Skip to main content
PLOS One logoLink to PLOS One
. 2022 Dec 16;17(12):e0264879. doi: 10.1371/journal.pone.0264879

Population structure and genetic connectivity of the scalloped hammerhead shark (Sphyrna lewini) across nursery grounds from the Eastern Tropical Pacific: Implications for management and conservation

Mariana Elizondo-Sancho 1,2,*, Yehudi Rodríguez-Arriatti 3,#, Federico J Albertazzi 4,5,#, Adrián Bonilla-Salazar 6,‡, Daniel Arauz-Naranjo 7,‡, Randall Arauz 8,9,‡, Elisa Areano 10,‡, Cristopher G Avalos-Castillo 11,‡, Óscar Brenes 6,‡, Elpis J Chávez 7,‡, Arturo Dominici-Arosemena 3,‡, Mario Espinoza 4,9,11,#, Maike Heidemeyer 5,#, Rafael Tavares 12,‡, Sebastián Hernández 1,13
Editor: Johann Mourier14
PMCID: PMC9757582  PMID: 36525407

Abstract

Defining demographically independent units and understanding patterns of gene flow between them is essential for managing and conserving exploited populations. The critically endangered scalloped hammerhead shark, Sphyrna lewini, is a coastal semi-oceanic species found worldwide in tropical and subtropical waters. Pregnant females give birth in shallow coastal estuarine habitats that serve as nursery grounds for neonates and small juveniles, whereas adults move offshore and become highly migratory. We evaluated the population structure and connectivity of S. lewini in coastal areas and one oceanic island (Cocos Island) across the Eastern Tropical Pacific (ETP) using both sequences of the mitochondrial DNA control region (mtCR) and 9 nuclear-encoded microsatellite loci. The mtCR defined two genetically discrete groups: one in the Mexican Pacific and another one in the central-southern Eastern Tropical Pacific (Guatemala, Costa Rica, Panama, and Colombia). Overall, the mtCR data showed low levels of haplotype diversity ranging from 0.000 to 0.608, while nucleotide diversity ranged from 0.000 to 0.0015. More fine-grade population structure was detected using microsatellite loci where Guatemala, Costa Rica, and Panama differed significantly. Relatedness analysis revealed that individuals within nursery areas were more closely related than expected by chance, suggesting that S. lewini may exhibit reproductive philopatric behaviour within the ETP. Findings of at least two different management units, and evidence of philopatric behaviour call for intensive conservation actions for this highly threatened species in the ETP.

Introduction

Delimiting demographically independent populations and understanding their levels of genetic diversity and connectivity is central to managing and conserving endangered and exploited species [1–3]. In aquatic ecosystems, animals that occupy high trophic positions generally exhibit high extinction risks due to their large sizes, life-history characteristics, and the exploitation rates they are subjected to [4,5]. Sharks are one of the most threatened groups of marine fishes globally, mainly due to overfishing and habitat degradation which has increased dramatically over the past 20 years [4,6,7]. Population level declines are of major concern in conservation since the effects of genetic drift and inbreeding are pronounced in small populations, which may lead to loss of genetic diversity and compromise the ability of a population to adapt to environmental change [8].

The scalloped hammerhead shark Sphyrna lewini (Griffith and Smith, 1834), is a large (up to 420 cm total length, TL), viviparous, coastal semi-oceanic species found worldwide in tropical and sub-tropical waters [9]. Similar to other shark species, S. lewini, has low resilience to overfishing due to its slow growth, late sexual maturity, and long gestation periods [10–12]. Throughout its distribution, S. lewini has experienced severe population declines [7,13–16], leading to its listing as Critically Endangered by the International Union for the Conservation of Nature (IUCN) Red List of Threatened Species [17]. S. lewini has a complex life history in which pregnant females give birth in shallow coastal estuarine habitats that serve as nursery grounds during their early life stages [18,19]. Eventually, large juveniles and adults move offshore and become highly migratory, often schooling around seamounts and near continental shelves [20,21].

The dichotomy between breeding in coastal reproductive habitats and the long-range dispersal of adults displayed by shark species such as S. lewini may result in complex population structure [22]. Six distinct population segments of S. lewini have been distinguished globally, defined within 1) the North West Atlantic and Gulf of Mexico, 2) Central and South West Atlantic, 3) Eastern Atlantic, 4) Indo-West Pacific, 5) Central Pacific, and 6) in the Eastern Pacific [16,23]. Despite high fishing levels, the Eastern Pacific S. lewini distinct population segment has been poorly studied throughout its range. Neonates and juveniles are susceptible to bottom shrimp trawl and small-scale artisanal fisheries inshore [24], whereas adults are a frequent by-catch in pelagic longline and purse-seine fisheries that operate near seamounts and oceanic islands [16,25,26].

Genetically discrete groups are created by reproductive behaviors that segregate populations, which cause allele frequency differentiation through time [27]. Natal philopatry is described as a reproductive behavior in which organisms return to their birthplace to reproduce or give birth [28]. This behavior has been observed in several species of sharks, including the great white shark (Carcharodon carcharias), mako shark (Isurus oxyrinchus), lemon shark (Negaprion brevirostris), blacktip shark (Carcharhinus limbatus), sand tiger shark (Carcharhinus taurus), speartooth shark (Glyphis glyphis), and bull shark (Carcharhinus leucas) [29–36]. For a species that uses coastal habitats as nursery areas, such as S. lewini, natal philopatry could contribute to the development of genetically discrete groups, where intrinsic reproduction and recruitment may result in population structure at smaller geographic scales than would be expected based on the mobility of the organism [37,38].

To date, studies investigating the genetic structure of S. lewini in the Eastern Tropical Pacific ocean (ETP) have been either limited to small geographic areas [7,39] or they have used relatively small sample sizes [40]. Given the limited data on the population structure of S. lewini and the high fishing pressure that this species is currently experiencing throughout the ETP, it is important to assess the population structure and genetic diversity in potential nursery areas of the region, to develop effective management and conservation strategies. This study (i) assessed the genetic diversity of S. lewini in coastal sites of the ETP, (ii) determined the population structure of S. lewini within the ETP, and (iii) evaluated the potential role of natal philopatry in the population dynamics of S. lewini within the ETP.

Materials and methods

Study region

The study region comprises the majority of the ETP (Fig 1), from the coast of Central America and South America to 140°W, and from southern Mexico to northern Peru [41]. The ETP includes a complex diversity of coastal environments and oceanic islands with oceanographic conditions that vary seasonally, annually and over longer time scales [42]. Coastal sampling sites were comprised of estuarine systems with predominant mangrove vegetation and muddy coasts 1) Las Lisas and Sipacate in Guatemala (GUA, N = 72); 2) Coyote (COY, N = 34) and Ojochal (OJO, N = 44) in Costa Rica; and 3) Punta Chame in Panama (PAN, N = 65) (Fig 1). Samples were also obtained from an oceanic island in Costa Rica, Cocos Island (ICO, N = 15). Previously collected molecular data from coastal areas in México and Colombia were included in the analysis to cover a broader geographic range. Mexican sites included: Nayarit (NAY), Oaxaca (OAX), Michoacan (MCH), Baja California (BJC), Chiapas (CHP), and Sinaloa [40]; Colombian sites included: Port Buenaventura (PTB), Utria (UTR), Sanquianga (SNQ) and Malpelo Island (MLP) [39] (Fig 1). All samples analyzed were from juveniles except the ones collected in Cocos Island and Malpelo Island which were adults. Sampling sites were plotted using base and raster layers from the Natural Earth (public domain) http://www.naturalearthdata.com/ in ArcMap 10.4 [43] and QGis 2.18.9 [44] (Figs 1, 5 and S2).

Fig 1. Location of sampling sites of Sphyrna lewini in the Eastern Tropical Pacific.

Fig 1

Sampling sites: Guatemala (GUA, N = 72), Ojochal (OJO, N = 43), Coyote (COY, N = 34), Cocos Island (ICO, N = 15), Panama (PAN, N = 65), Nayarit (NAY, N = 25), Oaxaca (OAX, N = 8), Michoacan (MCH, N = 17), Baja California (BJC, N = 25), Chiapas (CHP, N = 14), Sinaloa (SIN, N = 36), Port Buenaventura (PTB, N = 22), Sanquianga (SNQ, N = 20), Utria (UTR, N = 21), Malpelo Island (MLP, N = 18). Sampling sites were plotted using base and raster layers from the Natural Earth (public domain) http://www.naturalearthdata.com/ in ArcMap 10.4.

Fig 5. Contemporary gene flow estimated from 9 microsatellite loci genotypes with the divMigrate function.

Fig 5

Arrows represent the relative number of migrants and estimated direction of gene flow between three coastal areas: Guatemala (GUA), Costa Rica (OJO), Panama (PAN); and an oceanic island: Cocos Island (ICO). The darker the arrow, the higher the relative number of migrants between sampling locations.

Sample collection

Tissue samples of juvenile S. lewini (30–50 cm TL) were collected from artisanal fisheries operating in Costa Rica (N = 78), Panama (N = 65) and Guatemala (N = 72) throughout 2017 and 2018. In addition, samples from adults (63–108 cm TL) were collected opportunistically in Cocos Island (N = 15) with a biopsy dart during scientific cruises conducted in 2008. The use of tissue samples for this study was reviewed by the National Commission for the Management of Biodiversity (CONAGEBIO) of Costa Rica. The technical office of CONAGEBIO emitted the research permit R-CM-VERITAS-001-2021-OT-CONAGEBIO. The Ministry of Environment of Panama issued the research permits SEX/A-61-19 and SEX/A-108-17 and the National Council of Protected Areas of Guatemala issued the research license no. I-DRSO-001-2018. Fin and muscle tissue was preserved in 95% ethanol and stored at -20° C. Total DNA was extracted from 25 mg of tissue using the phenol-chloroform protocol [45] and with Promega’s Wizard® Genomic DNA Purification Kit.

Amplification and sequencing of mitochondrial DNA

The mitochondrial DNA control region (mtCR) was amplified and sequenced for a total of 231 S. lewini individuals using primers designed in Geneious Pro v6.0.6 Bioinformatics Software for Sequence Data Analysis [46]. Forward (3´ AAGGGTCAACTTCTGCCCT 5´) and reverse (3´AGCATGGCACTGAAGATGCT 5´) primers were designed based on the whole mitochondrial genome of S. lewini deposited in Genbank (Accession number: JX827259). PCR amplification was conducted using a Veriti™ Thermal Block (Applied Biosystems, USA) with a total volume of 15μL containing 67 mM Tris-HCl pH 8.8, 16mM (NH4)2SO4, 2.0 mM MgCl2, 20 mM dNTPs, 10 μM of each primer, 0.4 units of Dream Taq DNA Polymerase (5U/ μl), and 1 μl of DNA (20–40 ng/μl). The PCR thermal profile included initial 5 min denaturation at 94°C, 30 cycles of 30 s at 94°C, 30 s at 59°C and 1.5 min at 72°C, followed by a final extension for 10 min at 72°C. PCR products and the corresponding negative control were visualized in UV light after electrophoresis in 1.2% agarose gel. PCR products were purified and then sequenced in both directions using an ABI 3100 automated sequencer.

Amplification and genotyping of microsatellite loci.

A total of 169 samples of S. lewini were genotyped for 14 microsatellite loci previously described by Nance et al. (2009) (Guatemala = 52; Costa Rica = 50; Panama = 51; Cocos Island = 15). Forward primers were marked with an M13 tail (5´- TGT AAA ACG ACG GCC AGT-3´) [47]. Microsatellite amplification was conducted using a nested PCR in a total volume of 15 μL with 1–2 μL of DNA (10–30 ng), 0.1 μM forward primer, 0.4 μM reverse primer, 0.4 μM M13 primer (6FAM, VIC or NED), 0.2 mM dNTPs, 2 mM MgCl2, 0.04 units of Dream Taq DNA Polymerase (5U/μL), 1X Buffer and water. PCR conditions consisted of an initial 2 min denaturalization at 94°C, followed by 32 cycles of 30 s at 94°C, 30 s of 57°C (Sle25, Sle77), 59°C (Sle45, Sle59, Sle33, Sle53), 60°C (Sle54, Sle13, Sle18, Sle27, Sle81, Sle71, Sle86, Sle38) 1 min a 72°C, followed by 8 cycles of 30 s at 94°C, 30 s at 53°C, 30 s at 72°C and a final extension of 2 min at 72°C. PCR products and corresponding negative controls were verified by electrophoresis in 1.2% agarose gel and visualized using UV light. PCR products were cleaned and then sequenced in both directions using an ABI 3730 automated sequencer to verify the microsatellite motifs. Fragment size analysis was done using an ABI 3730 automated sequencer with a 5-dye chemistry and a size standard of GS500.

Mitochondrial DNA analysis

Collected in this study from coastal sites of the ETP and Cocos Island, 229 sequences from the mtCR of S. lewini were analyzed. An alignment of 489bp was carried out with the MUSCLE algorithm on GeneiousPro Bioinformatics Software for Sequence Data Analysis [46]. For a broader geographic range, 206 additional sequences previously published were retrieved from GenBank® (S1 Table) and added to the alignment from the coast of Colombia (N = 81) [39] and México (N = 125) [40]. Arlequin 3.5 Software [48] was used to calculate the number of haplotypes (H), polymorphic sites (S), nucleotide diversity (π), haplotype diversity (hd) and nucleotide base composition. To examine relationships among haplotypes, a haplotype network was drawn in Haploview Bioinformatics software [49] which was based on phylogenetic reconstructions carried out for maximum likelihood in RAxML-HPC2 8.2.12 on XSEDE [50] (available at https://www.phylo.org) [51]. The maximum likelihood analysis was carried out using GTR+ Gamma and 1000 Bootstrap iterations.

Arlequin 3.5 software [48] was used to estimate the population structure among geographic areas using Wright’s pairwise fixation index (ƟST) [52] (20,000 permutations, α = 0.05). An exact test of population differentiation based on haplotype frequencies was conducted to complement this analysis using Arlequin 3.5 (100000 steps in the Markov chain, 100000 dememorization steps, α = 0.05) [48]. A global hierarchical Analysis of Molecular Variance (AMOVA) [53] was performed to determine the genetic diversity among and within regions using Arlequin 3.5 (10000 permutations and α = 0.05) [48]. In order to observe which configuration of the data best explained the variance the AMOVA was performed with three different groupings: 1) one region (all locations); 2) two regions the Northern Eastern Tropical Pacific (Mexico) and the Central-southern Eastern Tropical Pacific (Guatemala, Costa Rica, Panama and Colombia); and 3) three regions the Northern Eastern Tropical Pacific (Mexico collection sites), the Central Eastern Pacific (Guatemala, Costa Rica and Panama), and the Southern Eastern Tropical Pacific (Colombia). A Mantel test [54] was conducted to test the hypothesis that genetic differentiation is due to isolation-by-distance; Adegenet R package [55] in R v.4.0.2. [56] was used to evaluate the correlation between Nei’s genetic distance and a matrix of Euclidian geographic distance.

Microsatellite DNA data analysis

The fragment size of 14 microsatellite loci for each sample was determined by identifying the peaks with GeneMarker® Software 2.6.3. The presence of genotyping errors and null alleles, as well as the frequency of null alleles per locus (r) was evaluated using MICRO-CHECKER v.2.2.3 [57]. Deviations from Hardy-Weinberg equilibrium (HW) and linkage disequilibrium (LD) were calculated for each locus and sampling site using GENEPOP v. 4.0 [58] utilizing 10000 steps of dememorization, 1000 batches and 10000 iterations per batch. All probability values were adjusted using the Holm-Bonferroni correction [59]. Adegenet R package [55] in R v.4.0.2 [56] was used to calculate the number of alleles (A), allelic richness (Ar), expected heterozygosity (HE), observed heterozygosity (HO) and inbreeding coefficient (FIS).

