immunohistochemical staining of granzyme B in the tumor tissue sections using anti-Granzyme B antibody. As expected, granzyme B was detected surrounding the small immune NK cells in the tumors treated with GRP-R mAb + NK, but not in the other three treatment groups (CON, mAb, and IgG+NK) (Fig 6A). The detection of cytotoxic granzyme B in only the tumor tissues treated with both GRP-R mAb and NK cells indicated that GRP-R mAb induced ADCC in tumors, consistent with our in vitro results. Furthermore, we stained tumor tissue sections with the anti-human phospho-Histone H3 (ser10) antibody followed by Alexa Fluor 568 Dye and DAPI (49,6- diamidino-2-phenylindole dihydrochloride) to stain the nuclei. Phospho-Histone H3 (Ser10) is a cell mitosis marker tightly correlated with chromosome condensation during both mitosis and meiosis [36]. As shown in Fig 6B, there were only 40% and 52.4% mitotic cells in the tumor sections treated with GRP-R mAb + NK cells and IgG + NK cells, respectively when compared to control. There was also no difference in tumors treated with GRP-R mAb alone relative to control, indicating the importance of effector cells in the tumor microenvironment on mAb-induced ADCC. Interestingly, we found that PD-L1 expression in tumor tissue sections could only be detected in cells surrounded by NK cells (Fig 6C), further suggesting that the expression of PD-L1 is dependent on the tumor microenvironment and IFNγ secreted by NK cells.

Fig 6 — (A) Granzyme B was detected by immunohistochemical staining with Granzyme B antibody in paraffin-embedded sections of BE(2)-C xenografts. (B) Immunofluorescence double staining of Phospho-Histone H3 (red) in the mitotic tumor cells and DAPI on nuclei DNA in all cells (blue) was performed in paraffin-embedded sections of tumor xenografts (left). Mitotic cells were quantified by counting positive immunofluorescent stained phospho-Histone H3 (ser10) cells (right). (C) Immunofluorescence triple staining of PD-L1 on the membrane of tumor cells (red) and CD16-FITC on NK cells (green) in tumor tissue sections. DAPI was used for counterstaining nuclei DNA in all cells. Scale bar: 100 mm. Data represent mean ± STDEV; * = p<0.05 vs. CON.

Discussion

Neuroblastoma has traditionally been considered an immunologically “cold” tumor, however, the recent success of mAb ch14.18 in clinical treatment has provided invaluable information regarding augmentation of the immune response and limiting immune escape in neuroblastoma [16]. Despite these recent research advances, high-risk neuroblastoma remains difficult to treat, necessitating the development of novel treatment strategies. Herein, we demonstrate a novel treatment strategy using GRP-R mAb against neuroblastoma.

The overexpression of GRP-R on the cellular membrane of neuroblastoma cells and its role in the modulation of the PI3K/AKT pathway make it an ideal target for novel anti-cancer therapies. GRP-R is a GPCR with seven transmembrane and four extracellular domains. These extracellular domains have the potential to serve as epitopes for antibodies (44). GRP-R-based pharmaceuticals and specific radioactive, cytotoxic, and nonradioactive GRP-analogs have been designed and tested in various animal tumor models with the aim of receptor targeting for tumor diagnosis or anti-cancer therapy [20, 37–41]. However, despite the fact that approximately 30–50% of marketed drugs target a GPCR, mAbs to GPCRs have yet to be approved for clinical use by the FDA [42]. Although small molecule drugs targeting GPCRs have been developed and preclinically tested, antibody therapy has therapeutic advantages over small molecules such as reduced dosing and peripheral restriction [43]. Several mAbs against different GPCRs are currently undergoing testing in phase I and phase II trials involved in cancer and inflammation [42]. Together, these findings support the use of a GRP-R mAb as a potentially novel immunotherapy against neuroblastoma. In the present study, GRP-R mAbs were identified and found to specifically bind to neuroblastoma tissue, inhibit PI3K/AKT activation, and inhibit cell proliferation and anchorage-independent growth. In addition, GRP-R mAb induced mAb-mediated ADCC and, in combination treatment with NK cells, successfully inhibited tumor growth in vivo.

In order to create mAb to GRP-R, a phage library was screened for scFv binders and four mAbs against GRP-R extracellular domain 1 (E1) were identified. GRP-R mAb-1 demonstrated the highest affinity at the lowest EC₅₀ and was used for further testing. Our results demonstrated GRP-R mAb-1-specific binding to neuroblastoma PDX tissue. Further, we found that treatment with GRP-R mAb-1 inhibits activation of PI3K/AKT, cellular proliferation and anchorage-independent growth. These findings are in line with findings from our previous study which demonstrated decreased tumor growth and inhibition of the PI3K/AKT pathway with GRP-R silencing [26]. Our results demonstrate that anti-GRP-R mAb effectively and significantly inhibits neuroblastoma tumorigenesis in preclinical testing.

The cytotoxic effects of mAb are enhanced by the effector cells, such as NK cells, of the tumor microenvironment [44]. Therefore, we sought to evaluate the effects of GRP-R mAb-1 treatment on the tumor microenvironment. Combination treatment with GRP-R mAb-1 and NK effector cells in a 2:1 ratio significantly induced ADCC in both BE(2)-C and SK-N-AS cell lines. Adding NK cells with anti-GRP-R mAb treatment significantly enhanced cell death when compared to anti-GRP-R mAb treatment alone. However, we found that GRP-R mAb-mediated induction of ADCC was inhibited at 24 hours compared to 4 hours, suggesting the actions of ADCC can be inhibited over time due to NK cell dysfunction [45].

PD-L1 is one of the immune checkpoint proteins that is regulated by IFNγ via JAK/STAT pathway [35]. In order to evaluate the potential role of immune checkpoint pathways in the reduction of ADCC over time, the effects of IFNγ treatment on PD-L1 and PD-L2 expression as well as Stat1 activation in neuroblastoma cells was evaluated. Treatment with IFNγ increased the activation of Stat1, a key upstream regulator of PD-L1, as well as the PD-L1 in a dose-dependent manner. PD-L2 expression did not respond the same as PD-L1, suggesting combination treatment with GRP-R mAb-1 induces ADCC and the secretion of IFNγ. Given findings of the effects of GRP-R mAb-1 + NK cell treatment in vitro, the effects of combination treatment on tumor growth in vivo were evaluated using an animal tumor model. Treatment with GRP-R mAb-1 in combination with NK cells significantly induced cell death in tumor tissues, however treatment with GRP-R mAb-1 alone did not impair tumor growth.

The positive association between PD-L1 expression and tumor aggressiveness has been demonstrated in numerous cancers including osteosarcoma, breast cancer, ovarian cancer, extrahepatic cholangiocarcinoma, and melanoma [46, 47]. However, these reports can be conflicting. Hamanishi et al suggested that PD-L1 may directly suppress antitumor CD8-positive T cells in ovarian cancer, making the PD-1/PD-L1 pathway an important target for restoring antitumor immunity [46]. Findings in the present study suggest that the varying PD-L1 expression, the effectiveness of current immunotherapies, and the overall clinical outcomes may be tumor microenvironment dependent. Together, these findings suggest that the modulation of the tumor microenvironment and immune checkpoint pathways are vital in preventing immune escape, enhancing cytotoxicity against tumor cells, and limiting tumorigenesis.

Despite the success of GRP-R mAb treatment in combination with NK cells in vivo and in vitro, further studies are needed to assess the safety and efficacy of GRP-R mAb-1 + NK cells in the clinical setting. There have been several studies evaluating the role of anti-GD2 mAb in combination with NK cells. Tran et al found that concurrent treatment with NK cells increased the efficacy of dinutuximab preclinically [48]. Clinical trials evaluating combination anti-GD2 treatment with NK cells have also shown antitumor activity [49, 50]. The success of treatment with anti-GD2 mAb in combination with NK cells in previous studies suggests GRP-R mAb is a potentially novel immunotherapeutic treatment against neuroblastoma that would benefit from clinical testing.

There are several limitations to the present study including the pre-clinical nature of the study. In addition, the significant heterogeneity of neuroblastoma has previously been reported by others [51]. To help mitigate the effects of this heterogeneity, both MYCN and non-MYCN-amplifying cell lines were used throughout the study in both in vitro and in vivo experiments to allow for a broader application of our findings. Future directions, however, include clinical trials to establish the safety and effectiveness of GRP-R mAbs for the treatment of neuroblastoma. In this study, four mAbs were obtained against E1 of GRP-R. Future studies would also allow for the production and evaluation of mAbs against GRP-R’s three remaining extracellular domains. Our results contribute to previous studies demonstrating the significant impact of the tumor microenvironment on prognosis, the effectiveness of therapies, and clinical outcomes. Further research should be directed to expanding our knowledge of the neuroblastoma tumor microenvironment and ways to effectively modify it to enhance the treatment effect.

Another limitation of anti-GRP-R treatment is that it is not a targetable mutation, rather GRP-R is ubiquitously expressed with physiologic functions. However, GRP-R has been shown to be upregulated in neuroblastoma. In addition, clinical studies have demonstrated success with radioactive GRP-analogs and GRP-R antagonists for both diagnostic tumor imaging and radiotherapy of GRP-R-overexpressing cancers [37, 39–41].

The anti-GRP-R mAb is a potential novel anti-cancer immunotherapy that effectively inhibits neuroblastoma tumorigenesis via modulation of the PI3K/AKT pathway and induction of ADCC. Despite continued research advances, high-risk neuroblastoma remains difficult to treat. However, GRP-R mAbs have the potential to improve survival outcomes for patients with neuroblastoma through the use of a novel immunotherapeutic strategy while mitigating the morbidity of traditional anti-cancer treatments. Furthermore, combination treatment with blockade of the PD-L1/PD-1 immune checkpoint may sustain the activity of effector NK cells and enhance GRP-R mAb-mediated ADCC on neuroblastoma tumor cells.

Supporting information

S1 Fig. Determination of the binding affinity of GRP-R mAbs.

The K_D value of GRP-R mAbs was measured using the 8-channel Octet RED96 system. The kinetic buffer without antibody was used as correction. The KD values were obtained by fitting the data to a 1:1 binding model.

(TIF)

Click here for additional data file.^{(712.4KB, tif)}

S2 Fig. The specificity binding analysis of GRP-R mAbs.

GRP-R mAbs cross binding test using ELISA coated with four different GRP-R extracellular domains E1, E2, E3, and E4. GRP-R mAb-1, mAb-17, and mAb-21 have no cross binding with GRP-R extracellular domain E2, E3, and E4.

(TIF)

Click here for additional data file.^{(536.3KB, tif)}

S3 Fig. Immune checkpoint PD-L1 and PD-L2 expression in neuroblastoma BE(2)-C cells.

The mRNA level of PD-L1 and PD-L2 was measured by qRT-PCR and normalized to GAPDH in BE(2)-C cells treated with IFNγ at 10 ng/ml for 24 hours.

(TIF)

Click here for additional data file.^{(518.9KB, tif)}

S4 Fig. Immune checkpoint PD-L2 expression in neuroblastoma cells.

The mRNA level of PD-L2 was measured by qRT-PCR and normalized to GAPDH in five human neuroblastoma cell lines. All cells were treated with IFNγ at 0, 1, or 10 ng/ml for 24 hours.

(TIF)

Click here for additional data file.^{(599KB, tif)}

S1 Raw images

(PDF)

Click here for additional data file.^{(7.6MB, pdf)}

Data Availability

All relevant data are within the paper and its Supporting information files.