The package Related [60] in R v.4.0.2. [56] was used to conduct the genetic relatedness analysis based on the allele frequencies among all pairs of S. lewini individuals within and among sampling sites. The function “comparestimators” was used to select the best relatedness estimator and evaluate the performance of four genetic relatedness estimators [61–64]. This function simulates individuals of known relatedness based on the observed allele frequencies and compares the correlation between observed and expected genetic relatedness for each estimator. The relatedness estimator with the highest correlation coefficient was chosen. To check for the possibility of occurrence of related individuals that may bias estimates of genetic diversity and differentiation, the distribution of observed pairwise relatedness values across all individuals was also compared to the values expected between parent-offspring (PO), full-siblings (FS), half- siblings (HS) and unrelated pairs (U). Subsequently, to determine if individuals within sampling sites were more closely related than expected by chance, observed values of relatedness for each sampling site were compared from random mating expectations with the function “grouprel”. This function calculates the average pairwise relationship within each predefined group (i.e., sampling site) as well as an overall within-group relatedness. The expected distribution of average within group relatedness is generated by randomly shuffling individuals using 1000 Monte Carlo simulations, keeping group size constant. The observed mean relatedness is then compared to the distribution of simulated values to test the null hypothesis of groups being randomly associated in terms of relatedness. Additionally, pairwise average relatedness was compared within and between sampling sites with a Two Sample t-test and an alpha threshold of 0.05 in R v.4.0.2. [56].

To test for population structure between sample collection areas, pairwise population comparisons of DEST values [65] and Wright’s pairwise fixation index (FST) [52], were obtained using the “fastDivPart” function in the diveRsity package [66] in R v.4.0.2. The variance of these statistics was assessed by 10000 bootstrap iterations and a bias corrected 95% confidence interval (CI) was calculated for pairwise calculations [66]. Additionally, the software STRUCTURE v.2.3.4 [67] was used to identify the clustering of groups of individuals and the admixture with a Markov Chain of Monte Carlo (MCMC) (length burn-in period: 200000; MCMC: 40000; 10 K, 10 iterations each). To infer the best K, the Evanno ΔK method was used [68]. To complement previous population structure analysis, a multivariate approach, Discriminant Analysis of Principal Components (DAPC) [69] was used to identify discrete populations based on geographic region, using the Adegenet package in R v.4.0.2. The DAPC summarizes initial genetic data into uncorrelated groups using principal components, then uses discriminant analysis to maximize the among-population variation [70]. In the DAPC, retaining too many Principal Component Analysis (PCA) axes with respect to the number of individuals can lead to over-fitting. To decide in an objective way how many PCA axes to retain a cross-validation analysis was performed with the “xvalDapc” function in the Adegenet package [69]. This function tries different numbers of PCA axes and then assesses the quality of the corresponding DAPC by cross-validation, with 100 replicas [69]. The number of PCA axes associated with the lowest Mean Squared Error were then retained in the DAPC [69]. Cluster assignments were pre-defined corresponding with defined collection locations.

A Mantel test was performed to test the hypothesis of genetic differentiation due to isolation-by-distance; the correlation between Nei’s genetic distance and a matrix of Euclidian geographic distances were evaluated using the Adegenet package [55] in R v.4.0.2. Gene flow was analyzed with the “divMigrate” function [71] of the package diveRsity [66] in R v. 4.0.2 [56]. The “divMigrate” function was used to plot the relative migration levels and detect asymmetries in gene flow patterns, between pairs of sampling sites using DEST values of genetic differentiation [71]. This function plots sampling areas connected to every other by two connections that represent the two reciprocal gene flow components between any pair of locations [71]. This approach provides information on the direction of migration using relative migration scales (from 0 to 1) in which the highest migration rate given is one [71].

Results

Mitochondrial DNA

The nucleotide alignment (435 sequences and 489pb) of mtCR sequences from individuals across the ETP, had a nucleotide base composition of 31.7% A, 24.4% C, 7.8% G, 36.1% T, 16 haplotypes, and 23 polymorphic sites. Sequences from this study are deposited in Genbank, accession numbers: OL692109—OL692337. There was variation of the genetic diversity of S. lewini samples throughout the ETP (Table 1). The haplotype diversity (hd) ranged from 0.000 to 0.608, while nucleotide diversity (π) ranged from 0.000 to 0.0015. The highest genetic diversity was observed in Guatemala (hd = 0.608; π = 0.00015), followed by Malpelo Island (hd = 0.581; π = 0.0012). The lowest genetic diversity was detected in Baja California, Chiapas, and Oaxaca (hd = 0.000, π = 0.000). In all sampling areas the overall haplotype diversity was 0.3912± 0.2215 and the nucleotide diversity 0.0016±0.0016. Overall genetic diversity in the Northern ETP (hd = 0.2175, π = 0.001691) was lower than in the Central-southern ETP (hd = 0.5481, π = 0.001704) (Table 1).

Table 1. Genetic diversity indices for the mitochondrial control region and 9 microsatellite loci for Sphyrna lewini individuals in the Eastern Tropical Pacific.

Sites mtCR 9 Microsatellite loci
n H S hd Π Pha Ho He Na Ua Fis Ar
Northern ETP 125 3 14 0.2175 0.001691
BJC 25 1 0 0 0 0
SIN 36 3 14 0.300 0.005392 1
NAY 25 2 1 0.380 0.000757 0
MCH 17 2 1 0.308 0.000689 0
OAX 8 1 0 0 0 0
CHP 14 1 0 0 0 0
Overall 125 3 14 0.2175 0.001691
Central-southern
ETP
310 15 23 0.548 0.001704
GUA 72 7 4 0.608 0.001531 4 0.71 0.71 8.33 10 0.03 6.74
COY 34 3 2 0.522 0.001141 1
OJO 43 6 4 0.501 0.001275 2 0.68 0.72 8.67 7 0.10 7
PAN 65 7 6 0.575 0.001433 2 0.68 0.72 7.78 10 0.08 5.89
ICO 15 3 2 0.514 0.001246 0 0.69 0.66 5.56 2 0.02 6.34
UTR 21 2 1 0.514 0.001052 0
PTB 22 4 17 0.541 0.00408 0
SNQ 20 3 17 0.511 0.004176 0
MLP 18 3 2 0.581 0.001296 0
Overall 125 3 14 0.5481 0.001704

N: Number, H: Number of haplotypes, S: Polymorphic sites, hd: Haplotype diversity, π: Nucleotide diversity, Pha: Number of private haplotypes, Ho: Observed heterozygosity, He: Expected heterozygosity, Na: Number of alleles, Ua: Unique alleles, Fis: Inbreeding coefficient, Ar: Allelic richness. Sampling sites: Northern Eastern Tropical Pacific: Baja California (BJC), Sinaloa (SIN), Nayarit (NAY), Michoacan (MCH), Oaxaca (OAX), Chiapas (CHP); and Central-Southern Eastern Tropical Pacific: Guatemala (GUA), Coyote (COY), Ojochal (OJO), Panama (PAN), Cocos Island (ICO), Utria (UTR), Port Buenaventura (PTB), Sanquianga (SNQ), Malpelo Island(MLP).

A total of 16 haplotypes were found in all samples across the ETP (Fig 2). Thirteen of these haplotypes were sampled out of two or more individuals where Hap5 was the most common haplotype across all sampling sites and detected in 50.4% of all individuals analyzed (Fig 2 and S3 Table). Two common haplotypes, Hap5 and Hap4 were found across all sampling sites. These two common haplotypes differed in frequency by region, Hap5 was found in higher frequency in the Northern ETP, while Hap4 was found in higher frequency in the Central-Southern ETP. Ten private haplotypes were detected: GUA (4), OJO (2), COY (1), PAN (2), SIN (1).

Fig 2. Haplotype network based on mitochondrial control region sequences for Sphyrna lewini.

Fig 2

Each circle represents a unique haplotype (Haplotype 1 through 16); the size of the circle is proportionate to the number of individuals; the colors represent the proportion of individuals from each sampling location; ticks on connecting lines indicate mutational steps between haplotypes. Sampling sites: Guatemala (GUA), Ojochal (OJO), Coyote (COY), Cocos Island (ICO), Panama (PAN), Nayarit (NAY), Oaxaca (OAX), Michoacan (MCH), Baja California (BJC), Chiapas (CHP), Sinaloa (SIN), Port Buenaventura (PTB), Sanquianga (SNQ), Utria (UTR), Malpelo Island (MLP).

Pairwise ƟST values showed significant genetic differentiation between Northern ETP sampling sites (NAY, OAX, MCH, BJC, CHP, SIN) and those in the Central-southern ETP (GUA, OJO, COY, ICO, PAN, PTB, UTR, SNQ and MLP) (Table 2). The hierarchal AMOVA, confirmed this genetic differentiation between samples from the Northern ETP and samples from Central-southern ETP. This configuration of the data was the one that best explained the variation. Significant levels of population subdivision were found between these two groups, representing 37.42% of the variation found in the mtCR (Table 3). The mtCR Mantel test revealed a significant pattern of isolation-by-distance (r = 0.47, p = 0.002), showing that genetic distance was correlated with geographic distance.

Table 2. Pairwise ƟST values and exact test of sample differentiation of the mitochondrial control region for Sphyrna lewini individuals in the Eastern Tropical Pacific.

BJC SIN NAY MCH OAX CHP GUA COY OJO PAN ICO UTR PTB SNQ MLP
BJC - 0.07072 0.02163 0.05993 0.99995 0.99995 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000
SIN 0.049 - 0.17235 0.54013 0.43470 0.18609 0.00000 0.00000 0.00000 0.00000 0.00000 0.00015 0.00000 0.00000 0.00000
NAY 0.208* 0.027 - 0.71997 0.29791 0.07127 0.00045 0.00729 0.00020 0.00150 0.00400 0.03456 0.00265 0.00405 0.05743
MCH 0.169 0.009 -0.039 - 0.52250 0.22344 0.00065 0.00459 0.00005 0.00190 0.00355 0.02003 0.00135 0.00280 0.03586
OAX 0.000 -0.015 0.101 0.050 - 0.99995 0.00040 0.00285 0.00005 0.00045 0.00105 0.00924 0.00095 0.00215 0.00215
CHP 0.000 0.020 0.151 0.105 0.000 - 0.00000 0.00015 0.00000 0.00000 0.00010 0.00060 0.00000 0.00005 0.00105
GUA 0.395* 0.175* 0.163* 0.205* 0.329* 0.359* - 0.64056 0.18823 0.71977 0.55986 0.63117 0.56540 0.59197 0.53264
COY 0.510* 0.134* 0.179* 0.239* 0.403* 0.449* -0.009 - 0.24562 0.86960 0.52060 0.99995 0.51850 0.68551 0.66888
OJO 0.549* 0.194* 0.270* 0.323* 0.461* 0.499* 0.007 0.001 - 0.21111 0.99995 0.24382 0.93747 0.79918 0.16386
PAN 0.406* 0.163* 0.158* 0.203* 0.335* 0.367* -0.002 -0.017 -0.003 - 0.58757 0.85432 0.61814 0.63312 0.71578
ICO 0.661* 0.123* 0.258* 0.325* 0.502* 0.575* -0.020 -0.029 -0.037 -0.031 - 0.48160 0.99995 0.99995 0.36678
UTR 0.575* 0.103* 0.170* 0.240* 0.435* 0.497* -0.018 -0.038 -0.003 -0.027 -0.034 - 0.52215 0.51755 0.86401
PTB 0.366* 0.106* 0.169* 0.181* 0.231* 0.291* 0.026 0.014 -0.001 0.019 -0.025 0.003 - 0.99995 0.35974
SNQ 0.352* 0.090* 0.153* 0.165* 0.211* 0.273* 0.022 0.009 0.002 0.016 -0.027 -0.004 -0.049 - 0.40434
MLP 0.532* 0.086* 0.141 0.201 0.377* 0.446* -0.016 -0.035 -0.005 -0.030 -0.030 -0.048 -0.005 -0.008 -

Sampling sites: Sampling sites: Baja California (BJC), Sinaloa (SIN), Nayarit (NAY), Michoacan (MCH), Oaxaca (OAX), Chiapas (CHP), Guatemala (GUA), Coyote (COY), Ojochal (OJO), Panama (PAN), Cocos Island (ICO), Utria (UTR), Port Buenaventura (PTB), Sanquianga (SNQ), Malpelo Island (MLP). Significant values (p < 0.05) are found in bold letters, significant values (p < 0.05) of exact tests of sample differentiation based on haplotype frequencies are represented with an asterisk (*). P values of the Pairwise ƟST analysis are presented above the diagonal.

Table 3. Hierarchical Analysis of Molecular Variance (AMOVA) on sequences of the mitochondrial control region for Sphyrna lewini in the Eastern Tropical Pacific.

DF SSD VC %V Ɵ Statistic P value
One region (BJC,SIN,NAY,MCH,OAX,CHP,GUA,COY, OJO,PAN, ICO, UTR,PTB,SNQ,MLP)
Among populations 14 26.850 0.05990 20.83
Within populations 420 95.640 0.22771 79.17 Ɵ ST = 0.2082 0.00000+-0.00000
Two regions (BJC,SIN,NAY,MCH,OAX,CHP) (GUA,COY,OJO,PAN,ICO,UTR,PTB,SNQ,MLP)
Among regions 1 24.321 0.13544 37.42 Ɵ CT = 0.374 0.00005+-0.00005
Among populations within regions 13 2.529 -0.00119 -0.33 Ɵ SC = -0.0052 0.54061+-0.00344
Within populations 420 95.640 0.22771 62.91 Ɵ ST = 0.37417 0.00000+-0.00000
Three regions (BJC,SIN,NAY,MCH,OAX,CHP) (GUA,COY,OJO,PAN,ICO) (UTR,PTB,SNQ,MLP)
Among regions 2 24.414 0.09115 28.67 Ɵ CT = 0.2866 0.00000+-0.00000
Among populations within regions 12 2.435 -0.00089 -0.28 Ɵ SC = -0.0039 0.44446+-0.00362
Within populations 420 95.640 0.22771 71.61 Ɵ ST = 0.2838 0.00000+-0.00000
Total 434 122.490

DF: Degrees of freedom, SSD sum of squares, VC variance component, and % V percent of variance. A comparison of different genetic groupings is presented in the following way: 1) one region: (all locations); 2) two regions: Northern Eastern Tropical Pacific (Mexico) and Central-southern Eastern Tropical Pacific (Guatemala, Costa Rica, Panama and Colombia); and 3) three regions: Northern Eastern Tropical Pacific (Mexico collection sites), Central Eastern Pacific (Guatemala, Costa Rica and Panama), and Southern Eastern Tropical Pacific (Colombia).