Funding Statement

This work was supported by a grant from the National Institutes of Health (R01 DK61470). This work was supported in part by the Welch Foundation grant AU-0042-20030616 (ZA), and Cancer Prevention and Research Institute of Texas (CPRIT) Grants RP150230, RP150551, and RP190561 (ZA). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Maris JM, Hogarty MD, Bagatell R, et al. Neuroblastoma. Lancet. 2007;369(9579):2106–20. doi: 10.1016/S0140-6736(07)60983-0 [DOI] [PubMed] [Google Scholar]
2.Brodeur GM. Neuroblastoma: biological insights into a clinical enigma. Nature reviews cancer. 2003;3(3):203–16. doi: 10.1038/nrc1014 [DOI] [PubMed] [Google Scholar]
3.Hoehner JC, Gestblom C, Hedborg F, et al. A developmental model of neuroblastoma: differentiating stroma-poor tumors’ progress along an extra-adrenal chromaffin lineage. Lab Invest. 1996;75(5):659–75. [PubMed] [Google Scholar]
4.Ryan AL, Akinkuotu A, Pierro A, et al. The Role of Surgery in High-risk Neuroblastoma. J Pediatr Hematol Oncol. 2020;42(1):1–7. doi: 10.1097/MPH.0000000000001607 [DOI] [PubMed] [Google Scholar]
5.Weiner LM, Surana R, Wang S. Monoclonal antibodies: versatile platforms for cancer immunotherapy. Nat Rev Immunol. 2010;10(5):317–27. doi: 10.1038/nri2744 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Waldmann TA. Immunotherapy: past, present and future. Nat Med. 2003;9(3):269–77. doi: 10.1038/nm0303-269 [DOI] [PubMed] [Google Scholar]
7.Scott AM, Wolchok JD, Old LJ. Antibody therapy of cancer. Nat Rev Cancer. 2012;12(4):278–87. doi: 10.1038/nrc3236 [DOI] [PubMed] [Google Scholar]
8.Seeger RC. Immunology and immunotherapy of neuroblastoma. Semin Cancer Biol. 2011;21(4):229–37. doi: 10.1016/j.semcancer.2011.09.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Furman WL. Monoclonal Antibody Therapies for High Risk Neuroblastoma. Biologics. 2021;15:205–19. doi: 10.2147/BTT.S267278 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Lu RM, Hwang YC, Liu IJ, et al. Development of therapeutic antibodies for the treatment of diseases. J Biomed Sci. 2020;27(1):1. doi: 10.1186/s12929-019-0592-z [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Morandi F, Sabatini F, Podesta M, et al. Immunotherapeutic Strategies for Neuroblastoma: Present, Past and Future. Vaccines (Basel). 2021;9(1). doi: 10.3390/vaccines9010043 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Park JA, Cheung NV. Targets and Antibody Formats for Immunotherapy of Neuroblastoma. J Clin Oncol. 2020;38(16):1836–48. doi: 10.1200/JCO.19.01410 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Yu AL, Gilman AL, Ozkaynak MF, et al. Anti-GD2 antibody with GM-CSF, interleukin-2, and isotretinoin for neuroblastoma. N Engl J Med. 2010;363(14):1324–34. doi: 10.1056/NEJMoa0911123 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Sait S, Modak S. Anti-GD2 immunotherapy for neuroblastoma. Expert Rev Anticancer Ther. 2017;17(10):889–904. doi: 10.1080/14737140.2017.1364995 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Voeller J, Sondel PM. Advances in Anti-GD2 Immunotherapy for Treatment of High-risk Neuroblastoma. J Pediatr Hematol Oncol. 2019;41(3):163–9. doi: 10.1097/MPH.0000000000001369 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Ladenstein R, Potschger U, Valteau-Couanet D, et al. Interleukin 2 with anti-GD2 antibody ch14.18/CHO (dinutuximab beta) in patients with high-risk neuroblastoma (HR-NBL1/SIOPEN): a multicentre, randomised, phase 3 trial. Lancet Oncol. 2018;19(12):1617–29. doi: 10.1016/S1470-2045(18)30578-3 [DOI] [PubMed] [Google Scholar]
17.Siebert N, Zumpe M, Juttner M, et al. PD-1 blockade augments anti-neuroblastoma immune response induced by anti-GD2 antibody ch14.18/CHO. Oncoimmunology. 2017;6(10):e1343775. doi: 10.1080/2162402X.2017.1343775 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Chu Y, Nayyar G, Jiang S, et al. Combinatorial immunotherapy of N-803 (IL-15 superagonist) and dinutuximab with ex vivo expanded natural killer cells significantly enhances in vitro cytotoxicity against GD2(+) pediatric solid tumors and in vivo survival of xenografted immunodeficient NSG mice. J Immunother Cancer. 2021;9(7). doi: 10.1136/jitc-2020-002267 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Zahavi D, Weiner L. Monoclonal Antibodies in Cancer Therapy. Antibodies (Basel). 2020;9(3). doi: 10.3390/antib9030034 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Cornelio DB, Roesler R, Schwartsmann G. Gastrin-releasing peptide receptor as a molecular target in experimental anticancer therapy. Ann Oncol. 2007;18(9):1457–66. doi: 10.1093/annonc/mdm058 [DOI] [PubMed] [Google Scholar]
21.Zhou J, Chen J, Mokotoff M, et al. Bombesin/gastrin-releasing peptide receptor: a potential target for antibody-mediated therapy of small cell lung cancer. Clin Cancer Res. 2003;9(13):4953–60. [PubMed] [Google Scholar]
22.Kim S, Hu W, Kelly DR, et al. Gastrin-releasing peptide is a growth factor for human neuroblastomas. Annals of surgery. 2002;235(5):621–9; discussion 9–30. doi: 10.1097/00000658-200205000-00003 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Ishola TA, Kang J, Qiao J, et al. Phosphatidylinositol 3-kinase regulation of gastrin-releasing peptide-induced cell cycle progression in neuroblastoma cells. Biochimica et biophysica acta. 2007;1770(6):927–32. doi: 10.1016/j.bbagen.2007.02.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Raieli S, Di Renzo D, Lampis S, et al. MYCN Drives a Tumor Immunosuppressive Environment Which Impacts Survival in Neuroblastoma. Front Oncol. 2021;11:625207. doi: 10.3389/fonc.2021.625207 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Qiao J, Lee S, Paul P, et al. Akt2 regulates metastatic potential in neuroblastoma. PloS one. 2013;8(2):e56382. doi: 10.1371/journal.pone.0056382 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Qiao J, Kang J, Ishola TA, et al. Gastrin-releasing peptide receptor silencing suppresses the tumorigenesis and metastatic potential of neuroblastoma. Proc Natl Acad Sci U S A. 2008;105(35):12891–6. doi: 10.1073/pnas.0711861105 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Kim KW, Paul P, Qiao J, et al. Enhanced autophagy blocks angiogenesis via degradation of gastrin-releasing peptide in neuroblastoma cells. Autophagy. 2013;9(10):1579–90. doi: 10.4161/auto.25987 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Ku Z, Xie X, Davidson E, et al. Molecular determinants and mechanism for antibody cocktail preventing SARS-CoV-2 escape. Nat Commun. 2021;12(1):469. doi: 10.1038/s41467-020-20789-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Meng W, Li L, Xiong W, et al. Efficient generation of monoclonal antibodies from single rhesus macaque antibody secreting cells. MAbs. 2015;7(4):707–18. doi: 10.1080/19420862.2015.1051440 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Lee S, Qiao J, Paul P, et al. FAK is a critical regulator of neuroblastoma liver metastasis. Oncotarget. 2012;3(12):1576–87. doi: 10.18632/oncotarget.732 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Paul P, Rellinger EJ, Qiao J, et al. Elevated TIMP-1 expression is associated with a prometastatic phenotype, disease relapse, and poor survival in neuroblastoma. Oncotarget. 2017;8(47):82609–20. doi: 10.18632/oncotarget.19664 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Gocher AM, Workman CJ, Vignali DAA. Interferon-gamma: teammate or opponent in the tumour microenvironment? Nat Rev Immunol. 2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Taube JM, Anders RA, Young GD, et al. Colocalization of inflammatory response with B7-h1 expression in human melanocytic lesions supports an adaptive resistance mechanism of immune escape. Sci Transl Med. 2012;4(127):127ra37. doi: 10.1126/scitranslmed.3003689 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Dondero A, Pastorino F, Della Chiesa M, et al. PD-L1 expression in metastatic neuroblastoma as an additional mechanism for limiting immune surveillance. Oncoimmunology. 2016;5(1):e1064578. doi: 10.1080/2162402X.2015.1064578 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Mimura K, Teh JL, Okayama H, et al. PD-L1 expression is mainly regulated by interferon gamma associated with JAK-STAT pathway in gastric cancer. Cancer Sci. 2018;109(1):43–53. doi: 10.1111/cas.13424 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Preuss U, Landsberg G, Scheidtmann KH. Novel mitosis-specific phosphorylation of histone H3 at Thr11 mediated by Dlk/ZIP kinase. Nucleic Acids Res. 2003;31(3):878–85. doi: 10.1093/nar/gkg176 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Maina T, Nock BA. From Bench to Bed: New Gastrin-Releasing Peptide Receptor-Directed Radioligands and Their Use in Prostate Cancer. PET Clin. 2017;12(2):205–17. doi: 10.1016/j.cpet.2016.12.002 [DOI] [PubMed] [Google Scholar]
38.Abiraj K, Mansi R, Tamma ML, et al. Bombesin antagonist-based radioligands for translational nuclear imaging of gastrin-releasing peptide receptor-positive tumors. J Nucl Med. 2011;52(12):1970–8. doi: 10.2967/jnumed.111.094375 [DOI] [PubMed] [Google Scholar]
39.Gourni E, Del Pozzo L, Kheirallah E, et al. Copper-64 Labeled Macrobicyclic Sarcophagine Coupled to a GRP Receptor Antagonist Shows Great Promise for PET Imaging of Prostate Cancer. Mol Pharm. 2015;12(8):2781–90. doi: 10.1021/mp500671j [DOI] [PubMed] [Google Scholar]
40.Mansi R, Wang X, Forrer F, et al. Development of a potent DOTA-conjugated bombesin antagonist for targeting GRPr-positive tumours. Eur J Nucl Med Mol Imaging. 2011;38(1):97–107. doi: 10.1007/s00259-010-1596-9 [DOI] [PubMed] [Google Scholar]
41.Mu L, Honer M, Becaud J, et al. In vitro and in vivo characterization of novel 18F-labeled bombesin analogues for targeting GRPR-positive tumors. Bioconjug Chem. 2010;21(10):1864–71. doi: 10.1021/bc100222u [DOI] [PubMed] [Google Scholar]
42.Jo M, Jung ST. Engineering therapeutic antibodies targeting G-protein-coupled receptors. Exp Mol Med. 2016;48:e207. doi: 10.1038/emm.2015.105 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Hutchings CJ. A review of antibody-based therapeutics targeting G protein-coupled receptors: an update. Expert Opin Biol Ther. 2020;20(8):925–35. doi: 10.1080/14712598.2020.1745770 [DOI] [PubMed] [Google Scholar]
44.Shimasaki N, Jain A, Campana D. NK cells for cancer immunotherapy. Nat Rev Drug Discov. 2020;19(3):200–18. doi: 10.1038/s41573-019-0052-1 [DOI] [PubMed] [Google Scholar]
45.Judge SJ, Murphy WJ, Canter RJ. Characterizing the Dysfunctional NK Cell: Assessing the Clinical Relevance of Exhaustion, Anergy, and Senescence. Front Cell Infect Microbiol. 2020;10:49. doi: 10.3389/fcimb.2020.00049 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Hamanishi J, Mandai M, Iwasaki M, et al. Programmed cell death 1 ligand 1 and tumor-infiltrating CD8+ T lymphocytes are prognostic factors of human ovarian cancer. Proc Natl Acad Sci U S A. 2007;104(9):3360–5. doi: 10.1073/pnas.0611533104 [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Koirala P, Roth ME, Gill J, et al. Immune infiltration and PD-L1 expression in the tumor microenvironment are prognostic in osteosarcoma. Sci Rep. 2016;6:30093. doi: 10.1038/srep30093 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Tran HC, Wan Z, Sheard MA, et al. TGFbetaR1 Blockade with Galunisertib (LY2157299) Enhances Anti-Neuroblastoma Activity of the Anti-GD2 Antibody Dinutuximab (ch14.18) with Natural Killer Cells. Clin Cancer Res. 2017;23(3):804–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Modak S, Le Luduec JB, Cheung IY, et al. Adoptive immunotherapy with haploidentical natural killer cells and Anti-GD2 monoclonal antibody m3F8 for resistant neuroblastoma: Results of a phase I study. Oncoimmunology. 2018;7(8):e1461305. doi: 10.1080/2162402X.2018.1461305 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Federico SM, McCarville MB, Shulkin BL, et al. A Pilot Trial of Humanized Anti-GD2 Monoclonal Antibody (hu14.18K322A) with Chemotherapy and Natural Killer Cells in Children with Recurrent/Refractory Neuroblastoma. Clin Cancer Res. 2017;23(21):6441–9. doi: 10.1158/1078-0432.CCR-17-0379 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Boeva V, Louis-Brennetot C, Peltier A, et al. Heterogeneity of neuroblastoma cell identity defined by transcriptional circuitries. Nat Genet. 2017;49(9):1408–13. doi: 10.1038/ng.3921 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0277956.r001