Microsatellite loci

A total of 169 individuals from three coastal sampling sites in Central America (GUA, OJO, and PAN), were genotyped at 14 microsatellite loci. MICRO-CHECKER provided evidence of null alleles on four loci (Sle18, Sle25, Sle53 and Sle77), which were removed from further analysis. Loci Sle13 and Sle27 were found to be linked (p < 0.05, Fisher’s method) after performing sampling site-specific and global pairwise comparisons between loci to determine linkage disequilibrium, and the latter was also removed from further analyses. The remaining loci presented no significant deviation from Hardy-Weinberg equilibrium after Holm-Bonferroni correction and presented a total of 1.45% of missing data (sample with no interpretable pattern of DNA fragments after PCR amplification). The genetic relatedness estimates of Wang showed the best performance with our data (r = 0.81), demonstrating an overall coefficient of r = -0.06. Individuals sampled across all sites closely followed the distribution of values expected from unrelated pairs (Fig 3). Unique alleles were found in loci Sle013, Sle033, Sle038, Sle054, Sle071, Sle081, Sle086, Sle089 and all sampling sites (Tables 1 and S2).

Fig 3. Distribution of pairwise genetic relatedness.

Fig 3

Distribution of pairwise genetic relatedness values for simulated pairs of individuals: Full siblings (FS), Half siblings (HS), Parent/Offspring (PO), and for observed pairs of individuals of Sphyrna lewini sampled in coastal areas of the ETP.

Genetic diversity metrics were similar between sampling sites (Table 1). The highest values of observed heterozygosity (Ho) and allelic richness (Ar) were found in Guatemala and the lowest in Panama (Table 1). Inbreeding coefficients (Fis) ranged from 0.02 to 0.10 (Table 1). Genetic diversity statistics were similar between the 9 loci analyzed (S2 Table). Allelic richness across loci was 6.13 ± 4.06. The observed heterozygosity (Ho) ranged from 0.539 (Sle054) to 0.835 (Sle089). The inbreeding coefficients (Fis) ranged from 0.003 (Sle045) to 0.074 (Sle033).

Global genetic structure coefficients of DEST and FST determined significant values of genetic differentiation for S. lewini at coastal sampling sites of the ETP (DEST = 0.14, p < 0.05; FST = 0.054, p < 0.05). Pairwise comparisons of DEST between coastal sampling sites were all significant and showed a greatest differentiation between Guatemala and Panama (DEST = 0.0942, 95% CI (0.0438–0.1123), p < 0.05) and a lowest differentiation for Costa Rica and Panama (DEST = 0.029, 95% CI (0.0096–0.054), p < 0.05). FST values were concordant with DEST values, showing the least differentiation between Costa Rica and Panama (FST = 0.0185, 95% CI (0.0089–0.0299), p < 0.05) and the most differentiation between Guatemala and Panama (FST = 0.0807, 95% CI (0.0621–0.0985), p < 0.05). The DAPC conducted for the coastal sampling sites of the ETP show this same pattern of differentiation (Figs 4A and S1). Two groups were revealed by the STRUCTURE cluster analysis (K = 2), with Costa Rica and Panama conforming one genetic cluster and Guatemala another (Fig 4B). STRUCTURE graphical visualizations with different values of K, reveal the pattern of three distinct groups with Costa Rica and Panama having a higher level of admixture (Fig 4B). Genetic distance was not correlated to the geographic distance between sites since the Mantel test revealed no significant IBD (p > 0.05.) Analysis of the extent and direction of gene flow showed no significant asymmetric movement between coastal sampling sites. However, relative pairwise gene flow demonstrated higher connectivity between Costa Rica and Panama than between Panama and Guatemala (S2 Fig). The genetic exchange obtained with this analysis coincides with the genetic population structure found in pairwise fixation indexes (DEST and FST) and the cluster analyses (STRUCTURE and DAPC) (Fig 4). Gene flow analysis, pairwise fixation indexes (DEST and FST) and cluster analyses (STRUCTURE and DAPC) including Cocos Island, demonstrated higher connectivity of this oceanic island with Costa Rica and Panama than with Guatemala (Figs 4C, 4D and 5 and S4 Table). Pairwise fixation indexes (DEST and FST), show Cocos Island is not significantly differentiated from Costa Rica and Panama.

Fig 4. Population structure analyses from microsatellite genotypes of Sphryna lewini individuals in sampling sites of the Eastern Tropical Pacific: Guatemala (GUA), Costa Rica (OJO), Panama (PAN), and Cocos Island (ICO).

Fig 4

A) DAPC plot from the first and second components of the nuclear microsatellite genotypes of three coastal areas B) Genetic clusters inferred by STRUCTURE with K = 2, K = 3 and K = 4 of three coastal areas. C) DAPC plot from the first and second components of the nuclear microsatellite genotypes of three coastal areas and an oceanic island. D) Genetic clusters inferred by STRUCTURE with K = 2, K = 3 and K = 4 of three coastal areas and an oceanic island.

Overall observed average relatedness calculated from Wang (R = 0.0079) was significantly higher than would be expected by chance (R = -0.0391), indicating non-random relatedness in S. lewini individuals within sampling site (S3 Fig). Additionally, the observed average relatedness in each sampling site was significantly higher than expected, indicating that individuals from these areas were more closely related within sampling sites than would be expected by chance (S3 Fig). The distribution of pairwise relatedness calculated from Wang, tends to be higher between individuals within sampling sites than between individuals in different sampling areas (Fig 6). Within each sampling area, the mean pairwise relatedness differed significantly from that found between sampling areas (Two sample t test, t = 24.326, df = 11626, P = 2.2e-16) (S4 Fig). No difference in average pairwise relatedness was observed between males and females (S5 Fig).

Fig 6. Distribution of pairwise relatedness values of the Wang estimator of Sphyrna lewini individuals within same sampling sites and between different sampling sites.

Fig 6

The mode of each distribution is presented in a black dashed line.

Discussion

Unravelling the genetic structure of threatened or exploited marine species is a critical step in developing more effective management and conservation approaches. This is the first study to use a robust sample size to examine the fine-scale population genetic structure of this critically endangered shark species throughout the ETP. Patterns of genetic variation of S. lewini across coastal areas and an oceanic island within the ETP were assessed using both nuclear-encoded microsatellites and sequences of the maternally inherited mtCR.

Genetic diversity

As with previous analyses of mtCR in the ETP [7,39,40,72], low levels of genetic diversity for S. lewini were found (hd = 0.391). These levels of mitochondrial genetic diversity are comparable to those found in a recent study of this species in the Central Pacific Ocean (hd = 0.439) and are lower than in the Central Indo-Pacific (hd = 0.835) and the western Indian Ocean (hd = 0.653) [72]. The low levels of diversity found in the ETP compared to other geographic locations, are consistent with the evidence suggesting S. lewini center of origin was likely from the Indo-Pacific Ocean [9]. Regions as the ETP could have been colonized taking a small sample of the diversity from the source population and consequently experienced strong genetic drift that promoted the fixation of haplotypes. Comparing these levels of genetic diversity with other sphyrnids, the bonnethead shark (Sphyrna tiburo) showed much higher levels in the Atlantic Ocean (hd = 0.92) [73], as well as the smooth hammerhead shark (Sphyrna zygaena) in the Northern Mexican Pacific Ocean (hd = 0.86) [74] and in the Southern Pacific Ocean (hd = 0.55) [75]. In this study, gene diversity based on nucleotide and haplotype diversity, was highest in the Central-southern ETP with 15 haplotypes resolved, and lowest in the Northern ETP with only three haplotypes present. Low genetic diversity has been previously attributed to overexploitation of this species [74], nonetheless sharks have some of the slowest mutational rates among vertebrates, so genetic diversity accumulates slowly even in the absence of population declines [76,77]. Given the long generation time of S.lewini, and the relatively short time this species has been prone to overexploitation, most likely the genetic diversity has been shaped by other historical demographic events. Future studies could analyze with high resolution, greater portions of the genome to see if this low genetic diversity observed indeed reflects other historical processes.

In addition, nuclear microsatellite marker’s observed heterozygosity showed similar values to those previously reported for this species in the region Ho = 0.703 [22], Ho = 0.770 [7]. Observed heterozygosity in the ETP is similar to that reported for S. lewini in the Indian Ocean (Ho = 0.729) [22] and is higher than the heterozygosity values found in the Western Atlantic Ocean [Ho = 0.580) [70]. When comparing the nuclear genetic diversity found in this study with that of other species, the values are similar to those reported for coastal sharks, including the bonnethead shark (S. tiburo) (Ho = 0.59–0.69; [78]) and the blacknose shark (Carcharhinus acronotus) (Ho = 0.66–68; [79]).

Population genetic structure

The mitochondrial DNA haplotype distribution of S. lewini revealed a pattern of differentiation between the Northern ETP and the Central-southern ETP. This pattern is mainly due to an uneven distribution of the two most common haplotypes, one is found in higher frequency in the Northern ETP while the other is found in higher frequency in the Central-southern ETP. These results differ from the genetic homogeneity that has been previously observed for S. lewini in the ETP [7,9], which may be partially explained by the finer geographic sampling and larger sampling sizes used in this study. The entire Eastern Pacific is considered as a single, well-defined distinct population segment of S. lewini [16,23], yet based on our findings, this definition should be re-evaluated. Additionally, the low levels of mtDNA polymorphism observed suggests that the mtCR variation in S. lewini is insufficient to detect genetic heterogeneity at small scales. It is possible that using more mitochondrial regions or the complete mitogenome could provide a higher resolution, as demonstrated in the speartooth shark (Glyphis glyphis), the bull shark (Carcharhinus leucas) and the silky shark (Carcharhinus falciformis) [35,76,80].

The genetic break identified in our study is located between the boundaries of the Costa Rica Dome and the Tehuantepec Bowl [81], suggesting that the seasonal dynamics of these systems generate oceanographic conditions that may have an impact on gene flow for S. lewini and other marine species [82]. In the ETP, Rodriguez-Zarate et al. (2018) detected a similar pattern of genetic differentiation in the mtCR of the olive ridley sea turtle (Lepidochelys olivacea), a migratory marine species with similar life history traits as S. lewini, where Mexican nesting colonies were genetically differentiated from those in Central America. Their study determined the existence of two oceanographically dynamic but disconnected regions in the ETP, with a physical mixing zone located in southern Mexico [82]. Pazmiño et al. (2018), also detected differentiation within the ETP region separating the galapagos shark (Carcharhinus galapagensis) mtCR sequences found in the Galapagos Islands from the mtCR sequences found in Mexico; this pattern was attributed to secondary barriers that have generated historical geographic isolation [83]. A recent study on S. tiburo, a species that is closely related to S. lewini, shows that magnetic map cues can elicit homeward orientation [84]. This map-like use of the information of Earth’s magnetic field offers a new explanation on how migratory routes and population structure of sharks can be maintained in marine environments.

The genetic differentiation tests (DEST and FST) based on nuclear microsatellite loci revealed three genetically independent units: Guatemala, Costa Rica, and Panama, with limited gene flow between these coastal areas. Despite the limited gene flow found between the three coastal areas, the greatest genetic similarity is observed between Costa Rica and Panama’s demes. Graphical representations of clustering analyses (DAPC and STRUCTURE) in Guatemala, Costa Rica and Panama, revealed three distinct groups yet Costa Rica and Panama appear closer together and present more admixture. Additionally, STRUCTURE analyses present K = 2 as the best clustering assignment of the data, with Costa Rica and Panama representing one genetic group, distinct from Guatemala. Connectivity was detected between Cocos Island and the three coastal areas, and more gene flow is observed between this oceanic island and Costa Rica and Panama than with Guatemala. This is the first observation of genetic connectivity between Cocos Island and coastal areas of Central America, and is analogous to the gene flow found between the oceanic island of Malpelo and coastal areas of the Colombian Pacific [39]. The observations of genetic differentiation between coastal nursery areas together with the genetic connectivity with oceanic aggregation areas of adults, suggest that S. lewini exhibits philopatry to specific coastal areas in the ETP region. Adult females may undertake long-range migrations to oceanic islands within the ETP but return to specific parturition areas.

Relatedness and natal philopatry

Inferring relatedness from genotypic data of few loci, remains a challenge and should be used with caution [85,86], nevertheless it provides insight into the potential mechanisms underlying fine-scale behavioral processes with long term consequences on population dynamics. Female fidelity to specific nurseries may define reproductive units if females are returning to the same location during each gestation cycle to give birth, leading to closer relatedness among juveniles from the same location than with individuals from surrounding areas [35]. Individuals within nursery areas were found to be more closely related than expected by chance, thus suggesting that S. lewini may exhibit reproductive philopatric behavior within the ETP. This behavior could explain the significant difference in the mean relatedness observed within nursery areas when compared to that found between nursery areas.

Given that S. lewini can undertake long-range migrations within the ETP [87], it can be inferred that the resulting population structure is not a consequence of limited dispersal ability. Moreover, all our sampling sites are potential nurseries for S. lewini in the ETP and the observed nuclear genetic structure does not support the relation of increased genetic differentiation with increasing geographic distance. This pattern has also been observed in the Atlantic Ocean, where the main factor driving population subdivision in S. lewini is reproductive philopatric behavior rather than oceanographic or geophysical barriers [70].

Implications for conservation and management

These results offer new insights into the genetic diversity and connectivity of S. lewini in the ETP. Our fine-scale population genetic analysis revealed the existence of at least two genetically distinct units within the ETP, one in the Northern ETP and another one in the Central-southern ETP. The strong genetic partitioning found, urges the recognition of two different management units in the ETP; a region that was previously considered to be one distinct population segment of S. lewini [16,23]. The low levels of genetic diversity found in S. lewini individuals of the Northern ETP, call for special attention to this region. Additionally, coastal sites from Guatemala, Costa Rica and Panama were found to have different evolutionary dynamics, probably attributable to female philopatry. Recent studies of S. lewini using genomic data have found finer scale structure than previously documented using genetic data [72]. The question of there being further structuring in the ETP region, should be addressed with higher resolution genetic techniques that could correctly identify discrete population subdivision.

The potential presence of philopatric behavior of S. lewini within the ETP emphasizes the need to develop more effective conservation approaches. All coastal sites along the ETP that could potentially serve as nursery areas for S. lewini are currently subject to illegal, unreported and unregulated fishing [39,88,89]. Therefore, protection of these nursery areas is crucial for maintaining the genetic diversity, and consequently adaptive potential, of this critically endangered species [1]. For a philopatric species, management measures that identify and protect parturition areas, migratory routes, and unique localized genetic diversity could be crucial to avoid local extinctions [37].

Supporting information

S1 Fig. Densities of individuals in discriminant function 1 of 9 nuclear microsatellite loci genotypes of Sphyrna lewini in three collection areas of Eastern Tropical Pacific: Guatemala (GUA), Costa Rica (OJO), Panama (PAN).

(TIF)

S2 Fig. Contemporary gene flow estimated from 9 microsatellite loci genotypes with the divMigrate function.

Arrows represent the relative number of migrants and estimated direction of gene flow between Guatemala (GUA), Costa Rica (OJO), and Panama (PAN). The darker the arrow, the higher the relative number of migrants between sampling locations.

(TIF)

S3 Fig. Observed and expected distribution of average relatedness.

Expected distribution of average relatedness based on the Wang estimator of Sphyrna lewini in each sampling site and overall sampling sites using 1000 iterations. The average relatedness observed within sampling site and overall sampling site is the statistic test (observed in a red arrow). The further away the statistic test is from the simulated bars, the greater the significance of the relatedness test.

(TIF)

S4 Fig. Distribution of the pairwise relatedness values of the Wang estimator of Sphyrna lewini within sampling sites and between sampling sites.

(TIF)

S5 Fig. Distribution of the pairwise relatedness values of the Wang estimator in females and males of Sphyrna lewini overall sampling sites.