Decision Letter 0

Salvatore V Pizzo

26 Aug 2022

PONE-D-22-10312Anti-GRP-R monoclonal antibody antitumor therapy against neuroblastomaPLOS ONE

Dear Dr. Chung,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Both reviewers have raised a number of minor issues which request you consider before the manuscript is accepted for publication.

Please submit your revised manuscript by Oct 10 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Salvatore V Pizzo

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

3. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information on the animal research and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, (3) efforts to alleviate suffering, (4) tumor volume at sacrifice and (5) basic housing.

4. As part of your revision, please complete and submit a copy of the Full ARRIVE 2.0 Guidelines checklist, a document that aims to improve experimental reporting and reproducibility of animal studies for purposes of post-publication data analysis and reproducibility: https://arriveguidelines.org/sites/arrive/files/Author%20Checklist%20-%20Full.pdf (PDF). Please include your completed checklist as a Supporting Information file. Note that if your paper is accepted for publication, this checklist will be published as part of your article.

5. Thank you for stating the following financial disclosure:

Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

6. Thank you for stating the following in the Acknowledgments Section of your manuscript:

However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

7. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

8. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: 1. P 5, top: How does the statement about N-803 relate to this work?

2. P 14, middle: How many PDXs were evaluated? What was the breakdown of risk-category of the patients from which these PDXs were derived?

3. P 16, “This suggests that the immune checkpoint pathway…” What data presented demonstrates that activation of these immune checkpoint pathways suppressed the measured ADCC? If this is speculation, then this statement should be confined to the discussion.

4. P 18, bottom: Do these data that “there was no difference in tumors treated with GRP-R mAb alone” suggest the only mechanism of antitumor effects of this antibody are through ADCC? Please comment.

5. P 19, first paragraph: “highly effective treatment strategy”. Is this not somewhat of an overstatement? Please comment.

6. P 20, bottom: How did you demonstrate that the decrease in ADCC at 24 hours was a direct result of activation of the PD-1/PD-L1 pathway? Please clarify.

7. P 22, top and references 48 and 49: I agree that anti-GRP mAb would benefit from clinical testing but it is unclear to me how these two studies suggest using an anti-GRP mAb would be a “highly effective immunotherapeutic strategy”. Please comment.

8. P 23, last paragraph, also see comment #4 above: do these antibodies inhibit NB tumorigenesis? Please comment.

9. P 23, last sentence: The use of “will” seems too definitive for the data presented?

Reviewer #2: Qiao et al. established anti-GRP-R mAbs and mAb-1 blocked the GRP-ligand activation of GRP-R and the downstream signaling. Efficacious anti-tumor effects were then confirmed in vitro and in vivo. In this study, GRP-R mAb-1 can be a novel immunotherapy in the treatment of high-risk neuroblastoma patients. This manuscript can be acceptable with minor revision.

Major points

1. Current figures should be replaced with higher res ones.

2. The authors described that the affinity of antibodies was measured by Octet RED96. However, we did not find any data to support this.

Minor points

1. Consider not to use “the highest affinity” in the Abstract, detailed EC50/KD values was better. Similarly, “The cytotoxic effects of mAb-1 were confirmed in vivo using a murine tumor xenograft model”, please make a conclusion with detailed result.

2. The affinity of an antibody does not equal to EC50. It is said that “GRP-R mAb-1 has the highest affinity with the lowest EC50 at 4.607 ng/ml”, I recommend to mention something instead of it.

3. It is said that “Four peptides of the GRP-R extracellular domains (E1, E2, E3, and E4) were synthesized and used to screen the phage library for scFv binders” and only four mAbs against E1 were obtained. What’s the panning result of scFv binders against E2/E3/E4? Do the four antibodies have the cross reactivity to E2/E3/E4? And we do not see any control peptide/protein in Figure 1D.

4. Scale bar is missing in Figure 2E

5. What does abbreviation BBS stand for? It’s missing.

6. Some typos. For example, IFNg should be IFN-γ; “CD3-CD56+” , the “-” and “+” need to be superscripted; “Alex 488“ should be “Alexa Fluor 488”, et. al.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Dec 16;17(12):e0277956. doi: 10.1371/journal.pone.0277956.r002

Author response to Decision Letter 0

18 Oct 2022

We have addressed all previously raised critiques and comments in the attached revised manuscript. We hope the Editorial Board will find our revised manuscript suitable for publication in PLOS ONE.

Attachment

Submitted filename: Response to Reviewers_100722.dc edits.pdf

Click here for additional data file.^{(120.3KB, pdf)}

PLoS One. doi: 10.1371/journal.pone.0277956.r003

Decision Letter 1

Salvatore V Pizzo

8 Nov 2022

Anti-GRP-R monoclonal antibody antitumor therapy against neuroblastoma

PONE-D-22-10312R1

Dear Dr. Chung,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Salvatore V Pizzo

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

**********

PLoS One. doi: 10.1371/journal.pone.0277956.r004

Acceptance letter

Salvatore V Pizzo

8 Dec 2022

PONE-D-22-10312R1

Anti-GRP-R monoclonal antibody antitumor therapy against neuroblastoma

Dear Dr. Chung:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Salvatore V Pizzo

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Determination of the binding affinity of GRP-R mAbs.

(TIF)

Click here for additional data file.^{(712.4KB, tif)}

S2 Fig. The specificity binding analysis of GRP-R mAbs.

(TIF)

Click here for additional data file.^{(536.3KB, tif)}

S3 Fig. Immune checkpoint PD-L1 and PD-L2 expression in neuroblastoma BE(2)-C cells.

The mRNA level of PD-L1 and PD-L2 was measured by qRT-PCR and normalized to GAPDH in BE(2)-C cells treated with IFNγ at 10 ng/ml for 24 hours.

(TIF)

Click here for additional data file.^{(518.9KB, tif)}

S4 Fig. Immune checkpoint PD-L2 expression in neuroblastoma cells.

The mRNA level of PD-L2 was measured by qRT-PCR and normalized to GAPDH in five human neuroblastoma cell lines. All cells were treated with IFNγ at 0, 1, or 10 ng/ml for 24 hours.

(TIF)

Click here for additional data file.^{(599KB, tif)}

S1 Raw images

(PDF)

Click here for additional data file.^{(7.6MB, pdf)}

Attachment

Submitted filename: Response to Reviewers_100722.dc edits.pdf

Click here for additional data file.^{(120.3KB, pdf)}

Data Availability Statement

All relevant data are within the paper and its Supporting information files.

[pone.0277956.ref001] 1.Maris JM, Hogarty MD, Bagatell R, et al. Neuroblastoma. Lancet. 2007;369(9579):2106–20. doi: 10.1016/S0140-6736(07)60983-0 [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref002] 2.Brodeur GM. Neuroblastoma: biological insights into a clinical enigma. Nature reviews cancer. 2003;3(3):203–16. doi: 10.1038/nrc1014 [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref003] 3.Hoehner JC, Gestblom C, Hedborg F, et al. A developmental model of neuroblastoma: differentiating stroma-poor tumors’ progress along an extra-adrenal chromaffin lineage. Lab Invest. 1996;75(5):659–75. [PubMed] [Google Scholar]

[pone.0277956.ref004] 4.Ryan AL, Akinkuotu A, Pierro A, et al. The Role of Surgery in High-risk Neuroblastoma. J Pediatr Hematol Oncol. 2020;42(1):1–7. doi: 10.1097/MPH.0000000000001607 [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref005] 5.Weiner LM, Surana R, Wang S. Monoclonal antibodies: versatile platforms for cancer immunotherapy. Nat Rev Immunol. 2010;10(5):317–27. doi: 10.1038/nri2744 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref006] 6.Waldmann TA. Immunotherapy: past, present and future. Nat Med. 2003;9(3):269–77. doi: 10.1038/nm0303-269 [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref007] 7.Scott AM, Wolchok JD, Old LJ. Antibody therapy of cancer. Nat Rev Cancer. 2012;12(4):278–87. doi: 10.1038/nrc3236 [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref008] 8.Seeger RC. Immunology and immunotherapy of neuroblastoma. Semin Cancer Biol. 2011;21(4):229–37. doi: 10.1016/j.semcancer.2011.09.012 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref009] 9.Furman WL. Monoclonal Antibody Therapies for High Risk Neuroblastoma. Biologics. 2021;15:205–19. doi: 10.2147/BTT.S267278 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref010] 10.Lu RM, Hwang YC, Liu IJ, et al. Development of therapeutic antibodies for the treatment of diseases. J Biomed Sci. 2020;27(1):1. doi: 10.1186/s12929-019-0592-z [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref011] 11.Morandi F, Sabatini F, Podesta M, et al. Immunotherapeutic Strategies for Neuroblastoma: Present, Past and Future. Vaccines (Basel). 2021;9(1). doi: 10.3390/vaccines9010043 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref012] 12.Park JA, Cheung NV. Targets and Antibody Formats for Immunotherapy of Neuroblastoma. J Clin Oncol. 2020;38(16):1836–48. doi: 10.1200/JCO.19.01410 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref013] 13.Yu AL, Gilman AL, Ozkaynak MF, et al. Anti-GD2 antibody with GM-CSF, interleukin-2, and isotretinoin for neuroblastoma. N Engl J Med. 2010;363(14):1324–34. doi: 10.1056/NEJMoa0911123 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref014] 14.Sait S, Modak S. Anti-GD2 immunotherapy for neuroblastoma. Expert Rev Anticancer Ther. 2017;17(10):889–904. doi: 10.1080/14737140.2017.1364995 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref015] 15.Voeller J, Sondel PM. Advances in Anti-GD2 Immunotherapy for Treatment of High-risk Neuroblastoma. J Pediatr Hematol Oncol. 2019;41(3):163–9. doi: 10.1097/MPH.0000000000001369 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref016] 16.Ladenstein R, Potschger U, Valteau-Couanet D, et al. Interleukin 2 with anti-GD2 antibody ch14.18/CHO (dinutuximab beta) in patients with high-risk neuroblastoma (HR-NBL1/SIOPEN): a multicentre, randomised, phase 3 trial. Lancet Oncol. 2018;19(12):1617–29. doi: 10.1016/S1470-2045(18)30578-3 [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref017] 17.Siebert N, Zumpe M, Juttner M, et al. PD-1 blockade augments anti-neuroblastoma immune response induced by anti-GD2 antibody ch14.18/CHO. Oncoimmunology. 2017;6(10):e1343775. doi: 10.1080/2162402X.2017.1343775 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref018] 18.Chu Y, Nayyar G, Jiang S, et al. Combinatorial immunotherapy of N-803 (IL-15 superagonist) and dinutuximab with ex vivo expanded natural killer cells significantly enhances in vitro cytotoxicity against GD2(+) pediatric solid tumors and in vivo survival of xenografted immunodeficient NSG mice. J Immunother Cancer. 2021;9(7). doi: 10.1136/jitc-2020-002267 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref019] 19.Zahavi D, Weiner L. Monoclonal Antibodies in Cancer Therapy. Antibodies (Basel). 2020;9(3). doi: 10.3390/antib9030034 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref020] 20.Cornelio DB, Roesler R, Schwartsmann G. Gastrin-releasing peptide receptor as a molecular target in experimental anticancer therapy. Ann Oncol. 2007;18(9):1457–66. doi: 10.1093/annonc/mdm058 [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref021] 21.Zhou J, Chen J, Mokotoff M, et al. Bombesin/gastrin-releasing peptide receptor: a potential target for antibody-mediated therapy of small cell lung cancer. Clin Cancer Res. 2003;9(13):4953–60. [PubMed] [Google Scholar]