(TIF)

S1 Table. Localities, the total number (n) and accession number of mitochondrial control region gene sequences for Sphyrna lewini from the Eastern Tropical Pacific.

(PDF)

S2 Table. Genetic diversity indices of each microsatellite loci from Sphyrna lewini individuals in the Eastern Tropical Pacific.

Ta: Annealing temperature, Ho: Observed heterozygosity, He: Expected heterozygosity, Ar: Allelic richness, Na: Number of alleles, Ua: Unique alleles, Fis: Inbreeding coefficient.

(PDF)

S3 Table. Geographic distribution and frequency of mitochondrial control region haplotypes of Sphyrna lewini individuals from the Eastern Tropical Pacific.

(PDF)

S4 Table. Pairwise fixation indices (DEST and FST) with lower and upper 95% confidence intervals (CI), between sampling areas of the Eastern Tropical Pacific.

Significant values α = 0.05, are presented in bold.

(PDF)

S1 File

(XLSX)

Acknowledgments

We thank the National Council of Protected Areas of Guatemala for issuing the research license (license no. I-DRSO-001-2018), the National Secretary of Science and Technology of Panama (SENACYT), the Ministry of Environment of Panama for the research permits (SEX/A-61-19 and SEX/A-108-17), the fishers from the community of Las Lisas Guatemala, Daniel Góngora and other fishers from the Punta Chame community for help in field work, Regina Domingo for sample collection in Punta Chame market, Alejandra Barahona director of the Center for International Programs and Sustainability Studies from Universidad Veritas for her support, members of Shark Defenders, small scale fishers of Coyote and Bejuco, in Nandayure, Guanacaste, Costa Rica, The Alvaro Ugalde Scholarship issued by Osa Conservation, and CONAGEBIO in Costa Rica for the research permits (CM-VERITAS-001-2021).

Data Availability

All the mitochondrial control region sequences are available in Genbank accession numbers: OL692109-OL692337. Microsatellite loci genotypes will be uploaded as a Supporting Information file.

Funding Statement

(YR-A) National Secretary of Science and Technology SENACYT (FID-156) https://www.senacyt.gob.pa/en/ (EA/ CA)The Phoenix Zoo (grant project no. 33297) https://www.phoenixzoo.org/ (EA/CA) PADI Foundation (grant no. 32809) http://www.padifoundation.org/ (EA/ CA)Waitt Foundation (grant project no. 33297) https://www.waittfoundation.org/ (EA/CA) Rufford Foundation (grant. no. 22366-1) https://www.rufford.org/ (OB) Fundación Reserva Ojochal https://reservaplayatortuga.org/ (RA) The Whitley Fund for Nature https://whitleyaward.org/ (RA) Sandler Family Foundation https://www.sandlerfoundation.org/ (ME-S) Osa Conservation https://osaconservation.org/ (ME-S) Sistema de Estudios de Posgrado of Universidad de Costa Rica https://www.sep.ucr.ac.cr/ The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Palsbøll PJ, Bérubé M, Allendorf FW. Identification of management units using population genetic data. Trends Ecol Evol. 2007;22(1):11–6. doi: 10.1016/j.tree.2006.09.003 [DOI] [PubMed] [Google Scholar]
  • 2.Veríssimo A, Sampaio Í, McDowell JR, Alexandrino P, Mucientes G, Queiroz N, et al. World without borders—genetic population structure of a highly migratory marine predator, the blue shark (Prionace glauca). Ecol Evol. 2017;7(13):4768–81. doi: 10.1002/ece3.2987 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Pirog A, Jaquemet S, Ravigné V, Cliff G, Clua E, Holmes BJ, et al. Genetic population structure and demography of an apex predator, the tiger shark Galeocerdo cuvier. Ecol Evol. 2019;9(10):5551–71. doi: 10.1002/ece3.5111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Dulvy NK, Fowler SL, Musick JA, Cavanagh RD, Kyne PM, Harrison LR, et al. Extinction risk and conservation of the world’s sharks and rays. Elife. 2014;3:1–34. doi: 10.7554/eLife.00590 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Dulvy NK, Sadovy Y, Reynolds JD. Extinction vulnerability in marine populations. Fish Fish. 2003. [Google Scholar]
  • 6.Holmes T, Rule M, Bancroft K, Shedrawi G, Murray K, Wilson S. Ecological monitoring in the Shark Bay marine reserves 2019. 2019;(February):84. [Google Scholar]
  • 7.Nance HA, Klimley P, Galván-Magaña F, Martínez-Ortíz J, Marko PB. Demographic Processes Underlying Subtle Patterns of Population Structure in the Scalloped Hammerhead Shark, Sphyrna lewini. PLoS One. 2011;6(7). doi: 10.1371/journal.pone.0021459 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Frankham R, Ballou JD, Briscoe DA, McInnes KH. Introduction to Conservation Genetics. Introduction to Conservation Genetics. 2002. [Google Scholar]
  • 9.Duncan KM, Martin AP, Bowen BW, De Couet HG. Global phylogeography of the scalloped hammerhead shark (Sphyrna lewini). Mol Ecol. 2006. doi: 10.1111/j.1365-294X.2006.02933.x [DOI] [PubMed] [Google Scholar]
  • 10.Gallagher AJ, Hammerschlag N, Shiffman DS, Giery ST. Evolved for extinction: The cost and conservation implications of specialization in hammerhead sharks. Bioscience. 2014;64(7):619–24. [Google Scholar]
  • 11.Musick JA, Burgess G, Cailliet G, Camhi M, Fordham S. Management of Sharks and Their Relatives (Elasmobranchii). Fisheries. 2000. [Google Scholar]
  • 12.Furlong-Estrada E, Tovar-Ávila J, Pérez-Jiménez JC, Ríos-Jara E. Resiliencia de sphyrna lewini, rhizoprionodon longurio y carcharhinus falciformis en la entrada del golfo de California después de tres décadas de explotación. Ciencias Mar. 2015;41(1):49–63. [Google Scholar]
  • 13.Amorim AF, Arfelli CA, Fagundes L. Pelagic elasmobranchs caught by longliners off southern Brazil during 1974–97: An overview. Mar Freshw Res. 1998. [Google Scholar]
  • 14.Ferretti F, Myers RA, Serena F, Lotze HK. Loss of large predatory sharks from the Mediterranean Sea. Conserv Biol. 2008. doi: 10.1111/j.1523-1739.2008.00938.x [DOI] [PubMed] [Google Scholar]
  • 15.Hayes CG, Jiao Y, Cortés E. Stock Assessment of Scalloped Hammerheads in the Western North Atlantic Ocean and Gulf of Mexico. North Am J Fish Manag. 2009. [Google Scholar]
  • 16.Miller M, Carlson J, Cooper P, Kobayashi D, Nammack M, Wilson J. Status Review Report: Scalloped Hammerhead Shark (Sphyrna lewini). NOAA Fish. 2013;(August):125. [Google Scholar]
  • 17.IUCN. The IUCN Red List of Threatened Species. Version 2019–2. http://www.iucnredlist.org. Downloaded on 30 July 2019. http://www.iucnredlist.org. 2019.
  • 18.Duncan KM, Holland KN. Habitat use, growth rates and dispersal patterns of juvenile scalloped hammerhead sharks Sphyrna lewini in a nursery habitat. Mar Ecol Prog Ser. 2006;312:211–21. [Google Scholar]
  • 19.Heupel MR, Carlson JK, Simpfendorfer CA. Shark nursery areas: Concepts, definition, characterization and assumptions. Mar Ecol Prog Ser. 2007;337(Nmfs 2006):287–97. [Google Scholar]
  • 20.Klimley AP, Nelson DR. Diel movement patterns of the scalloped hammerhead shark (Sphyrna lewini) in relation to El Bajo Espiritu Santo: a refuging central-position social system. Behav Ecol Sociobiol. 1984. [Google Scholar]
  • 21.Ketchum JT, Hearn A, Klimley AP, Peñaherrera C, Espinoza E, Bessudo S, et al. Inter-island movements of scalloped hammerhead sharks (Sphyrna lewini) and seasonal connectivity in a marine protected area of the eastern tropical Pacific. Mar Biol. 2014;161(4):939–51. [Google Scholar]
  • 22.Daly-Engel TS, Seraphin KD, Holland KN, Coffey JP, Nance HA, Toonen RJ, et al. Global phylogeography with mixed-marker analysis reveals male-mediated dispersal in the endangered scalloped hammerhead shark (sphyrna lewini). PLoS One. 2012. doi: 10.1371/journal.pone.0029986 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Baum J, Clarke S, Domingo A, Ducrocq M, Lamónaca AF, Gaibor N, et al. Sphyrna lewini. The IUCN Red List of Threatened Species. e.T39385A10190088. 2009. [Google Scholar]
  • 24.Espinoza M, Díaz E, Angulo A, Hernández S, Clarke TM. Chondrichthyan diversity, conservation status, and management challenges in Costa Rica. Frontiers in Marine Science. 2018. [Google Scholar]
  • 25.Clarke TM, Espinoza M, Romero Chaves R, Wehrtmann IS. Assessing the vulnerability of demersal elasmobranchs to a data-poor shrimp trawl fishery in Costa Rica, Eastern Tropical Pacific. Biol Conserv [Internet]. 2018;217(November):321–8. Available from: doi: 10.1016/j.biocon.2017.11.015 [DOI] [Google Scholar]
  • 26.López Garro A, Arauz Vargas R, Zanella I, Le Foulgo L. Análisis De Las Capturas De Tiburones Y Rayas En Las Pesquerías Artesanales De Tárcoles, Pacífico Central De Costa Rica. Rev Ciencias Mar y Costeras. 2011;1:145. [Google Scholar]
  • 27.Waples RS. Separating the wheat from the chaff: Patterns of genetic differentiation in high gene flow species. J Hered. 1998;89(5):438–50. [Google Scholar]
  • 28.Hueter RE, Heupel MR, Heist EJ, Keeney DB. Evidence of philopatry in sharks and implications for the management of shark fisheries. J Northwest Atl Fish Sci. 2005;35(November 2004):239–47. [Google Scholar]
  • 29.Feldheim KA, Gruber SH, Dibattista JD, Babcock EA, Kessel ST, Hendry AP, et al. Two decades of genetic profiling yields first evidence of natal philopatry and long-term fidelity to parturition sites in sharks. Mol Ecol. 2014; doi: 10.1111/mec.12583 [DOI] [PubMed] [Google Scholar]
  • 30.Feldheim KA, Gruber SH, De Marignac JRC, Ashley M V. Genetic tagging to determine passive integrated transponder tag loss in lemon sharks. J Fish Biol. 2002. [Google Scholar]
  • 31.Keeney DB, Heupel M, Hueter RE, Heist EJ. Genetic heterogeneity among blacktip shark, Carcharhinus limbatus, continental nurseries along the U.S. Atlantic and Gulf of Mexico. Mar Biol. 2003;143(6):1039–46. [Google Scholar]
  • 32.Schrey AW, Heist EJ. Microsatellite analysis of population structure in the shortfin mako (Isurus oxyrinchus). Can J Fish Aquat Sci. 2003;60(6):670–5. [Google Scholar]
  • 33.Pardini AT, Jones CS, Noble LR, Kreiser B, Malcolm H, Bruce BD, et al. Sex-biased dispersal of great white sharks. Nature. 2001;412(6843):139–40. doi: 10.1038/35084125 [DOI] [PubMed] [Google Scholar]
  • 34.Klein JD, Bester-van der Merwe AE, Dicken ML, Mmonwa KL, Teske PR. Reproductive philopatry in a coastal shark drives age-related population structure. Mar Biol. 2019. [Google Scholar]
  • 35.Tillett BJ, Meekan MG, Field IC, Thorburn DC, Ovenden JR. Evidence for reproductive philopatry in the bull shark Carcharhinus leucas. J Fish Biol. 2012;80(6):2140–58. doi: 10.1111/j.1095-8649.2012.03228.x [DOI] [PubMed] [Google Scholar]
  • 36.Feutry P, Berry O, Kyne PM, Pillans RD, Hillary RM, Grewe PM, et al. Inferring contemporary and historical genetic connectivity from juveniles. Mol Ecol. 2017. doi: 10.1111/mec.13929 [DOI] [PubMed] [Google Scholar]
  • 37.Chapman DD, Feldheim KA, Papastamatiou YP, Hueter RE. There and Back Again: A Review of Residency and Return Migrations in Sharks, with Implications for Population Structure and Management. Ann Rev Mar Sci [Internet]. 2015;7(1):547–70. Available from: http://www.annualreviews.org/doi/10.1146/annurev-marine-010814-015730. [DOI] [PubMed] [Google Scholar]
  • 38.Feldheim KA, Gruber SH, Ashley M V. Reconstruction of parental microsatellite genotypes reveals female polyandry and philopatry in the lemon shark, Negaprion brevirostris. Evolution (N Y). 2004;58(10):2332–42. doi: 10.1111/j.0014-3820.2004.tb01607.x [DOI] [PubMed] [Google Scholar]
  • 39.Quintanilla S, Gómez A, Mariño-Ramírez C, Sorzano C, Bessudo S, Soler G, et al. Conservation Genetics of the Scalloped Hammerhead Shark in the Pacific Coast of Colombia. J Hered. 2015;106(S1):448–58. doi: 10.1093/jhered/esv050 [DOI] [PubMed] [Google Scholar]
  • 40.Castillo-Olguín E, Uribe-Alcocer M, Díaz-Jaimes P. Evaluación de la estructura genética poblacional de Sphyrna lewini para la identificación de unidades de conservación en el Pacífico Mexicano. Ciencias Mar. 2012;38(4):635–52. [Google Scholar]
  • 41.Pennington JT, Mahoney KL, Kuwahara VS, Kolber DD, Calienes R, Chavez FP. Primary production in the eastern tropical Pacific: A review. Prog Oceanogr. 2006. [Google Scholar]
  • 42.Fiedler PC, Lavín MF. Oceanographic Conditions of the Eastern Tropical Pacific. In 2017. [Google Scholar]
  • 43.ESRI. ArcMap Version 10. Redlands California; 2020.
  • 44.QGIS Development Team. QGIS Geographic Information System.Open Source Geospatial Foundation Project. 2020. [Google Scholar]
  • 45.Sambrook J., Fritsch TM E.F. Molecular cloning: a laboratory manual / J. Sambrook, E.F. Fritsch, T. Maniatis. New York: Cold Spring Harbor Laboratory Press. 1989. [Google Scholar]
  • 46.Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, Duran C, et al. Geneious version 6.0.6. http://www.geneious.com. 2011. [Google Scholar]
  • 47.Schuelke M. An economic method for the fluorescent labeling of PCR fragments. Nat Biotechnol. 2000. doi: 10.1038/72708 [DOI] [PubMed] [Google Scholar]
  • 48.Excoffier L, Lischer HEL. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour. 2010. doi: 10.1111/j.1755-0998.2010.02847.x [DOI] [PubMed] [Google Scholar]
  • 49.Barrett JC, Fry B, Maller J, Daly MJ. Haploview: Analysis and visualization of LD and haplotype maps. Bioinformatics. 2005. doi: 10.1093/bioinformatics/bth457 [DOI] [PubMed] [Google Scholar]
  • 50.Stamatakis A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014. doi: 10.1093/bioinformatics/btu033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Miller MA, Pfeiffer W, Schwartz T. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: 2010 Gateway Computing Environments Workshop, GCE 2010.
  • 52.Weir BS, Cockerham CC. Estimating F-statistics for the analysis of population structure. Evolution (N Y). 1984. doi: 10.1111/j.1558-5646.1984.tb05657.x [DOI] [PubMed] [Google Scholar]
  • 53.Excoffier L, Smouse PE, Quattro JM. Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics. 1992;131(2):479–91. doi: 10.1093/genetics/131.2.479 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Mantel N. The Detection of Disease Clustering and a Generalized Regression Approach. Cancer Res. 1967. [PubMed] [Google Scholar]
  • 55.Jombart T. Adegenet: A R package for the multivariate analysis of genetic markers. Bioinformatics. 2008. [DOI] [PubMed] [Google Scholar]
  • 56.R Core Team. R software: Version 4.0.2. R Found Stat Comput. 2020.
  • 57.Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes. 2004. [Google Scholar]
  • 58.Rousset F. GENEPOP’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Mol Ecol Resour. 2008. doi: 10.1111/j.1471-8286.2007.01931.x [DOI] [PubMed] [Google Scholar]
  • 59.Holm S. A simple sequentially rejective multiple test procedure. Scand J Stat. 1979. [Google Scholar]
  • 60.Pew J, Muir PH, Wang J, Frasier TR. related: An R package for analysing pairwise relatedness from codominant molecular markers. Mol Ecol Resour. 2015. [DOI] [PubMed] [Google Scholar]
  • 61.Li CC, Weeks BE, Chakravarti A. Similarity of DNA fingerprints due to chance and relatedness. Hum Hered. 1993. doi: 10.1159/000154113 [DOI] [PubMed] [Google Scholar]
  • 62.Lynch M, Ritland K. Estimation of pairwise relatedness with molecular markers. Genetics. 1999. doi: 10.1093/genetics/152.4.1753 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Queller DC, Goodnight KF. Estimating Relatedness Using Genetic Markers. Evolution (N Y). 1989. doi: 10.1111/j.1558-5646.1989.tb04226.x [DOI] [PubMed] [Google Scholar]
  • 64.Wang J. An estimator for pairwise relatedness using molecular markers. Genetics. 2002. doi: 10.1093/genetics/160.3.1203 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Jost L. GST and its relatives do not measure differentiation. Mol Ecol. 2008. [DOI] [PubMed] [Google Scholar]
  • 66.Keenan K. DiveRsity: A comprehensive, general purpose population genetics analysis package. R package version 1. 2017. [Google Scholar]
  • 67.Pritchard JK, Stephens M, Donnelly P. Inference of population structure using multilocus genotype data. Genetics. 2000;155(2):945–59. doi: 10.1093/genetics/155.2.945 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Evanno G, Regnaut S, Goudet J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol Ecol. 2005;14(8):2611–20. doi: 10.1111/j.1365-294X.2005.02553.x [DOI] [PubMed] [Google Scholar]
  • 69.Jombart T, Devillard S, Balloux F. Discriminant analysis of principal components: A new method for the analysis of genetically structured populations. BMC Genet. 2010. doi: 10.1186/1471-2156-11-94 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Pinhal D, Domingues RR, Bruels CC, Ferrette BLS, Gadig OBF, Shivji MS, et al. Restricted connectivity and population genetic fragility in a globally endangered Hammerhead Shark. Rev Fish Biol Fish. 2020. [Google Scholar]
  • 71.Sundqvist L, Keenan K, Zackrisson M, Prodöhl P, Kleinhans D. Directional genetic differentiation and relative migration. Ecol Evol. 2016. doi: 10.1002/ece3.2096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Green ME, Appleyard SA, White WT, Tracey SR, Heupel MR, Ovenden JR. Updated connectivity assessment for the scalloped hammerhead (Sphyrna lewini) in Pacific and Indian Oceans using a multi-marker genetic approach. Fish Res [Internet]. 2022;251(November 2021):106305. Available from: 10.1016/j.fishres.2022.106305. [DOI] [Google Scholar]
  • 73.Escatel-Luna E, Adams DH, Uribe-Alcocer M, Islas-Villanueva V, Díaz-Jaimes P. Population genetic structure of the Bonnethead Shark, sphyrna tiburo, from the western north Atlantic Ocean based on mtDNA sequences. J Hered. 2015; doi: 10.1093/jhered/esv030 [DOI] [PubMed] [Google Scholar]
  • 74.Félix-López DG, Bolaño-Martinez N, Díaz-Jaimes P, Oñate-González EC, Ramírez-Pérez JS, García-Rodríguez E, et al. Possible female philopatry of the smooth hammerhead shark Sphyrna zygaena revealed by genetic structure patterns. J Fish Biol. 2019;94(4):671–9. doi: 10.1111/jfb.13949 [DOI] [PubMed] [Google Scholar]
  • 75.Bolaño-Martínez N, Hernández-Muñoz S, Uribe-Alcocer M, Galván-Magaña F, Ritchie PA, García-De León FJ, et al. Population genetic divergence as consequence of past range expansion of the smooth hammerhead shark Sphyrna zygaena. Hydrobiologia. 2019;837(1):31–46. [Google Scholar]
  • 76.Feutry P, Kyne PM, Pillans RD, Chen X, Naylor GJP, Grewe PM. Mitogenomics of the Speartooth Shark challenges ten years of control region sequencing. BMC Evol Biol. 2014;14(1):1–9. doi: 10.1186/s12862-014-0232-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Martin AP, Naylor GJP, Palumbi SR. Rates of mitochondrial DNA evolution in sharks are slow compared with mammals. Nature. 1992;357(6374):153–5. doi: 10.1038/357153a0 [DOI] [PubMed] [Google Scholar]
  • 78.Díaz-Jaimes P, Bayona-Vásquez NJ, Escatel-Luna E, Uribe-Alcocer M, Pecoraro C, Adams DH, et al. Population genetic divergence of bonnethead sharks Sphyrna tiburo in the western North Atlantic: Implications for conservation. Aquat Conserv Mar Freshw Ecosyst. 2021. [Google Scholar]
  • 79.Portnoy DS, Hollenbeck CM, Bethea DM, Frazier BS, Gelsleichter J, Gold JR. Population structure, gene flow, and historical demography of a small coastal shark (Carcharhinus isodon) in US waters of the Western Atlantic Ocean. ICES J Mar Sci. 2016;73(9):2322–32. [Google Scholar]
  • 80.Kraft DW, Conklin EE, Barba EW, Hutchinson M, Toonen RJ, Forsman ZH, et al. Genomics versus mtDNA for resolving stock structure in the silky shark (Carcharhinus falciformis). PeerJ. 2020; doi: 10.7717/peerj.10186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Kessler WS. The circulation of the eastern tropical Pacific: A review. Prog Oceanogr. 2006. [Google Scholar]
  • 82.Rodríguez-Zárate CJ, Sandoval-Castillo J, van Sebille E, Keane RG, Rocha-Olivares A, Urteaga J, et al. Isolation by environment in the highly mobile olive ridley turtle (Lepidochelys olivacea) in the eastern pacific. Proc R Soc B Biol Sci. 2018. doi: 10.1098/rspb.2018.0264 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Pazmiño DA, Maes GE, Green ME, Simpfendorfer CA, Hoyos-Padilla EM, Duffy CJA, et al. Strong trans-Pacific break and local conservation units in the Galapagos shark (Carcharhinus galapagensis) revealed by genome-wide cytonuclear markers. Heredity (Edinb). 2018. doi: 10.1038/s41437-017-0025-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Keller BA, Putman NF, Grubbs DR, Portnoy DS, Murphy TP. Map-like use of Earth’s magnetic field in sharks. Curr Biol [Internet]. 2021;31(13):2881–6. Available from: https://www.sciencedirect.com/science/article/abs/pii/S0960982221004760. doi: 10.1016/j.cub.2021.03.103 [DOI] [PubMed] [Google Scholar]
  • 85.Weir BS, Anderson AD, Hepler AB. Genetic relatedness analysis: Modern data and new challenges. Nature Reviews Genetics. 2006. doi: 10.1038/nrg1960 [DOI] [PubMed] [Google Scholar]
  • 86.Wang J. Marker-based estimates of relatedness and inbreeding coefficients: An assessment of current methods. J Evol Biol. 2014. doi: 10.1111/jeb.12315 [DOI] [PubMed] [Google Scholar]
  • 87.Nalesso E, Hearn A, Sosa-Nishizaki O, Steiner T, Antoniou A, Reid A, et al. Movements of scalloped hammerhead sharks (Sphyrna lewini) at Cocos Island, Costa Rica and between oceanic islands in the Eastern Tropical Pacific. PLoS One. 2019;14(3):1–16. doi: 10.1371/journal.pone.0213741 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Zanella I, López-Garro A. Abundancia, reproducción y tallas del tiburón martillo Sphyrna lewini (Carcharhiniformes: Sphyrnidae) en la pesca artesanal de Golfo Dulce, Pacifíco de Costa Rica. Rev Biol Trop. 2015. [Google Scholar]
  • 89.Pérez-Jiménez JC. Historical records reveal potential extirpation of four hammerhead sharks (Sphyrna spp.) in Mexican Pacific waters. Rev Fish Biol Fish. 2014. [Google Scholar]

Decision Letter 0

Johann Mourier

19 Apr 2022

PONE-D-22-04909Population structure and genetic connectivity of the scalloped hammerhead shark (Sphyrna lewini) across nursery grounds from the Eastern Tropical Pacific: implications for management and conservationPLOS ONE

Dear Dr. Elizondo-Sancho,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

Thank you for submitting your manuscript PONE-D-22-04909 “Population structure and genetic connectivity of the scalloped hammerhead shark (Sphyrna lewini) across nursery grounds from the Eastern Tropical Pacific: implications for management and conservation” to PLOS ONE. 

I have now received feedback from three experts in the field. As you can see below, they all found the paper of interest but had a few comments. In particular they found that some details on the analyses are missing which could make the paper more robust and understandable. They provided constructive comments that will help you to improve your paper. 

As a result, I invite you to resubmit a revised version of the paper addressing the comments made by these referees.

With kind regards,

Johann 

==============================

Please submit your revised manuscript by May 20 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Johann Mourier, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following in the Funding Section of your manuscript: 

"This project was funded by: The National Secretary of Science and Technology SENACYT (FID-156) executed by the Ramsar Regional Center for Training and Research on Wetlands in the Western (CREHO), the PADI Foundation (grant no. 32809), The Phoenix Zoo (grant project no. 33297), the Waitt Foundation (grant project no. 33297), the Rufford Foundation (grant. No. 22366-1), Fundación Reserva Ojochal, The Whitley Fund for Nature, Sandler Family Foundation, Osa Conservation, and Sistema de Estudios de Posgrado of Universidad de Costa Rica."

We note that you have provided funding information. However, funding information should not appear in the Funding section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. 

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: 

"(YR-A) National Secretary of Science and Technology SENACYT (FID-156) https://www.senacyt.gob.pa/en/

(EA/ CA)The Phoenix Zoo (grant project no. 33297) https://www.phoenixzoo.org/

(EA/CA) PADI Foundation (grant no. 32809) http://www.padifoundation.org/

(EA/ CA)Waitt Foundation (grant project no. 33297) https://www.waittfoundation.org/

(EA/CA) Rufford Foundation (grant. no. 22366-1) https://www.rufford.org/

(OB) Fundación Reserva Ojochal https://reservaplayatortuga.org/

(RA) The Whitley Fund for Nature https://whitleyaward.org/

(RA) Sandler Family Foundation https://www.sandlerfoundation.org/

(ME-S) Osa Conservation https://osaconservation.org/

(ME-S) Sistema de Estudios de Posgrado of Universidad de Costa Rica https://www.sep.ucr.ac.cr/

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

4. We note that Figure 1 in your submission contain map image which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

a. You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license.  

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an ""Other"" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

b. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

The following resources for replacing copyrighted map figures may be helpful:

USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/

The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/

Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html

NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/

Landsat: http://landsat.visibleearth.nasa.gov/

USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/#

Natural Earth (public domain): http://www.naturalearthdata.com/

5. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

Thank you for submitting your manuscript PONE-D-22-04909 “Population structure and genetic connectivity of the scalloped hammerhead shark (Sphyrna lewini) across nursery grounds from the Eastern Tropical Pacific: implications for management and conservation” to PLOS ONE.

I have now received feedback from three experts in the field. As you can see below, they all found the paper of interest but had a few comments. In particular they found that some details on the analyses are missing which could make the paper more robust and understandable. They provided constructive comments that will help you to improve your paper.

As a result, I invite you to resubmit a revised version of the paper addressing the comments made by these referees.

With kind regards,

Johann

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Partly

********** 

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: No

Reviewer #3: Yes

********** 

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

Reviewer #3: Yes

********** 

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

********** 

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: PlosONE review Elizondo-Sancho et al. 2022

In this study, Elizondo-Sancho and collaborators add a significant number of samples to revisit the population structure of the Scalloped Hammerhead shark in the Eastern Tropical Pacific region. By doing so they provide valuable information for the management of this species. Overall, I found the manuscript well written and easy to follow. The genetic techniques used are not cutting-edge but the data is analysed adequately and I believe the conclusions are robust. I only made a few minor comments that I hope will improve the manuscript. Well done to all the authors. Pierre Feutry

L87-91: there are other philopatric shark species, look up genus Glyphis and Bull Shark

L112: are the acronyms ok for the locations in Costa Rica? There is a discrepancy between that sentence (COY, OJO and COS) and figure 1 (COY, OJO, ICO). Cocos Island seems to be missing in the locations from CR

L123-124: along the coast is quite vague and doesn’t really match up with the specificity of the sampling locations.

L149: “Nance et al. (2009 lewini” Typos?

L167 : add a « , » after « among haplotypes”

L191-192: related individuals should only be removed if there is a reason to think there was a bias in the sampling favoring the catch of related individuals, e.g. 2 neonates caught in the same eddy on the same day. On the opposite, if two siblings were caught 3 years apart there is no reason to remove one of them. See paper by Anderson & Waples (2017) for further details

L213-216: need to explain what method was used to choose the “best” K

L220-221: how did you deal with the potential of overfitting? Alpha score? Cross-validation?

L238: delete “relatively low”, this type of comment on the results belongs to the discussion.

L273: What is significant? Less than 0.05 p-value after correction? It’s generally better to provide the confidence interval for the Fst values rather than p-values, could add them in the upper diagonal

L284: delete “duly”

L305-306: move “(Fis)” after “inbreeding coefficients”

L309-311: replace “a greater” and “a lower” by “the greatest” and “the lowest” respectively

L312: replace “less” by “the least” and “greater” by “the most”

L368: most likely a bottleneck is not detected because the population size is not (yet) low enough, is that what you mean by “only a few generations have passed since overfishing started”. Please reword

L368-369: how can you report a “non-detectable bottleneck”? Do you mean that no bottleneck was detected?

L379: the entire mitogenome is one marker, I would reword and say “using more mitochondrial regions”

L380: Feutry et al. 2014 is a better reference for that statement

L404: or more markers, or both. See Foster et al. 2021

L415: not a challenge if you have plenty of markers (generally SNPs)

L430: quite likely there is further structuring, but more markers and/or more individuals are required to demonstrate it. I think the discussion need to emphasize a bit more the high potential for finer scale structure and the need to look into it with appropriate genetic techniques

References

Feutry, P., Kyne, P. M., Pillans, R. D., Chen, X., Naylor, G. J., & Grewe, P. M. (2014). Mitogenomics of the Speartooth Shark challenges ten years of control region sequencing. BMC evolutionary biology, 14(1), 1-9.

Foster, S. D., Feutry, P., Grewe, P., & Davies, C. (2021). Sample size requirements for genetic studies on yellowfin tuna. PloS one, 16(11), e0259113.

Waples, R. S. , & Anderson, E. C. (2017). Purging putative siblings from population genetic data sets: A cautionary view. Molecular Ecology, 26, 1211–1224. 10.1111/mec.14022

Reviewer #2: This research uses mtDNA and microsatellite data to assess the population structure of the Critically Endangered Scalloped Hammerhead Shark in the Eastern Tropical Pacific. These data build upon previous published datasets (which is wonderful!), revealing novel patterns of population structure. Given the highly threatened status of this species and the importance of population genetic data in conservation and management strategies, this is an important paper that need to be published. I am recommending major revisions on the basis that some of the information could be communicated more clearly through rephrasing, consistent use of terms, and some reorganization. I found some statements to be confusing as written, so I suggest rephrasing and being more concise to improve reader comprehension. The use of consistent names or acronyms for sampling sites would also improve clarity surrounding data analysis and results. Some of the information might flow better with some minor reorganization in the introduction and discussion. Specific suggestions regarding these points are below. The manuscript also needs a careful proofread. Comments/examples are provided in the manuscript pdf but these are not comprehensive.

The other reason I recommend major revision is that some data analyses are not presented, and this dataset may reveal additional novel and important information about the species with some further analysis. The data for HWE are not presented, so the p-values are unknown, as is the scale for these analyses. Was HWE significant calculated for all individuals pooled or for each sample site? This is important because of the assumptions of HWE (e.g. pooling two populations or not-pooling a single population could cause violations in the HWE assumptions). P values should also be reported for all statistics throughout. For example, Table 2 has ‘significant values in bold’, but the threshold used is not specified to give this more meaning. The authors state a correction was applied, so presumably it is not 0.05. Bottleneck tests are also mentioned, but no methods or results presented. Additional statistics that should be considered are: 1) exact tests, 2) DEST for mtDNA, 3) a hierarchical STRUCTURE analysis, 4) genetic diversity indices for the identified populations (rather than sampling sites), and 4) set up the AMOVA as a hypothesis. See specific comments below regarding some of these.

Line 64-65: All populations experience genetic drift, but the effects are more pronounced in small populations. Suggest rephrasing to make this clear.

Line 98: Suggest rephrasing from “sorting out the genetic diversity…”. For example, could change to “it is important to assess population structure and genetic diversity between potential nursery areas in this region”.

Line 100-103: Remove, as this is methods.

Line 112: Add sample sizes for each site.

Line 123: Here is says samples were collect from juveniles, but the introduction said YOY. Which is it? Similarly, what life stages were sampled in the other studies where the data is used here? This needs to be stated, and potential caveats addressed in the discussion since life stage sampled is needed to interpret the data more fully.

Line 153: The entire mtDNA control region?

Line 136: Remove “species-specific”. These primers may have been designed for S. lewini, but that does not mean they are species-specific. That would involve cross testing in other species to make sure they do not cross-amplify DNA from other species.

Lines 146, 159: More details are needed for how PCR products were cleaned and sequenced, as well as for fragment analysis, e.g. what size standard was used?

Line 156: Suggest including cycle numbers in Table S2 since they were not the same across all loci.

Line 165: Add sample sizes for these locations.

Line 173: Suggest exact tests here too.

Line 191-192: I understand why the authors removes FS from the analyses, but does this then impact population structure and genetic diversity statistics in the other direction? Since relatedness/sibship approaches can be used to elucidate population structure and natal philopatry, it might be worth exploring the data without this removal of FS and/or going further with relatedness analyses. See next comment as well.

Line 202-204: Were these comparisons also made between individuals at different sites? Suggest doing so to compare to the within-nursery data. It would also be interesting to look at sibship between different nursery areas as well as within nursery areas.

Line 210: Why not calculate DEST for mtDNA too?

Line 213: Suggest a hierarchical STRUCTURE if any of the identified populations (GUA, COS, PAN) have >1 sampling site. This is not really clear to me, as per the below comment for line 282. Also suggest looking at delta K

Table 1: Suggest calculating genetic diversity indices for each of the identified populations; this will give an estimate of diversity at scales relevant to management.

Line 250-252: Suggest rephrasing these sentences as they are confusing. I suspect the authors are trying to say that there were two common haplotypes across all sampling sites, but they were found at different frequencies in Mexico compared to Central America and Colombia.

Line 262-265: This statement is long and confusing. An AMOVA should be set up to test a specific hypothesis.

Line 282: I’m finding the acronyms and verbiage surrounding locations somewhat confusing. Here, GUA, COS, and PAN are mentioned. GUA and PAN are labelled on the map, but COS is not. I’m guessing that COS includes samples from >1 site, but the same may also be true for PAN based on the map. Later, there is reference to regions (e.g., 372) but it is difficult to follow given the inconsistencies. Suggest explaining sampling sites/ countries (pooled or not), regions (countries pooled?), etc. early on and then using the same language throughout the manuscript.

Line 285: “population-specific”- what was this defined by?

Line 291: Were all FS pairs from the same sampling site? This could be an interesting discussion point.

Line 308, 311, etc: Suggest reporting actual P-value. Was a correction applied to these statistical tests? If so, what was the new threshold?

Line 316-319: These statements seem to be contradictory. Were they all non-significant?

Line 321: Why were the samples from the Cocos Islands not included in analyses? For example, FST, DEST, Structure, etc.? The sample size wasn’t huge, but still worth including in the structure plot at a minimum.

Line 339-340: The statement “The average withing sampling site….” is confusing; suggest rephrasing.

Line 353 and elsewhere: Population declines can lead to a loss of genetic diversity, but that does not mean that: 1) population declines always cause declines in genetic diversity, or 2) that all populations with low diversity have undergone recent declines. This section seems to attribute the observed levels of genetic diversity to recent population declines, but this is not actually known. Elasmobranchs have some of the slowest rates of mutation among vertebrates, so genetic diversity accumulates slowly and can be low even in the absence of population declines. Suggest developing this section to be more comprehensive of genetic diversity in elasmobranchs, perhaps bringing in phylogeography (e.g. how recently might these populations been founded?)

Line 356: Levels of genetic diversity were not calculated for the central-southern ETP overall- they were calculated by sampling sites from what I can tell. Suggest analyzing genetic diversity for the identified populations to back up this statement. It also makes more sense from a management perspective to analyze data for each identified population.

Line 358-359: Take care with verbiage. Genetically distinct populations do not mean they resulted from independent evolutionary history. All populations of this species in the ETP likely have a common evolutionary history. This is evidenced by the presence of two common haplotypes shared across populations.

Line 367: It is stated that a bottleneck was not detected, but no data are presented to support this. Suggest either including bottleneck tests (with discussion on caveats of the various statistical approaches) or deleting the statement about the detection of bottleneck tests.

Line 373: The sentence on this line is confusing, suggest rephrasing.

Line 376: The term “sub-population’ has a specific meaning for the IUCN species assessments, which is cited as the source of this definition. The IUCN definition of ‘sub-population’ is not the same as used in population genetics. I suggest the authors read this definition more carefully and rework this point. The data presented in this paper does not support further splitting the EP sub-population of this species, as per the IUCN definition. Within this region, the identification of distinct population units is important to inform management, so suggest focusing on that.

Line 388-391; 397; 400-401; 436: The phrasing on these lines need some work as it is difficult to understand/follow. For example, line 388 mentions oceanographically dynamic regions and then uses the phrase ‘mixing zone’. Is this referring to a physical mixing zone or ‘mixing’ meaning gene flow? Line 400 mentions “high sampling effort” but not what locations fit this category. Etc.

Line 407: What age classes were sampled in these other studies?

Line 415: The discussion on relatedness could be built upon more. For example, what were the challenge for assessing sibship in this study? Could take some of the analysis further as well to support more discussion, as mentioned in previous comments.

Lines 423-429: This ought to be discussed in the population structure section. Philopatry is the logical explanation for the observed population structure, so integrate there. I also suggest either doing additional analyses on relatedness to develop this section more fully, or use the relatedness statistics to support the population structure findings.

Figure 1: Add sample sizes to caption or figure

Figure 2: It is difficult to see the ticks or count them.

Figure 5: What is the difference between the gray and black arrows? Specify in the caption.

Reviewer #3: In their article, Elizondo-Sancho describe the scalloped hammerhead’s population genetic structure and connectivity across nursery grounds from the Eastern Tropical Pacific, using a combination of mtDNA sequences and microsatellite markers. They employ commonly used population genetic analyses, and report stronger patterns of genetic structure than previously reported, suggestive of natal philopatry. They go on discussing the implications of these findings in terms of management of local populations.

Generally, the study is well conducted and I have no major issue with the analyses. Some important details (e.g. regarding STRUCTURE analyses) are missing, and I think some of the interpretations may be unwarranted. But these are fairly minor issues that I think can be very easily addressed by the authors with a minor revision. below I provide some detailed comments:

• Lines 50-51: I am not sure what the value of reporting Ho and allelic richness at microsatellite markers in the abstract is. These are very highly dependent on marker type (bialellic, tri-alellic, how where the markers selected).

• Line 87: i would rephrase as "allele frequency differences through time", since divergence usually refers to accumulation of mutations, while here the authors are talking of the effects of drift.

• Lines 214_216 and in general STRUCTURE analyses:

The authors do not explain how they chose the value for K they report in the results. What method was used to choose K (Evanno’s method? Other)? How do STRUCTURE plots look for different values of K? IS there any way to assess the admixture proportions? For SNPs data it's common to use evalAdmix (http://www.popgen.dk/software/index.php/EvalAdmix ), to evaluate pairwise correlation of residuals matrix between individuals. I am not sure whether there is an equivalent approach for microsatellite data.

Also, the admixture proportions reported in the figure are a bit difficult to reconcile with both the general population structure (Fst) and relative migration rates inferred: how is it that PAN and GUA show the lowest relative migration rates but the highest levels of admixture?

I am also not sure why the Authors have not reported structure analyses and DAPC of the entire dataset (including the samples from previous studies).

• DivMigrate analyses: what measure of genetic differentiation was used to estimate relative migration patterns ? Also please give more details on the method (including citation of the method implemented in divMigrate: Sunqvist et al 2016, Ecol Evol https://doi.org/10.1002/ece3.2096 ). How are relative migration rates scaled? i.e. is the highest migration rate given as 1?

An important concern is that this method assumes migration-drift equilibrium, I doubt this is a reasonable assumptions when it comes to long-lived marine animals with large Ne whose habitat has been affected by glaciations. See for example Maisano-Delser et al paper in Heredity on black-tip reef sharks and Walsh et al. paper in Heredity on grey reef sharks. So these results need to be interpreted with caution (as the authors of the package diveRsity themselves say).

• The authors mention low levels of genetic diversity (referring to pi and haplotype diversity). Low with respect to what? Other populations of the same species, other coastal sharks, or other marine fish? a pi of 0.0016 does not seem very low, but again this depends on what the reference is. What does seem interesting is the high degree of geographical heterogeneity in these estimates.

• Regarding migration rates, the authors mention that “Analysis of the extent and direction of gene flow showed no significant movement between coastal sampling sites.”. I am not sure how this conclusion was reached. There is no real analyses of the extent of gene flow, as measures of geneflow are "relative" (no absolute values ). Also the analyses assume migration-drift equilibrium and an island model, so the authors must be careful in interpreting the results.

• The authors mention that the low diversity of mtDNA is consistent with overexploitation. (Lines 352-353). No evidence is presented that the low levels of genetic diversity of this species are linked in any way to recent population declines. Given the generation time of scalloped hammerheads i find this hypothesis extremely unlikely.

None of the analyses the author presented allow any inference of recent changes in Ne, and to my knowledge such analyses would require extensive two-locus statistics (LD) obtained for a great portion of the genome, along with good linkage maps (for example, using the method developed by Santiago: https://doi.org/10.1093/molbev/msaa169) . Also please note that most studies on genetic diversity of sharks concluded that patterns of genetic diversity were almost certainly unrelated to recent population declines but rather reflect the species history of colonization/range expansion/isolation. See work on grey nurse sharks (Stow et al 2006 Biology Letters and subsequent paper in Molecular Ecology about grey nurse sharks https://doi.org/10.1098/rsbl.2006.0441 https://doi.org/10.1111/j.1365-294X.2009.04377.x , and recent work on blacktip reef shark by Stefano Mona and Maisano-Delser https://doi.org/10.1038/s41437-018-0164- , as well as work on grey reef sharks just published in heredity https://doi.org/10.1038/s41437-022-00514-4 ).

If the authors want to test this hypothesis they could try to use the R package “migraine” to detect possible bottlenecks, but they should also be aware that these estimates could be biased by complex demographic histories (e.g. https://doi.org/10.1038/s41437-018-0164-0 ).

• Lines 368-369: I am not sure what is meant by "non-detectable bottleneck effect". It could very well be that overharvesting may have reduced census size while having negligibly effects on effective population size. A non-detectable effect is not an effect at all?

********** 

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Pierre Feutry

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: PONE-D-22-04909.pdf

PLoS One. 2022 Dec 16;17(12):e0264879. doi: 10.1371/journal.pone.0264879.r002

Author response to Decision Letter 0


23 Jun 2022

May 20th, 2022

San José, Costa Rica

To Dr. Johann Mourier, Academic Editor;

Dr. Pierre Feutry, Referee;

and two anonymous referees:

First of all, thank you so much for your time to revise the manuscript. Your comments have been extremely helpful to improve this manuscript. Here below I address all of your comments. First I will start with observations about Journal Requirements and then I will address the comments regarding the content of the manuscript that were provided by each Referee.

I look forward to you receiving the revised manuscript and expect that it now can meet PLOS ONE’s publication criteria.

Kind regards,

Mariana

A. Regarding the comments about Journal Requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.

Yes thank you, I double checked that the manuscript has PLOS ONE’s style requirements.

2. We note that you have provided funding information. However, funding information should not appear in the Funding section or other areas of your manuscript.

Thank you, yes I eliminated the funding statement from the manuscript.

3. We note that you have stated that you will provide repository information for your data at acceptance.

The data of mitochondrial control region sequences was deposited in Genbank and will not be released to the public database until December 2033,or until the data or accession numbers appear in print, whichever

is first.

4. We note that Figure 1 in your submission contain map image which may be copyrighted

I specified in the methods section that the map images were created by a public domain without any copyright.

B. Regarding the comments about the content of the Manuscript:

Reviewer #1:

Thank you again Dr. Pierre Feutry, your comments were very welcome. Here I respond to your observations:

1. L87-91: there are other philopatric shark species, look up genus Glyphis and Bull Shark

Thank you, I added these species to the introduction.

2. L112: are the acronyms ok for the locations in Costa Rica? There is a discrepancy between that sentence (COY, OJO and COS) and figure 1 (COY, OJO, ICO). Cocos Island seems to be missing in the locations from CR

Yes, I missed mentioning Cocos Island in this section. For microsatellite analyses I only use the sampling site Ojochal of Costa Rica, that is why I was using the acronym OJO and COS for the same area, I understand this is confusing. I will change it.

3. L123-124: along the coast is quite vague and doesn’t really match up with the specificity of the sampling locations.

Noted! And changed.

4. L149: “Nance et al. (2009 lewini” Typos?

Yes! I did not see it before

5. L167 : add a « , » after « among haplotypes”

Yes, much better

6. L191-192: related individuals should only be removed if there is a reason to think there was a bias in the sampling favoring the catch of related individuals, e.g. 2 neonates caught in the same eddy on the same day. On the opposite, if two siblings were caught 3 years apart there is no reason to remove one of them. See paper by Anderson & Waples (2017) for further details

I ran all analyses with both data sets and the difference was very little, the total number of individuals that I removed from the analyses were 19, the majority were from Guatemala. No strong conclusion was different. Something that could further justify not removing these pairs of Full Siblings, is that most of them were sampled one year apart, and some even in different countries, so I would not trust that they are really full siblings. I checked the distribution of my data comparing it to what is expected of Unrelated pairs, Half Siblings, Full Sibling and Parent Offspring pairs (Fig 3). The majority are distributed as Unrelated, so I decided to leave all analyses with the full data set.

7. L213-216: need to explain what method was used to choose the “best” K

Yes, the Evanno method was used

8. L220-221: how did you deal with the potential of overfitting? Alpha score? Cross-validation?

In the DAPC, retaining too many PCA axes with respect to the number of individuals can lead to over-fitting in the membership probabilities. To decide in an objective way how many PCA axes to retain, a cross validation analysis was performed with the xvalDapc function from the Adegenet package in R. This function tries different numbers of axes and the quality of the corresponding DAPC is assessed by cross-validation. The number of PCA axes associated with the lowest Mean Squared Error (40 PCs) were then retained in the DAPC.

Jombart T, Devillard S and Balloux F (2010) Discriminant analysis of principal components: a new method for the analysis of genetically structured populations. BMC Genetics11:94. doi:10.1186/1471-2156-11-94

9. L238: delete “relatively low”, this type of comment on the results belongs to the discussion.

You are right, I will delete it

10. L273: What is significant? Less than 0.05 p-value after correction? It’s generally better to provide the confidence interval for the Fst values rather than p-values, could add them in the upper diagonal

The significance level was 0.05, so yes less tan 0.05 and there was no correction applied. For mitochondrial DNA Fst pairwise comparisons I could not find a way to provide the confidence intervals. I added the p-values to the upper diagonal.

11. L284: delete “duly”

Deleted

12. L305-306: move “(Fis)” after “inbreeding coefficients”

Yes!

13. L309-311: replace “a greater” and “a lower” by “the greatest” and “the lowest” respectively

Thank you yes much better

14. L312: replace “less” by “the least” and “greater” by “the most”

Yes

15. L368: most likely a bottleneck is not detected because the population size is not (yet) low enough, is that what you mean by “only a few generations have passed since overfishing started”. Please reword

After consideration, I think that these results of the bottleneck analysis are not relevant. Other reviewers also suggested to eliminate this since it does not contribute much.

16. L368-369: how can you report a “non-detectable bottleneck”? Do you mean that no bottleneck was detected?

After consideration, I think that these results of the bottleneck analysis are not relevant. Other reviewers also suggested to eliminate this since it does not contribute much.

17. L379: the entire mitogenome is one marker, I would reword and say “using more mitochondrial regions”

Yes, this makes more sense

18. L380: Feutry et al. 2014 is a better reference for that statement

Yes!

19. L404: or more markers, or both. See Foster et al. 2021

Yes, I understand what you mean, it is important to use robust sample sizes or more markers or both. The thing is that here, I want to emphasize in that what out study has that is not seen in Nance et al., 2009 is a bigger sample size.

20. L415: not a challenge if you have plenty of markers (generally SNPs)

Ok, I will specify genotypic data of few loci.

21. L430: quite likely there is further structuring, but more markers and/or more individuals are required to demonstrate it. I think the discussion need to emphasize a bit more the high potential for finer scale structure and the need to look into it with appropriate genetic techniques

Yes, I added this to the discussion

Reviewer #2

Thank you again for all your constructive comments, here I address each of them. And made the corresponding improvements to the manuscript.

1. The data for HWE are not presented, so the p-values are unknown, as is the scale for these analyses. Was HWE significant calculated for all individuals pooled or for each sample site? This is important because of the assumptions of HWE (e.g. pooling two populations or not-pooling a single population could cause violations in the HWE assumptions).

The data for HWE was calculated for all individuals pooled and for each sampling site separately, these results are presented in the Microsatellite loci section. There were no significant deviations from HWE after Holm-Bonferroni correction of the 9 loci that were used for analyses.

2. Line 64-65: All populations experience genetic drift, but the effects are more pronounced in small populations. Suggest rephrasing to make this clear.

You are right I rephrased it the following way:

Population level declines are of major concern in conservation since the effects of genetic drift and inbreeding are pronounced in small populations, which may lead to loss of genetic diversity and compromise the ability of a population to cope with environmental change.

3. Line 98: Suggest rephrasing from “sorting out the genetic diversity…”. For example, could change to “it is important to assess population structure and genetic diversity between potential nursery areas in this region”.

Perfect, I rephrased this the following way:

Given the limited data on the population structure of S. lewini and the high fishing pressure that this species is currently under throughout the ETP, it is important to assess sorting to assess population structure and genetic diversity in potential nursery areas of the region, to develop effective management and conservation strategies.

4. Line 100-103: Remove, as this is methods.

Yes, I removed those lines.

5. Line 112: Add sample sizes for each site.

Yes, I could do this but it would be a little confusing, since the samples that were used for the mitochondrial control region are not exactly the same as the ones used for the microsatellite loci analyses. I am going to add the total number of samples I had from each location

6. Line 123: Here is says samples were collect from juveniles, but the introduction said YOY. Which is it? Similarly, what life stages were sampled in the other studies where the data is used here? This needs to be stated, and potential caveats addressed in the discussion since life stage sampled is needed to interpret the data more fully.

The Castillo-Olguin and collaborators (2009) study sampled juveniles (60-130cm long).Nance and collaborators (2011) paper were juveniles 1-3 years old except adults in Manta Island (TL ≥ 1.5m). Quintanilla and collaborators (2015) juveniles 30-50 TL except Malpelo Island (adults TL ≥ 1.5m). Thank you I cleared this in methods

7. Line 153: The entire mtDNA control region?

Yes, this was modified

8. Line 136: Remove “species-specific”. These primers may have been designed for S. lewini, but that does not mean they are species-specific. That would involve cross testing in other species to make sure they do not cross-amplify DNA from other species.

Yes! You are right. Removed

9. Lines 146, 159: More details are needed for how PCR products were cleaned and sequenced, as well as for fragment analysis, e.g. what size standard was used?

Yes, for microsatellites I sequenced all loci in both directions to verify the microsatellite dinucleotide motifs. Then for fragment analyses it was done with a 5-dye chemistry (FAM, NED, PET, VIC) and an internal size standard LIZ GS500

10. Line 156: Suggest including cycle numbers in Table S2 since they were not the same across all loci.

Yes, this was from the initial protocol (8-20 cycles) I only used 8 cycles

11. Line 165: Add sample sizes for these locations.

Ready

12. Line 173: Suggest exact tests here too.

Yes, as you suggested I ran the exact test of population differentiation, in Arlequin. The results are almost exactly the same as the Fst values. I included the significance of the exact test in Table 2.

13. Line 191-192: I understand why the authors removes FS from the analyses, but does this then impact population structure and genetic diversity statistics in the other direction? Since relatedness/sibship approaches can be used to elucidate population structure and natal philopatry, it might be worth exploring the data without this removal of FS and/or going further with relatedness analyses. See next comment as well.

Yes, I ran all analyses with both sets of data and the difference is minimal, no relevant conclusions changed. I explored a little further with relatedness analyses.

Another reviewer made the observation that related individuals should only be removed if there is a reason to think there was a bias in the sampling favoring the catch of related individuals, e.g. 2 neonates caught in the same eddy on the same day. On the opposite, if two siblings were caught 3 years apart there is no reason to remove one of them. See paper by Anderson & Waples (2017) for further details.

Something that could further justify not removing these pairs of Full Siblings, is that most of them were sampled one year apart, and some even in different countries, so I would not trust that they are really full siblings.

14. Line 202-204: Were these comparisons also made between individuals at different sites? Suggest doing so to compare to the within-nursery data. It would also be interesting to look at sibship between different nursery areas as well as within nursery areas.

Yes, I added some analyses and graphs that explored further the relatedness within and between nursery areas.

15. Line 210: Why not calculate DEST for mtDNA too?

I could not find any software or R package that would calculate Dest values for mtDNA data.

16. Line 213: Suggest a hierarchical STRUCTURE if any of the identified populations (GUA, COS, PAN) have >1 sampling site. This is not really clear to me, as per the below comment for line 282. Also suggest looking at delta K

For this analyses there was only one sampling site per identified population. What I mean by this is only one sampling area in Guatemala, one in Costa Rica and one in Panamá. I also now present STRUCTURE plots with different values of K, and specify that the number of clusters identified by the Evanno method was K = 2.

17. Table 1: Suggest calculating genetic diversity indices for each of the identified populations; this will give an estimate of diversity at scales relevant to management.

Yes very good idea, thank you I added this.

18. Line 250-252: Suggest rephrasing these sentences as they are confusing. I suspect the authors are trying to say that there were two common haplotypes across all sampling sites, but they were found at different frequencies in Mexico compared to Central America and Colombia.

Yes, I cleared this

19. Line 262-265: This statement is long and confusing. An AMOVA should be set up to test a specific hypothesis.

Yes, here I added different configurations of the data for the AMOVA analyses. The two group configuration (Northern ETP and Central-southern ETP), is the one that best explains the variation found. I specified the AMOVA as a hypothesis in the following way:

In order to observe which configuration of the data best explained the variance, the AMOVA was performed with three different groupings: 1) one region (all locations); 2) two regions the Northern Eastern Tropical Pacific (Mexico) and the Central-southern Eastern Tropical Pacific (Guatemala, Costa Rica, Panama and Colombia); and 3) three regions the Northern Eastern Tropical Pacific (Mexico collection sites), the Central Eastern Pacific (Guatemala, Costa Rica and Panama), and the Southern Eastern Tropical Pacific (Colombia).

20. Line 282: I’m finding the acronyms and verbiage surrounding locations somewhat confusing. Here, GUA, COS, and PAN are mentioned. GUA and PAN are labelled on the map, but COS is not. I’m guessing that COS includes samples from >1 site, but the same may also be true for PAN based on the map. Later, there is reference to regions (e.g., 372) but it is difficult to follow given the inconsistencies. Suggest explaining sampling sites/ countries (pooled or not), regions (countries pooled?), etc. early on and then using the same language throughout the manuscript.

Yes, thank you I have cleared this misunderstanding. From now on I refer only to Ojochal (OJO), as it was the only location from Costa Rica that was analyzed with microsatellites.

21. Line 285: “population-specific”- what was this defined by?

Sorry yes, I meant sampling location.

22. Line 291: Were all FS pairs from the same sampling site? This could be an interesting discussion point.

From the FS pairs that I found with 99% confidence, 17 were from the same sampling site. From the 5 that were from different sampling sites: 2 pairs were found between Costa Rica and Guatemala, and three pairs between Costa Rica and Panamá. I decided to not go further into these results, since there were inconsistencies when changing the alpha value. ML related identified as much as 200 pairs of FS in the data. This does not make sense, since they were pairs from different sampling sites and also from different years. I decided to maintain the analyses presented in Fig 3, in which the distribution of my data, is similar to that of Unrelated pairs (using the same allele frequencies as my data).

23. Line 308, 311, etc: Suggest reporting actual P-value. Was a correction applied to these statistical tests? If so, what was the new threshold?

Dest values and Weir and & Cockerham’s Fst values were calculated with the function fastDivPart in the R package diversity. The variance of these statistics was assessed by 100000 bootstrap iterations. For pairwise calculations carried out by the function, a bias corrected 95% confidence interval is calculated. I calculated the 95% confidence interval for these statistics

24. Line 316-319: These statements seem to be contradictory. Were they all non-significant?

Yes, this was written in a confusing way. What this analysis did was test if there was asymmetric gene flow between these areas, which was not found. The statement should be corrected the following way:

Analysis of the extent and direction of gene flow showed no significant asymmetric movement between coastal sampling sites.

25. Line 321: Why were the samples from the Cocos Islands not included in analyses? For example, FST, DEST, Structure, etc.? The sample size wasn’t huge, but still worth including in the structure plot at a minimum.

Yes, I will ran these analyses with samples from Cocos included, and now present these results.

26. Line 339-340: The statement “The average withing sampling site….” is confusing; suggest rephrasing.

Thank you, yes. This should be: The average relatedness examined within sampling sites and overall sampling sites is the statistic test (observed in a red arrow).

27. Line 353 and elsewhere: Population declines can lead to a loss of genetic diversity, but that does not mean that: 1) population declines always cause declines in genetic diversity, or 2) that all populations with low diversity have undergone recent declines. This section seems to attribute the observed levels of genetic diversity to recent population declines, but this is not actually known. Elasmobranchs have some of the slowest rates of mutation among vertebrates, so genetic diversity accumulates slowly and can be low even in the absence of population declines. Suggest developing this section to be more comprehensive of genetic diversity in elasmobranchs, perhaps bringing in phylogeography (e.g. how recently might these populations been founded?)

Yes, I re-wrote this part of the Discussion.

28. Line 356: Levels of genetic diversity were not calculated for the central-southern ETP overall- they were calculated by sampling sites from what I can tell. Suggest analyzing genetic diversity for the identified populations to back up this statement. It also makes more sense from a management perspective to analyze data for each identified population.

Yes! I added these results.

29. Line 358-359: Take care with verbiage. Genetically distinct populations do not mean they resulted from independent evolutionary history. All populations of this species in the ETP likely have a common evolutionary history. This is evidenced by the presence of two common haplotypes shared across populations.

Yes, I re-wrote this part of the Discussion.

30. Line 367: It is stated that a bottleneck was not detected, but no data are presented to support this. Suggest either including bottleneck tests (with discussion on caveats of the various statistical approaches) or deleting the statement about the detection of bottleneck tests.

Yes, I consider deleting the statement is better. This is not a relevant result.

31. Line 373: The sentence on this line is confusing, suggest rephrasing.

Yes, I rephrased it the following way:

This pattern is mainly due to an uneven distribution of the two most common haplotypes, one is found in higher frequency in the Northern ETP while the other is found in higher frequency in the Central-southern ETP.

32. Line 376: The term “sub-population’ has a specific meaning for the IUCN species assessments, which is cited as the source of this definition. The IUCN definition of ‘sub-population’ is not the same as used in population genetics. I suggest the authors read this definition more carefully and rework this point. The data presented in this paper does not support further splitting the EP sub-population of this species, as per the IUCN definition. Within this region, the identification of distinct population units is important to inform management, so suggest focusing on that.

Thank you, yes I had not considered the strict definition of subpopulation of the IUCN, which specifies that they are groups with very little exchange. In this case I was referring specifically to a distinct population segments, defined under the Endangered Species Act as a vertebrate population or group of populations that is discrete from other populations of the species and significant in relation to the entire species.

33. Line 388-391; 397; 400-401; 436: The phrasing on these lines need some work as it is difficult to understand/follow. For example, line 388 mentions oceanographically dynamic regions and then uses the phrase ‘mixing zone’. Is this referring to a physical mixing zone or ‘mixing’ meaning gene flow?

Yes, in this study (Rodríguez-Zárate et al., 2018) make a simulation of what would happen if they freed a particle from a coastal area along the coast of Central America and Mexico, where would the particle drift depending on oceanographic conditions, so here they are referring to a physical mixing zone.

34. Line 400 mentions “high sampling effort” but not what locations fit this category. Etc.

Yes I rephrased this.

35. Line 407: What age classes were sampled in these other studies?

Thank you yes, I added this to the methods section. The Castillo-Olguin and colaborators (2009) study sampled juveniles (60-130cm long).Nance et al. (2011) paper were juveniles 1-3 years old except adults in Manta Island (TL ≥ 1.5m). Quintanilla et al. (2015) juveniles 30-50 TL except Malpelo Island (adults TL ≥ 1.5m).

36. Line 415: The discussion on relatedness could be built upon more. For example, what were the challenge for assessing sibship in this study? Could take some of the analysis further as well to support more discussion, as mentioned in previous comments.

Yes, I took some of these analyses further.

37. Lines 423-429: This ought to be discussed in the population structure section. Philopatry is the logical explanation for the observed population structure, so integrate there. I also suggest either doing additional analyses on relatedness to develop this section more fully, or use the relatedness statistics to support the population structure findings.

I understand that this paragraph relates to the population structure section. Philopatry in this case is generating the population structure observed, so I still consider that is should be in the section of Relatedness and Natal Philopatry.

38. Figure 1: Add sample sizes to caption or figure

Added

39. Figure 2: It is difficult to see the ticks or count them.

Yes, I added some lines for them to be more visible

40. Figure 5: What is the difference between the gray and black arrows? Specify in the caption.

Ready, the darker the arrows the higher the relative gene flow.

Reviewer #3.

Thank you so much for your valuable comments, here I address each of them:

1. Lines 50-51: I am not sure what the value of reporting Ho and allelic richness at microsatellite markers in the abstract is. These are very highly dependent on marker type (bialellic, tri-alellic, how where the markers selected).

You are right, this is not a very substantial result, I will eliminate it from the abstract.

2. Line 87: i would rephrase as "allele frequency differences through time", since divergence usually refers to accumulation of mutations, while here the authors are talking of the effects of drift.

I agree. I will rephrase it with the word differentiation instead of divergence.

3. Lines 214_216 and in general STRUCTURE analyses:The authors do not explain how they chose the value for K they report in the results. What method was used to choose K (Evanno’s method? Other)?

Yes, Evanno’s method was used to choose K

4. How do STRUCTURE plots look for different values of K? IS there any way to assess the admixture proportions? For SNPs data it's common to use evalAdmix (http://www.popgen.dk/software/index.php/EvalAdmix ), to evaluate pairwise correlation of residuals matrix between individuals. I am not sure whether there is an equivalent approach for microsatellite data.

Also, the admixture proportions reported in the figure are a bit difficult to reconcile with both the general population structure (Fst) and relative migration rates inferred: how is it that PAN and GUA show the lowest relative migration rates but the highest levels of admixture?

I re-ran the STRUCTURE analyses and present the plots for different values of K as you suggested. Levels of admixture now coincide with other population structure analyses.

5. I am also not sure why the Authors have not reported structure analyses and DAPC of the entire dataset (including the samples from previous studies).

Structure and DAPC analyses were done only for the locations where I had microsatellite loci genotype data. This was only for the locations of Costa Rica: Ojochal (OJO) and Cocos Island (ICO); Guatemala (GUA) and Panamá (PAN)

6. DivMigrate analyses: what measure of genetic differentiation was used to estimate relative migration patterns?

Dest was used to estimate relative migration patterns

7. Also please give more details on the method (including citation of the method implemented in divMigrate: Sunqvist et al 2016, Ecol Evol https://doi.org/10.1002/ece3.2096 ). How are relative migration rates scaled? i.e. is the highest migration rate given as 1? An important concern is that this method assumes migration-drift equilibrium, I doubt this is a reasonable assumptions when it comes to long-lived marine animals with large Ne whose habitat has been affected by glaciations. See for example Maisano-Delser et al paper in Heredity on black-tip reef sharks and Walsh et al. paper in Heredity on grey reef sharks. So these results need to be interpreted with caution (as the authors of the package diveRsity themselves say).

Yes, thank you I provide more details on this method. The “divMigrate” function was used to plot the relative migration levels and detect asymmetries in gene flow patterns, between pairs of population samples using DEST values of genetic differentiation (Sundqvist et al., 2016). This function plots sampling areas connected to every other by two connections that represent the two reciprocal gene flow components between any pair of locations (Sundqvist et al., 2016). This approach provides information on the direction of migration using relative migration scales (from 0 to 1) in which the highest migration rate given is 1 (Sundqvist et al., 2016).

Yes, these articles you mention make a thorough analysis of past and present demographics of these species. They have more statistical power, since they are using a large genomic data set of SNPs. Even with this statistical power, these authors mention how equilibrium models of population structure are not realistic and can give misleading results. They mention how increases in Ne can be confounded by increases in migration. They mention how population bottlenecks can also be mistaken for what really is a low number of migrants associated to a metapopulation structure. The genetic variability produces a similar pattern. Thank you for mentioning them to me, but I consider this analyses are a way to visualize other population structure analyses like DAPC, genetic differentiation indexes and STRUCTURE analyses. This graphs provide an idea of how much variation is shared between locations. Also knowing that sampling sizes are different, for example between Cocos Island (N = 15) and areas of the coast (N = 50) there is a big difference of sample sizes, this could be affecting the way connectivity is observed, being highest from the island to the coast, and lowest from the coast to the island. Still I mention in the results that the asymmetry of gene flow is not significant.

8. The authors mention low levels of genetic diversity (referring to pi and haplotype diversity). Low with respect to what? Other populations of the same species, other coastal sharks, or other marine fish? a pi of 0.0016 does not seem very low, but again this depends on what the reference is. What does seem interesting is the high degree of geographical heterogeneity in these estimates.

I re-wrote this section of the discussion. These values can be compared to other related species of sharks from the ETP, like Spyrna zygaena that has Haplotype diversity of 0.86 and nucleotide diversity of 0.26 (Feliz-Lopez., 2019). This species in the south pacific h=0.615 (Hernández., 2013). Sphyrna tiburo h = 0.932 Escatel-Luna., 2015. And S. lewini in the ETP with previous studies h=0.53 Nance et al., 2011 and Castillo-Olguin h=0.49.

9. Regarding migration rates, the authors mention that “Analysis of the extent and direction of gene flow showed no significant movement between coastal sampling sites.”. I am not sure how this conclusion was reached. There is no real analyses of the extent of gene flow, as measures of geneflow are "relative" (no absolute values ). Also the analyses assume migration-drift equilibrium and an island model, so the authors must be careful in interpreting the results.

Yes, this was written in a confusing way. What this analysis did was test if there was asymmetric gene flow between these areas, which was not found. The statement should be corrected the following way:

Analysis of the extent and direction of gene flow showed no significant asymmetric movement between coastal sampling sites.

10. The authors mention that the low diversity of mtDNA is consistent with overexploitation. (Lines 352-353). No evidence is presented that the low levels of genetic diversity of this species are linked in any way to recent population declines. Given the generation time of scalloped hammerheads i find this hypothesis extremely unlikely.

None of the analyses the author presented allow any inference of recent changes in Ne, and to my knowledge such analyses would require extensive two-locus statistics (LD) obtained for a great portion of the genome, along with good linkage maps (for example, using the method developed by Santiago: https://doi.org/10.1093/molbev/msaa169) . Also please note that most studies on genetic diversity of sharks concluded that patterns of genetic diversity were almost certainly unrelated to recent population declines but rather reflect the species history of colonization/range expansion/isolation. See work on grey nurse sharks (Stow et al 2006 Biology Letters and subsequent paper in Molecular Ecology about grey nurse sharks https://doi.org/10.1098/rsbl.2006.0441 https://doi.org/10.1111/j.1365-294X.2009.04377.x , and recent work on blacktip reef shark by Stefano Mona and Maisano-Delser https://doi.org/10.1038/s41437-018-0164- , as well as work on grey reef sharks just published in heredity https://doi.org/10.1038/s41437-022-00514-4 ).

If the authors want to test this hypothesis they could try to use the R package “migraine” to detect possible bottlenecks, but they should also be aware that these estimates could be biased by complex demographic histories (e.g. https://doi.org/10.1038/s41437-018-0164-0 ).

Thank you, I addressed these observations in the first paragraph of the Genetic diversity part of the Discussion

11. Lines 368-369: I am not sure what is meant by "non-detectable bottleneck effect". It could very well be that overharvesting may have reduced census size while having negligibly effects on effective population size. A non-detectable effect is not an effect at all?

Yes, I realize this is not clear. When I did the bottleneck analyses, there was none detected. So yes, it is not an effect. After consideration, I think that these results of the bottleneck analysis are not relevant. Other reviewers also suggested to eliminate this since it does not contribute much.

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 1

Johann Mourier

26 Jul 2022

PONE-D-22-04909R1Population structure and genetic connectivity of the scalloped hammerhead shark (Sphyrna lewini) across nursery grounds from the Eastern Tropical Pacific: implications for management and conservationPLOS ONE

Dear Dr. Elizondo-Sancho,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

Dear Mariana Elizondo-Sancho,

I have now received the comments of one of the original reviewer who only highlighted a minor point to address.

Please address it in a revised version and I will be happy to accept your work for publication in Plos One.

Kind regards

Johann

==============================

Please submit your revised manuscript by Sep 09 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Johann Mourier, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

Dear Mariana Elizondo-Sancho,

I have now received the comments of one of the original reviewer who only highlighted a minor point to address.

Please address it in a revised version and I will be happy to accept your work for publication in Plos One.

Kind regards

Johann

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #3: The authors addressed most of my concerns.

A further comment to be addressed in a minor revision (no need to send this back to me for review)

In the discussion about genetic diversity, the authors mention the slow mutation rate for mtDNA in sharks. Note that genetic diversity is a product of Ne and mutation rate, i.e. nucleotide diversity is determined by the mutation scaled population size (or the population scaled mutation rate, if you prefer). So that at equilibrium pi= = 4Ne (where is the mutation rate). So the authors are correct that the mutation rate alone does not explain low nucleotide diversity, but this does not suggest at all that nucleotide diversity could reflect overexploitation. It most likely (given generation time and time for pi to reach equilibrium) reflects historical demographic events. So the point that diversity is likely shaped by long term Ne or other demographic events should be made, in my opinion. Indeed, theta (and pi at equilibrium) are indeed a measure of population size given a mutation rate.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #3: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Dec 16;17(12):e0264879. doi: 10.1371/journal.pone.0264879.r004

Author response to Decision Letter 1


17 Aug 2022

Reviewer #3: The authors addressed most of my concerns.

A further comment to be addressed in a minor revision (no need to send this back to me for review)

In the discussion about genetic diversity, the authors mention the slow mutation rate for mtDNA in sharks. Note that genetic diversity is a product of Ne and mutation rate, i.e. nucleotide diversity is determined by the mutation scaled population size (or the population scaled mutation rate, if you prefer). So that at equilibrium pi= = 4Ne (where is the mutation rate). So the authors are correct that the mutation rate alone does not explain low nucleotide diversity, but this does not suggest at all that nucleotide diversity could reflect overexploitation. It most likely (given generation time and time for pi to reach equilibrium) reflects historical demographic events. So the point that diversity is likely shaped by long term Ne or other demographic events should be made, in my opinion. Indeed, theta (and pi at equilibrium) are indeed a measure of population size given a mutation rate

Thank you, I addressed all the suggestions of low nucleotide diversity reflecting overexploitation in the Manuscript. In order to do so, I eliminated the following citations from the reference list:

78. Chapman DD, Pinhal D, Shivji MS. Tracking the fin trade: Genetic stock identification in western Atlantic scalloped hammerhead sharks Sphyrna lewini. Endanger Species Res. 2009;

79. Baum JK, Myers RA, Kehler DG, Worm B, Harley SJ, Doherty PA. Collapse and conservation of shark populations in the Northwest Atlantic. Science (80- ). 2003;

Attachment

Submitted filename: Response to reviewers 17.08.2022.docx

Decision Letter 2

Johann Mourier

19 Aug 2022

Population structure and genetic connectivity of the scalloped hammerhead shark (Sphyrna lewini) across nursery grounds from the Eastern Tropical Pacific: implications for management and conservation

PONE-D-22-04909R2

Dear Dr. Elizondo-Sancho,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Johann Mourier, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Thank you for your effort in revising your manuscript.

I am now happy to recommend your work to be published in Plos One. I hope you enjoyed the reviewing process to help you improve your manuscript.

Kind regards

Johann

Reviewers' comments:

Acceptance letter

Johann Mourier

2 Sep 2022

PONE-D-22-04909R2

Population structure and genetic connectivity of the scalloped hammerhead shark (Sphyrna lewini) across nursery grounds from the Eastern Tropical Pacific: implications for management and conservation

Dear Dr. Elizondo-Sancho:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Johann Mourier

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Densities of individuals in discriminant function 1 of 9 nuclear microsatellite loci genotypes of Sphyrna lewini in three collection areas of Eastern Tropical Pacific: Guatemala (GUA), Costa Rica (OJO), Panama (PAN).

    (TIF)

    S2 Fig. Contemporary gene flow estimated from 9 microsatellite loci genotypes with the divMigrate function.

    Arrows represent the relative number of migrants and estimated direction of gene flow between Guatemala (GUA), Costa Rica (OJO), and Panama (PAN). The darker the arrow, the higher the relative number of migrants between sampling locations.

    (TIF)

    S3 Fig. Observed and expected distribution of average relatedness.

    Expected distribution of average relatedness based on the Wang estimator of Sphyrna lewini in each sampling site and overall sampling sites using 1000 iterations. The average relatedness observed within sampling site and overall sampling site is the statistic test (observed in a red arrow). The further away the statistic test is from the simulated bars, the greater the significance of the relatedness test.

    (TIF)

    S4 Fig. Distribution of the pairwise relatedness values of the Wang estimator of Sphyrna lewini within sampling sites and between sampling sites.

    (TIF)

    S5 Fig. Distribution of the pairwise relatedness values of the Wang estimator in females and males of Sphyrna lewini overall sampling sites.

    (TIF)

    S1 Table. Localities, the total number (n) and accession number of mitochondrial control region gene sequences for Sphyrna lewini from the Eastern Tropical Pacific.

    (PDF)

    S2 Table. Genetic diversity indices of each microsatellite loci from Sphyrna lewini individuals in the Eastern Tropical Pacific.

    Ta: Annealing temperature, Ho: Observed heterozygosity, He: Expected heterozygosity, Ar: Allelic richness, Na: Number of alleles, Ua: Unique alleles, Fis: Inbreeding coefficient.

    (PDF)

    S3 Table. Geographic distribution and frequency of mitochondrial control region haplotypes of Sphyrna lewini individuals from the Eastern Tropical Pacific.

    (PDF)

    S4 Table. Pairwise fixation indices (DEST and FST) with lower and upper 95% confidence intervals (CI), between sampling areas of the Eastern Tropical Pacific.

    Significant values α = 0.05, are presented in bold.

    (PDF)

    S1 File

    (XLSX)

    Attachment

    Submitted filename: PONE-D-22-04909.pdf

    Attachment

    Submitted filename: Response to Reviewers.docx

    Attachment

    Submitted filename: Response to reviewers 17.08.2022.docx

    Data Availability Statement

    All the mitochondrial control region sequences are available in Genbank accession numbers: OL692109-OL692337. Microsatellite loci genotypes will be uploaded as a Supporting Information file.


    Articles from PLOS ONE are provided here courtesy of PLOS

    RESOURCES