[pone.0277956.ref022] 22.Kim S, Hu W, Kelly DR, et al. Gastrin-releasing peptide is a growth factor for human neuroblastomas. Annals of surgery. 2002;235(5):621–9; discussion 9–30. doi: 10.1097/00000658-200205000-00003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref023] 23.Ishola TA, Kang J, Qiao J, et al. Phosphatidylinositol 3-kinase regulation of gastrin-releasing peptide-induced cell cycle progression in neuroblastoma cells. Biochimica et biophysica acta. 2007;1770(6):927–32. doi: 10.1016/j.bbagen.2007.02.002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref024] 24.Raieli S, Di Renzo D, Lampis S, et al. MYCN Drives a Tumor Immunosuppressive Environment Which Impacts Survival in Neuroblastoma. Front Oncol. 2021;11:625207. doi: 10.3389/fonc.2021.625207 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref025] 25.Qiao J, Lee S, Paul P, et al. Akt2 regulates metastatic potential in neuroblastoma. PloS one. 2013;8(2):e56382. doi: 10.1371/journal.pone.0056382 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref026] 26.Qiao J, Kang J, Ishola TA, et al. Gastrin-releasing peptide receptor silencing suppresses the tumorigenesis and metastatic potential of neuroblastoma. Proc Natl Acad Sci U S A. 2008;105(35):12891–6. doi: 10.1073/pnas.0711861105 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref027] 27.Kim KW, Paul P, Qiao J, et al. Enhanced autophagy blocks angiogenesis via degradation of gastrin-releasing peptide in neuroblastoma cells. Autophagy. 2013;9(10):1579–90. doi: 10.4161/auto.25987 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref028] 28.Ku Z, Xie X, Davidson E, et al. Molecular determinants and mechanism for antibody cocktail preventing SARS-CoV-2 escape. Nat Commun. 2021;12(1):469. doi: 10.1038/s41467-020-20789-7 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref029] 29.Meng W, Li L, Xiong W, et al. Efficient generation of monoclonal antibodies from single rhesus macaque antibody secreting cells. MAbs. 2015;7(4):707–18. doi: 10.1080/19420862.2015.1051440 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref030] 30.Lee S, Qiao J, Paul P, et al. FAK is a critical regulator of neuroblastoma liver metastasis. Oncotarget. 2012;3(12):1576–87. doi: 10.18632/oncotarget.732 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref031] 31.Paul P, Rellinger EJ, Qiao J, et al. Elevated TIMP-1 expression is associated with a prometastatic phenotype, disease relapse, and poor survival in neuroblastoma. Oncotarget. 2017;8(47):82609–20. doi: 10.18632/oncotarget.19664 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref032] 32.Gocher AM, Workman CJ, Vignali DAA. Interferon-gamma: teammate or opponent in the tumour microenvironment? Nat Rev Immunol. 2021. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref033] 33.Taube JM, Anders RA, Young GD, et al. Colocalization of inflammatory response with B7-h1 expression in human melanocytic lesions supports an adaptive resistance mechanism of immune escape. Sci Transl Med. 2012;4(127):127ra37. doi: 10.1126/scitranslmed.3003689 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref034] 34.Dondero A, Pastorino F, Della Chiesa M, et al. PD-L1 expression in metastatic neuroblastoma as an additional mechanism for limiting immune surveillance. Oncoimmunology. 2016;5(1):e1064578. doi: 10.1080/2162402X.2015.1064578 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref035] 35.Mimura K, Teh JL, Okayama H, et al. PD-L1 expression is mainly regulated by interferon gamma associated with JAK-STAT pathway in gastric cancer. Cancer Sci. 2018;109(1):43–53. doi: 10.1111/cas.13424 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref036] 36.Preuss U, Landsberg G, Scheidtmann KH. Novel mitosis-specific phosphorylation of histone H3 at Thr11 mediated by Dlk/ZIP kinase. Nucleic Acids Res. 2003;31(3):878–85. doi: 10.1093/nar/gkg176 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref037] 37.Maina T, Nock BA. From Bench to Bed: New Gastrin-Releasing Peptide Receptor-Directed Radioligands and Their Use in Prostate Cancer. PET Clin. 2017;12(2):205–17. doi: 10.1016/j.cpet.2016.12.002 [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref038] 38.Abiraj K, Mansi R, Tamma ML, et al. Bombesin antagonist-based radioligands for translational nuclear imaging of gastrin-releasing peptide receptor-positive tumors. J Nucl Med. 2011;52(12):1970–8. doi: 10.2967/jnumed.111.094375 [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref039] 39.Gourni E, Del Pozzo L, Kheirallah E, et al. Copper-64 Labeled Macrobicyclic Sarcophagine Coupled to a GRP Receptor Antagonist Shows Great Promise for PET Imaging of Prostate Cancer. Mol Pharm. 2015;12(8):2781–90. doi: 10.1021/mp500671j [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref040] 40.Mansi R, Wang X, Forrer F, et al. Development of a potent DOTA-conjugated bombesin antagonist for targeting GRPr-positive tumours. Eur J Nucl Med Mol Imaging. 2011;38(1):97–107. doi: 10.1007/s00259-010-1596-9 [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref041] 41.Mu L, Honer M, Becaud J, et al. In vitro and in vivo characterization of novel 18F-labeled bombesin analogues for targeting GRPR-positive tumors. Bioconjug Chem. 2010;21(10):1864–71. doi: 10.1021/bc100222u [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref042] 42.Jo M, Jung ST. Engineering therapeutic antibodies targeting G-protein-coupled receptors. Exp Mol Med. 2016;48:e207. doi: 10.1038/emm.2015.105 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref043] 43.Hutchings CJ. A review of antibody-based therapeutics targeting G protein-coupled receptors: an update. Expert Opin Biol Ther. 2020;20(8):925–35. doi: 10.1080/14712598.2020.1745770 [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref044] 44.Shimasaki N, Jain A, Campana D. NK cells for cancer immunotherapy. Nat Rev Drug Discov. 2020;19(3):200–18. doi: 10.1038/s41573-019-0052-1 [DOI] [PubMed] [Google Scholar]

[pone.0277956.ref045] 45.Judge SJ, Murphy WJ, Canter RJ. Characterizing the Dysfunctional NK Cell: Assessing the Clinical Relevance of Exhaustion, Anergy, and Senescence. Front Cell Infect Microbiol. 2020;10:49. doi: 10.3389/fcimb.2020.00049 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref046] 46.Hamanishi J, Mandai M, Iwasaki M, et al. Programmed cell death 1 ligand 1 and tumor-infiltrating CD8+ T lymphocytes are prognostic factors of human ovarian cancer. Proc Natl Acad Sci U S A. 2007;104(9):3360–5. doi: 10.1073/pnas.0611533104 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref047] 47.Koirala P, Roth ME, Gill J, et al. Immune infiltration and PD-L1 expression in the tumor microenvironment are prognostic in osteosarcoma. Sci Rep. 2016;6:30093. doi: 10.1038/srep30093 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref048] 48.Tran HC, Wan Z, Sheard MA, et al. TGFbetaR1 Blockade with Galunisertib (LY2157299) Enhances Anti-Neuroblastoma Activity of the Anti-GD2 Antibody Dinutuximab (ch14.18) with Natural Killer Cells. Clin Cancer Res. 2017;23(3):804–13. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref049] 49.Modak S, Le Luduec JB, Cheung IY, et al. Adoptive immunotherapy with haploidentical natural killer cells and Anti-GD2 monoclonal antibody m3F8 for resistant neuroblastoma: Results of a phase I study. Oncoimmunology. 2018;7(8):e1461305. doi: 10.1080/2162402X.2018.1461305 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref050] 50.Federico SM, McCarville MB, Shulkin BL, et al. A Pilot Trial of Humanized Anti-GD2 Monoclonal Antibody (hu14.18K322A) with Chemotherapy and Natural Killer Cells in Children with Recurrent/Refractory Neuroblastoma. Clin Cancer Res. 2017;23(21):6441–9. doi: 10.1158/1078-0432.CCR-17-0379 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0277956.ref051] 51.Boeva V, Louis-Brennetot C, Peltier A, et al. Heterogeneity of neuroblastoma cell identity defined by transcriptional circuitries. Nat Genet. 2017;49(9):1408–13. doi: 10.1038/ng.3921 [DOI] [PubMed] [Google Scholar]

PERMALINK

Anti-GRP-R monoclonal antibody antitumor therapy against neuroblastoma

Jingbo Qiao

Junquan Liu

Jillian C Jacobson

Rachael A Clark

Sora Lee

Li Liu

Zhiqiang An

Ningyan Zhang

Dai H Chung

Roles

Abstract

Introduction

Materials and methods

Antibodies and reagents

Cell lines and culture

Phage library panning and antibody expression

Enzyme-linked immunosorbent assay

Affinity measurement with biolayer interferometry

Cytotoxicity assay and IFNγ releasing measurement

Flow cytometry

Cell growth and anchorage-independent growth assay

Immunoblotting

Immunohistochemistry and immunofluorescence staining

RNA isolation and quantitative polymerase chain reaction with RT-PCR

Cytotoxicity assay in murine xenograft model

Statistical analysis and experimental analysis

Results

GRP-R mAb production

Fig 1. GRP-R monoclonal antibody development and production.

Inhibitory effects of GRP-R mAb on human neuroblastoma cells

Fig 2. Evaluation of GRP-R mAb binding affinity with neuroblastoma cells and tissue.

GRP-R mAb-1 blocks bombesin-induced PI3K/AKT activation and inhibits cell proliferation and anchorage-independent growth

Fig 3. GRP-R mAb-1 inhibitory roles on neuroblastoma cell in vitro.

GRP-R mAb mediates ADCC on GRP-R expressing neuroblastoma cells and induces IFNγ secretion from NK cells

Fig 4. GRP-R mAb–mediated antibody-dependent cellular cytotoxicity (ADCC) in neuroblastoma.

Immune checkpoint protein PD-L1 expression in neuroblastoma cells

Fig 5. Immune checkpoint protein PD-L1 expression in neuroblastoma cells.

GRP-R mAb-1 induced ADCC in mouse xenografts tumor tissue

Fig 6. GRP-R mAb-mediated ADCC in mouse xenograft tumors.

Discussion

Supporting information

Data Availability

Funding Statement

References

Decision Letter 0

Salvatore V Pizzo

Roles

Author response to Decision Letter 0

Decision Letter 1

Salvatore V Pizzo

Roles

Acceptance letter

Salvatore V Pizzo

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases