Abstract
Phosphorus starvation response (PHR) protein is an important transcription factor in phosphorus regulatory network, which plays a vital role in regulating the effective utilization of phosphorus. So far, the PHR genes have not been systematically investigated in cotton. In the present study, we have identified 22, 23, 41 and 42 PHR genes in G. arboreum, G. raimondii, G. hirsutum and G. barbadense, respectively. Phylogenetic analysis showed that cotton PHR genes were classified into five distinct subfamilies. The gene structure, protein motifs and gene expression were further investigated. The PHR genes of G. hirsutum from the same subfamily had similar gene structures, all containing Myb_DNA-binding and Myb_CC_LHEQLE conserved domain. The structures of paralogous genes were considerably conserved in exons number and introns length. The cis-element prediction in their promoters showed that genes were not only regulated by light induction, but also were related to auxin, MeJA, abscisic acid-responsive elements, of which might be regulated by miRNA. The expression analysis showed that the GhPHR genes were differentially expressed in different tissues under various stresses. Furthermore, GhPHR6, GhPHR11, GhPHR18 and GhPHR38 were significantly changed under low phosphorus stress. The results of this study provide a basis for further cloning and functional verification of genes related to regulatory network of low phosphorus tolerance in cotton.
Keywords: Cotton, PHR gene, Transcription factor, Low phosphorus stress, Expression
Introduction
Phosphorus (P) is a necessary mineral nutrient for plant growth and development, playing an important role in plant cell energy metabolism, enzyme reaction and signal transduction. Plants mainly absorb inorganic phosphorus from soil solution through roots. However, about 95~99% of phosphorus easily complexes with iron, calcium and aluminum in acidic and alkaline soils to produce insoluble phosphorus, which is not conducive to plant absorption and assimilation, becoming primary constraint to global crop production (Péret et al., 2011). For crop production, it is necessary to apply excessive phosphorus fertilizer to supplement the available phosphorus in the soil, but this process will cause serious environmental pollution. Therefore, for sustainable production in phosphorus deficient soil, it is necessary to explore and analyze the molecular basis of high-efficiency utilization of available phosphorus.
To adapt to a low phosphorus medium, plants have evolved a set of complex gene regulation networks, among which the most important members related to phosphate absorption and transport involved PHR1 (phosphate startup response 1), IPS1 (induced by phosphate startup 1), miR399 (microRNA399), PHO2 (phosphate 2) and PT (phosphate transport). In this complex regulatory network, PHR protein is an important transcription factor in plant phosphorus regulatory network, which plays a key role in signal transduction and regulation induced by phosphate starvation. At present, PHR genes of Arabidopsis thaliana, Oryza sativa, Zea mays, Glycine max and other species have been identified (Bustos et al., 2010; Woo et al., 2012; Lin et al., 2013; Guo et al., 2015; Xue et al., 2017; Xu et al., 2018). Arabidopsis PHR transcription factor directly regulates gene expression by binding to the sequence of phosphorus starvation induced gene P1BS (GNATATNC), and there is functional redundancy among members (Rubio et al., 2001). Arabidopsis PHR1 and PHL1 (PHR1-LIKE) transcription factors play a role in plant response to phosphorus starvation. PHR1 can bind to the promoters of many phosphorus starvation induced genes. The loss of AtPHR1 gene function in Arabidopsis will reshape membrane lipid metabolism, primary and secondary metabolism and photosynthesis, which will affect the growth rate of Arabidopsis root and crown and the accumulation of anthocyanins. PHR1 deletion mutation will affect the expression of some phosphorus starvation induced genes, resulting in the decrease of glucose, fructose, sucrose and starch contents in the mutants (Bustos et al., 2010; Nilsson et al., 2012; Pant et al., 2015). In rice, SPX family proteins are involved in phosphorus sensing and signaling by inhibiting the transcriptional activity of OsPHR2 (Lv et al., 2014). Rice contains genes OsPHR1, OsPHR2 and OsPHR3 with MYB-CC domain. The loss of any gene function will inhibit the elongation of rice root hair, and then affect the effective absorption of phosphate by plants. MiRNAs regulate plant response to low phosphorus by down regulating gene transcription (Zeng et al., 2014). MiR399 and miR827 are involved in the response of plants to low phosphorus stress (Pant et al., 2008; Lin et al., 2010). MiR399-PHO2 and miR827-NLA mediate the ubiquitination and degradation of phosphate transporters PHT1 and PHO1, and participate in the systematic regulation of phosphorus balance (Chiou et al., 2006; Liu et al., 2014).
Cotton is an important cash crop and raw material for textile industry in China, and plays an important role in the national economy (Ma et al., 2021). Phosphorus is one of the three necessary nutrient elements for cotton growth and development. It can promote cotton budding and flowering in the middle growth stage, promote cottonseed maturation, increase boll weight and open boll early in the later growth stage, which directly affects the yield and fiber quality of seed cotton. Under low phosphorus stress, the adaptive change of root morphology is an important biological basis for crops to make efficient use of soil phosphorus. It has been found the total root length, total root surface area, lateral root length and lateral root number increase in varying degrees under low phosphorus stress in wheat, maize and rice (Chiou & Lin, 2011; Guo et al., 2015; Sawers et al., 2017). When low phosphorus stress occurs, different crops will form a set of adaptive mechanisms to deal with stress. However, there are few studies on the response to low phosphorus stress of cotton (Lei et al., 2022).
In order to explore the candidate genes of low phosphorus tolerance in cotton, we identified the members of PHR gene family, and analyzed their gene structure, cis-acting elements and expression pattern based on four Gossypium genomes including the latest published genomes of allotetraploid cotton. It provides a reference for further revealing the biological function of PHR transcription factor under low phosphorus stress in cotton.
Material and method
Identification and analysis of cotton PHR gene family members
To obtain the members of PHR family genes, the amino acid sequences with conserved domain Myb DNA-binding (PF00249) and Myb_CC_LHEQLE (PF14379) of the PHR transcription factor family were searched from the four Gossypium genomes including Gossypium arboreum (CRI, version 1.0), G. raimondii (JGI, version 2.0), G. hirsutum(HEBAU, version 1.0) and G. barbadense (HEBAU, version 1.0) (Paterson et al., 2012; Wang et al., 2012; Li et al., 2014; Ma et al., 2021). The obtained sequences of PHR transcription factor were identified using SMART (http://smart.embl-heidelberg.de/) and CDD databases (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). The physical and chemical properties of the proteins were predicted using the online website ExPASY (https://web.expasy.org/protparam/).
Conserved domain and gene structure analysis of cotton PHR family members
The online website MEME (http://meme-suite.org/tools/meme) was used to predict the conserved motif of cotton PHR genes, and the number of motifs was set to 10, other parameters are the default settings. The genes structure of cotton PHR transcription factors were draw using online website GSDS (http://gsds.gao-lab.org/) based on cotton genome annotations.
Phylogenetic relationship of cotton PHR gene family members
The protein sequences of Arabidopsis thaliana PHR family gene were downloaded from Phytozome database (https://phytozome-next.jgi.doe.gov). The protein sequences of PHR family genes in cotton and Arabidopsis were compared by MEGA 11.0 software (Koichiro, Glen & Sudhir, 2021), and the phylogenetic tree was constructed by adjacency method (NJ). The bootstrap value was 1,000, the model is Poisson model. Finally, we showed the results using the online tool iTOL (Letunic & Bork, 2021).
Analysis of cis-acting elements of promoters of GhPHR gene family members
To understand the possible regulation and response mechanism of cotton PHR genes, the 1.5 kb upstream of genome sequences were obtained from each GhPHRs, and submitted to PlantCARE website (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) to predict cis-acting elements of promoters, and finally visualized by TBtools software (Chen et al., 2020).
Prediction of miRNA-target GhPHR genes
According to the principle of sequence complementarity, the regulatory miRNAs of GhPHR genes were predicted. The GhPHR target genes of miRNA were predicted using psRNATarget online software (https://www.zhaolab.org/psRNATarget/).
Differential expression analysis of GhPHR family members in roots under low phosphorus stress
Tissue expression specificity of GhPHR genes were analyzed by using RNA sequencing data of G. hirsutum ‘TM-1’ (Zhang et al., 2015) during different development stages and stress treatments downloaded from the NCBI Sequence Read Archive (PRJNA490626). To further screen GhPHR genes in response to low phosphorus stress, we generated and analyzed the genes expression in roots based on transcriptome data of a P-resistant accession under P deficient hydroponic conditions. The cotton seeds were grown in germination boxes containing quartz sand, and the seedlings were moved into half-strength Hoagland normal nutrient solution when the cotyledons had fully expanded. After 3 days, the nutrient solution was replaced with P-deficient and P-replete Hoagland nutrient solution, respectively. The roots of three cotton seedings were sampled at 0 day and 15 days for RNA-seq. The gene expression patten was drawn by Hemi 1.0 software (Deng et al., 2014) with log2 (1 + FPKM) values after averaging three replicates. The expression of six GhPHR genes were selected for further verification by qRT-PCR. All reactions were performed using the Roche LightCycler96 RealTime PCR System with three independent biological replicates, each with three technical replicates. The expression of GhUBQ14 was used as the internal control. Relative gene expression values were calculated using the 2−ΔCT method (Schmittgen & Livak, 2008).
Results
Identification of cotton PHR family gene members
To investigate the copy number variation of the PHR genes during cotton evolution, a comprehensive search was conducted for PHR genes across four cottons including G. arboreum, G. raimondii, G. hirsutum and G. barbadense. A total of 128 PHR gene sequences were detected in the four cotton species, 22, 23, 41, and 42 PHR genes were identified, respectively. The detailed information was listed in Tables S1 and S2. The results were further verified through the NCBI-CDD and SMART database. The results showed that the numbers of PHR genes in two diploid cotton species were almost similar as were those in two tetraploid cotton species. The number of PHR family genes in G. arboretum and G. raimondii were basically half in G. hirsutum and G. barbadense, indicating that the PHR family was relatively conserved, which conforms to the known evolutionary relationship in different cottons (Paterson et al., 2012).
The names of the PHR genes were determined according to the gene information of Arabidopsis and the locations on the chromosomes. The encoded protein of the PHR family genes in G. hirsutum contains 236~494 amino acid residues. The relative molecular mass is between 26.53 and 54.30 kDa, and the theoretical isoelectric point is between 5.50 and 9.82. Each of the family members contains Myb DNA-binding and Myb_CC_LHEQLE domain. Fourty-one PHR genes of G. hirsutum were distributed on 21 chromosomes except A05, A07, D01, D03 and D07 (Table 1). Subgenome A and subgenome D contained 22 and 19 sequences, respectively. The genes number in subgenome A was consistent with the genes number of GaPHR, and four GhPHR genes from subgenome D were missing compared to GrPHRs. This result indicated that subgenome D of G. hirsutum might have lost genes due to redundant gene functions during evolution.
Table 1. Information of PHR gene family in G. hirsutum.
| A subgenome of G. hirsutum | D subgenome of G. hirsutum | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Gene name | Gene ID | Protein length | MV (Da) | pI | Gene name | Gene ID | Protein length | MV (Da) | pI |
| GhPHR1 | GhM_A01G2399 | 380 | 42,304.2 | 7.76 | GhPHR23 | GhM_D02G1490 | 364 | 40,435.4 | 6.85 |
| GhPHR2 | GhM_A02G0277 | 303 | 33,075.2 | 6.52 | GhPHR24 | GhM_D04G2388 | 346 | 38,667.5 | 9.37 |
| GhPHR3 | GhM_A03G1365 | 364 | 40,578.5 | 6.85 | GhPHR25 | GhM_D05G1302 | 494 | 54,301.4 | 6.23 |
| GhPHR4 | GhM_A04G1918 | 346 | 38,712.5 | 9.34 | GhPHR26 | GhM_D06G2662 | 298 | 32,958.0 | 5.88 |
| GhPHR5 | GhM_A06G2674 | 298 | 32,865.9 | 6.11 | GhPHR27 | GhM_D06G2663 | 333 | 35,805.0 | 8.65 |
| GhPHR6 | GhM_A06G2675 | 333 | 35,829.1 | 8.65 | GhPHR28 | GhM_D08G0228 | 411 | 46,409.8 | 7.05 |
| GhPHR7 | GhM_A08G0240 | 417 | 47,059.5 | 6.86 | GhPHR29 | GhM_D08G1976 | 279 | 31,618.2 | 9.82 |
| GhPHR8 | GhM_A08G2024 | 279 | 31,659.3 | 9.78 | GhPHR30 | GhM_D08G2683 | 372 | 41,765.9 | 8.19 |
| GhPHR9 | GhM_A08G2740 | 411 | 46,419.1 | 8.69 | GhPHR31 | GhM_D08G2924 | 357 | 39,650.8 | 8.62 |
| GhPHR10 | GhM_A08G2986 | 348 | 38,638.6 | 8.77 | GhPHR32 | GhM_D09G1508 | 316 | 36,391.6 | 8.20 |
| GhPHR11 | GhM_A09G1611 | 315 | 36,353.5 | 8.05 | GhPHR33 | GhM_D09G1943 | 267 | 30,049.4 | 8.20 |
| GhPHR12 | GhM_A09G2040 | 267 | 29,998.3 | 8.20 | GhPHR34 | GhM_D10G0017 | 399 | 44,484.4 | 5.78 |
| GhPHR13 | GhM_A09G2485 | 253 | 27,983.4 | 5.97 | GhPHR35 | GhM_D10G1602 | 302 | 33,108.2 | 6.78 |
| GhPHR14 | GhM_A10G0026 | 433 | 48,090.4 | 5.50 | GhPHR36 | GhM_D11G1558 | 478 | 52,511.1 | 5.69 |
| GhPHR15 | GhM_A10G1517 | 302 | 33,070.1 | 6.25 | GhPHR37 | GhM_D11G3020 | 448 | 49,301.5 | 6.20 |
| GhPHR16 | GhM_A11G1564 | 478 | 52,622.2 | 5.69 | GhPHR38 | GhM_D11G3158 | 387 | 43,073.3 | 7.41 |
| GhPHR17 | GhM_A11G3088 | 418 | 46,179.0 | 5.97 | GhPHR39 | GhM_D12G2463 | 236 | 26,531.7 | 8.43 |
| GhPHR18 | GhM_A11G3236 | 387 | 43,196.4 | 6.88 | GhPHR40 | GhM_D13G0849 | 356 | 39,260.4 | 8.15 |
| GhPHR19 | GhM_A12G2578 | 236 | 26,730.9 | 8.43 | GhPHR41 | GhM_D13G1605 | 347 | 38,580.7 | 8.01 |
| GhPHR20 | GhM_A13G0904 | 309 | 34,021.4 | 8.07 | |||||
| GhPHR21 | GhM_A13G1449 | 374 | 41,288.3 | 8.17 | |||||
| GhPHR22 | GhM_A13G1727 | 347 | 38,480.6 | 8.33 | |||||
Three GhPHR genes were observed on chromosomes A09 and A13, while D09 and D13 only contained two genes. The A01 and A03 chromosomes contained one gene, but no GhPHR gene sequence was contained in D01 and D03. These results showed that the GhPHR genes might have been lost and duplicated in the process of cotton evolution, indicating a strong correlation between subgenome A and subgenome D (Paterson et al., 2012; Wang et al., 2018).
Phylogenetic analysis of the PHR gene family in cotton
To explore the phylogenetic relationship of the cotton PHR genes, we constructed a phylogenetic tree with the neighbor-joining method using 41 G. hirsutum, 42 G. babardence, 22 G. arboreum, 23 G. raimondii and 13 Arabidopsis PHR amino acid sequences (Fig. 1). All the PHR genes can be divided into five subgroups. The PHR genes number of G. hirsutum and G. barbadense was basically twice of G. arboreum and G. raimondii in each subgroup. This result was consistent with the previous analysis and conformed to the conserved evolutionary relationship in cottons. Among these subgroups, the largest subgroup V consisted of 12 GhPHRs, 12 GbPHRs, seven GaPHRs, seven GrPHRs and six AtPHRs, showing that has expanded considerably in two allotetraploid cottons. In contrast, subgroup III only included four GhPHRs, four GbPHRs, two GaPHRs, two GrPHRs and one AtPHRs, indicating might be a highly-conserved clade.
Figure 1. Phylogenic tree of the PHR family members in G. arboreum, G. raimondii, G. hirsutum, G. barbadense and Arabidopsis thaliana.
The unrooted phylogenic tree was constructed using MEGA 11.0 by neighbor-joining method. Numbers on branches were bootstrap portions from 1,000 replicates. The subgroups were marked in different colors.
Analyses of gene structures and protein motifs of PHR genes in G. hirsutum
Gene structure analysis of PHR gene family members showed that the gene structure of GhPHR members in the same subgroup was similar, and there was little difference in the number of exons of GhPHR members among different subgroups. Except for the GhPHR genes of class V which contained seven exons, most of the other GhPHR genes contained six exons (Fig. 2). Furthermore, these PHR protein sequences were submitted to MEME to discover conserved motifs. The adjacent clades carried similar motifs. Analysis of the conserved domains of GhPHR gene family members showed that Myb_DNA-binding and Myb_CC_LHEQLE were present in all GhPHR proteins and other motifs were functionally unknown motifs (Fig. 2). Among these, motif 4 occurred in class I, class II and class IV subgroups, motif 6 was unique to class II subgroup, motif 10 were unique to class IV subgroup, and motif 5 was unique to two of class I class II subgroup. It is worth noting that the GhPHR protein motif types of class II were different. Among them, there were eight motifs in GhPHR2, GhPHR15 and GhPHR35, only six motifs in GhPHR5 and GhPHR26, and seven motifs in the other five GhPHRs. These special conserved motifs may be the main factors enabling GhPHRs to participate in different biological functions.
Figure 2. Distributions of gene structure and conserved protein motifs in GhPHR genes.
(A) Gene structure of all GhPHR genes. (B) Conserved protein motifs of all GhPHR genes. The red boxes and gray lines represent the exon and intron, respectively. The lengths of the boxes and lines were scaled based on the length of the genes. Conserved motifs in the GhPHR proteins are indicated by colored boxes.
Analysis of cis-acting elements in the promoter of GhPHR family genes
To further clarify the possible regulatory mechanism of GhPHR family genes under abiotic stress, the promoter sequences were analyzed by using PlantCARE database. The results showed 13 types of cis-acting elements, including light responsiveness, salicylic acid responsiveness, gibberellin-responsiveness, MeJA-responsiveness, anaerobic induction, auxin-responsiveness, abscisic acid responsiveness and so on (Fig. 3). In terms of composition and quantity, the GhPHR genes contained an average of 18 cis-acting elements, all of which had light responsiveness elements. Among them, GhPHR6 and GhPHR19 contained the most types of response elements (10 kinds), while GhPHR3, GhPHR5, GhPHR7 and GhPHR40 contained the least cis-acting elements (three kinds). In terms of element types, 17 genes contained gibberellin—responsiveness elements including GhPHR1, GhPHR12 and GhPHR34. Thirty-one genes contained anaerobic induction elements including GhPHR5, GhPHR19, GhPHR24, and 11 genes contained auxin-responsiveness elements including GhPHR16, GhPHR20, GhPHR36. The results showed that the GhPHR genes were not only regulated by light induction, but also played a role during drought, anaerobic and other stresses. Among them, the promoter regions of GhPHR3, GhPHR5, GhPHR7 and GhPHR40 contained less cis elements, which were only related to light, MeJA, abscisic acid and anaerobic induction.
Figure 3. Cis-acting element analysis of PHR family members in G. hirsutum.
The colored boxes indicate different cis-elements in promoters of genes.
Prediction of the regulatory miRNA of PHR gene family
The online software psRNATarget was used to predict and analyze the regulatory miRNAs of GhPHR genes. The regulatory combinations of 33 miRNAs and PHR genes were predicted (Table S3). It was found that 12 miRNAs could regulate 16 PHR genes. Unpaired energy (UPE) is the energy required to unlock the secondary structure of the target gene miRNA target site. A lower UPE value indicates that miRNA is more likely to bind or cleave the target gene. This study showed some of the predicted results with an expected value less than or equal to 5. GhPHR21 and GhPHR32 can be recognized by miR396 and miR7510a, miR2949 and miR7491 at the same time, respectively, which may be regulated by these two miRNAs. GhPHR19 may be regulated by the sequence cleavage of miR482, GhPHR4 and GhPHR24 may be regulated by the transcriptional inhibition of miR827, GhPHR17 and GhPHR37 may be regulated by the sequence cleavage of miR2948-5p, and GhPHR23, GhPHR25 and GhPHR40 may be regulated by the transcriptional inhibition of miR2948-5p. In this study, the regulation modes of interaction combinations were different. Approximately 2/3 of the regulation modes belonged to sequence cleavage and 1/3 belonged to transcriptional inhibition (Table 2).
Table 2. Bioinformatic analysis of partial miRNA target sites.
| miRNA | Target genes | Expectation | Start | Sequence | End | Inhibition mode | |
|---|---|---|---|---|---|---|---|
| miR827a | GhPHR4 | 5.0 | miRNA | 1 | UUAGAUGACCAUCAACAAACA | 21 | Translation |
| : ::::::: ::::::.:.: | |||||||
| Target | 952 | GGAUUGUUGA-GGUCAUUUGA | 971 | ||||
| miR827b | GhPHR4 | 5.0 | miRNA | 1 | UUAGAUGACCAUCAACAAACA | 21 | Translation |
| : ::::::: ::::::.:.: | |||||||
| Target | 952 | GGAUUGUUGA-GGUCAUUUGA | 971 | ||||
| miR827c | GhPHR4 | 5.0 | miRNA | 1 | UUAGAUGACCAUCAACAAACA | 21 | Translation |
| : ::::::: ::::::.:.: | |||||||
| Target | 952 | GGAUUGUUGA-GGUCAUUUGA | 971 | ||||
| miR7491 | GhPHR11 | 4.0 | miRNA | 1 | UGGGAUCUUCGAGAGGAUUGAGCC | 24 | Translation |
| ::::::.: :::::::.: | |||||||
| Target | 324 | CCAGAAAUCCUUUGAAAGAUCCUA | 347 | ||||
| miR2949b | GhPHR12 | 4.0 | miRNA | 1 | UCUUUUGAACUGGAUUUGCCGA | 22 | Translation |
| ..:.:::: ::::::::: | |||||||
| Target | 497 | AGUCUGAGUCCAAUUCAAAAGA | 518 | ||||
| miR2949c | GhPHR12 | 4.0 | miRNA | 1 | UCUUUUGAACUGGAUUUGCCGA | 22 | Translation |
| ..:.:::: ::::::::: | |||||||
| Target | 497 | AGUCUGAGUCCAAUUCAAAAGA | 518 | ||||
| miR2949a-5p | GhPHR12 | 5.0 | miRNA | 1 | ACUUUUGAACUGGAUUUGCCGA | 22 | Translation |
| ..:.:::: :::::::: | |||||||
| Target | 497 | AGUCUGAGUCCAAUUCAAAAGA | 518 | ||||
| miR482a | GhPHR19 | 5.0 | miRNA | 1 | UCUUUCCUACUCCUCCCAUACC | 22 | Cleavage |
| ::::: .:::: :::.::: | |||||||
| Target | 620 | AUUAUGGAGGGAGAUGGAGAGA | 641 | ||||
| miR7510a | GhPHR21 | 4.5 | miRNA | 1 | AAGGUCAUGAUCUUUAGCGGCGUU | 24 | Cleavage |
| ::.: : ::..::::. ::.:::: | |||||||
| Target | 88 | AAUGGCACUGGAGAUUCUGGCCUU | 111 | ||||
| miR396a | GhPHR21 | 5.0 | miRNA | 1 | UUCCACAGCUUUCUUGAACUG | 21 | Cleavage |
| :: ::::::.::. ::::: | |||||||
| Target | 560 | AAGCUCAAGAGAGUCUUGGAA | 580 | ||||
| miR396b | GhPHR21 | 5.0 | miRNA | 1 | UUCCACAGCUUUCUUGAACUG | 21 | Cleavage |
| :: ::::::.::. ::::: | |||||||
| Target | 560 | AAGCUCAAGAGAGUCUUGGAA | 580 | ||||
| miR2948-5p | GhPHR40 | 4.5 | miRNA | 1 | UGUGGGAGAGUUGGGCAAGAAU | 22 | Translation |
| ::: ::::.. :::::..::: | |||||||
| Target | 46 | UUUCCUGCCUGCCUCUCUUACA | 67 |
Tissue expression analysis of GhPHR family genes
The expression of GhPHR family genes was investigated across different tissues and developmental stages of upland cotton. Most of these genes were expressed at varying levels across different tissues and developmental stages (Fig. 4). It was found that five GhPHR genes were the most commonly expressed in all tissues. A total of 13 GhPHRs were highly expressed in all tissues, indicating that these genes play an important role in all morphogenesis of cotton. Among them, GhPHR5 and GhPHR6 were highly expressed in leaves, while GhPHR13, GhPHR14, GhPHR26 and GhPHR27 were highly expressed in both roots and leaves. Combined with the cis-element structure of GhPHR promoters, it was speculated that they may play an important role in leaf photosynthesis. A total of eight GhPHRs were expressed across different tissues except fiber developmental stages, and the expression of other six GhPHR genes were low in different tissues. Altogether, the expression profiles of GhPHR genes showed that it plays a role in different tissues of cotton, among which GhPHR2, GhPHR5, GhPHR6 and GhPHR13 have obvious tissue expression specificity.
Figure 4. Expression profiles of GhPHR genes in different tissues.
The color represents the gene expression level based on public transcriptome data. The red and blue colors indicate a high and a low expression level, respectively.
Expression pattern of GhPHR genes in roots under low phosphorus stress
The expression of 41 GhPHR genes in roots showed that most GhPHR genes were affected under low phosphorus treatment, except that GhPHR4, GhPHR7, GhPHR12, GhPHR19, GhPHR24, GhPHR33 and GhPHR39 were not detected (Fig. 5). The expression of GhPHR1 and GhPHR11 decreased under low phosphorus stress but that of GhPHR3, GhPHR6, GhPHR17, GhPHR18, GhPHR27, GhPHR30 and GhPHR38 increased. Among them, expression level of GhPHR17, GhPHR30 and GhPHR38 was significantly higher than that before stress treatment. In addition, GhPHR5, GhPHR13, GhPHR15 and GhPHR26 maintained a high expression level. It should be noted that the expression of GhPHR11 was significantly lower under low phosphorus stress than under normal phosphorus treatment, and that of GhPHR18 was significantly higher than that of normal phosphorus treatment (Fig. 5). Further, we selected six differentially expressed GhPHR genes for verification by qRT-PCR, showing a consistent trend (Fig. 6). This provided further evidence that the six putative genes were closely associated with low-phosphorus tolerance.
Figure 5. Expression pattern of GhPHR genes in root under low phosphorus stress.
(A) Expression level of PHR genes at 0 d and 15 d under low and normal phosphorus condition, respectively. (B) Cotton seedlings of 15 d under low and normal phosphorus condition. The colorful scale of heat map indicates the relative expression levels where blue indicates low and red indicates high.
Figure 6. Relative expression level of six representative GhPHR genes.
(A) GhM_A01G2399. (B) GhM_A06G2675. (C) GhM_A09G1611. (D) GhM_A11G3236. (E) GhM_D08G2683. (F) GhM_D11G3158. Data represent mean ± SE of three biological replicates by qRT-PCR.
Discussion
Phosphorus deficiency is a major factor limiting crop yield. In cotton, the PHR genes have not been systematically investigated. In the present study, we have identified 22, 23, 41 and 42 PHR genes in G. arboreum, G. raimondii, G. hirsutum and G. barbadense, respectively. The GhPHR genes are differentially expressed in different tissues under various stresses. Furthermore, GhPHR6, GhPHR11, GhPHR18 and GhPHR38 were significantly changed under low phosphorus stress. These results provided a basis for low phosphorus tolerance in cotton.
Plants have evolved a series of morphological, physiological and molecular strategies to adapt to phosphorus deficiency (Veneklaas et al., 2012), including symbiosis with mycorrhizal fungi, secretion of organic acids, remodeling of root structure, and improving the expression of phosphorus transporters (Chiou & Lin, 2011; Sawers et al., 2017). Most of these strategies improve the utilization efficiency of phosphorus by enhancing the mobility of phosphorus in soil or the acquisition of phosphorus by roots. In recent years, genes and proteins related to low phosphorus stress have been found and identified. Among them, PHR is a MYB transcription factor, which plays an important role in plant response to low phosphorus stress (Bustos et al., 2010; Sega & Pacak, 2019). It has been reported that PHR1 and PHR1-like genes play a key role in the phosphorus signal regulation network of plants such as Arabidopsis (Karthikeyan et al., 2007), rice (Guo et al., 2015), soybeans (Xue et al., 2017), wheat (Chiou & Lin, 2011), maize (Lin et al., 2013; Sawers et al., 2017) and rape (Ren et al., 2012). In addition, genome-wide transcriptional analysis of Arabidopsis and rice showed that most phosphorus starvation response genes were induced and activated by AtPHR1 and OsPHR2 and their homologous genes AtPHL1, AtPHL2, OsPHR1 and OsPHR3 (Guo et al., 2015; Sun et al., 2016). In our study, the expression of GhPHR1 and GhPHR11 decreased but that of GhPHR6, GhPHR18, GhPHR30 and GhPHR38 increased under low phosphorus stress, we further verified the six genes by qRT-PCR, indicating closely associated with low-phosphorus tolerance.
Cis-acting elements regulate gene transcription by responding to different external signals, and then affect plant growth and development (Schmitz, Grotewold & Stam, 2022). Phosphorylation signal transduction and phosphorus starvation response are affected by light, sugar, plant hormones (auxin, ethylene, cytokinin and gibberellin), as well as oxygen (Karthikeyan et al., 2007; Lei et al., 2011; Klecker et al., 2014). For example, the expression of AtPHR1 is regulated by light and ethylene, and the response to phosphorus starvation is regulated by the promoter of AtPHR gene (Liu et al., 2017). In this study, 13 types of cis-acting elements were identified in the promoter of PHR genes. A large number of light response elements and hormone elements showed that the expression and regulation of PHR genes were affected by light and hormone. MiRNAs regulate plant response to low phosphorus by down regulating gene transcription (Zeng et al., 2014). MiR399 and miR827 are involved in the response of plants to low phosphorus stress (Pant et al., 2008; Lin et al., 2010). In this study, 12 cotton miRNAs such as miR396, miR482 and miR827 have the potential to regulate GhPHR genes, which may play a role in phosphorus absorption and transport in cotton.
Most PHR genes in maize, rice and sorghum are continuously expressed in all tissues, indicating that they may play an important role in regulating phosphorus uptake and transport (Lin et al., 2013; Xu et al., 2018). This study analyzed the tissue expression of cotton PHR family genes in roots, stem, leaves and so on, and found that there was tissue-specific expression of cotton PHR family genes, which was similar to that of other crops (Lin et al., 2013). In tissue expression analysis, it was found that the expression of GhPHRs in root was high, and there were gibberellin and auxin response elements related to stress resistance in the cis-acting elements of promoter. In addition, the expression of GhPHRs exceeded the expression level before stress after low phosphorus stress, so it is speculated that GhPHRs may be related to the remodeling of root morphology under abiotic stress.
In conclusion, 128 PHR genes were identified in cotton, 41 of which were in G. hirsutum. There GhPHR genes had great differences in the number of amino acids and isoelectric point characteristics. In addition, the promoter region of GhPHRs has different cis-acting elements related to light response, and biotic and abiotic stresses. Further, expression analysis of the genes of showed that GhPHR11 and GhPHR18 were significantly highly expressed in root under low phosphorus stress. This study has provided a foundation for subsequent functional study of PHR genes and the breeding of new cotton varieties.
Supplemental Information
Funding Statement
The work was supported by Key Scientific and Technological Research Projects of University in Hebei Province (QN2021073), the Key Research and Development Program of Hebei Province (21326314D), the Startup Fund from Hebei Agricultural University (YJ201824), and the Training Program of Innovation and Entrepreneurship for Undergraduates of Hebei Agricultural University (2020270). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Contributor Information
Yao Su, Email: 254211823@qq.com.
Zhengwen Sun, Email: nxszhw@hebau.edu.cn.
Additional Information and Declarations
Competing Interests
The authors declare that they have no competing interests.
Author Contributions
Yan Zhao performed the experiments, analyzed the data, prepared figures and/or tables, and approved the final draft.
Peiyu Li performed the experiments, analyzed the data, prepared figures and/or tables, and approved the final draft.
Huarui Wang analyzed the data, prepared figures and/or tables, and approved the final draft.
Jiping Feng performed the experiments, prepared figures and/or tables, and approved the final draft.
Yuxin Li performed the experiments, prepared figures and/or tables, and approved the final draft.
Shanshan Wang performed the experiments, prepared figures and/or tables, and approved the final draft.
Yuanjie Li performed the experiments, prepared figures and/or tables, and approved the final draft.
Yanyan Guo performed the experiments, prepared figures and/or tables, and approved the final draft.
Lin Li performed the experiments, prepared figures and/or tables, and approved the final draft.
Yao Su conceived and designed the experiments, authored or reviewed drafts of the article, and approved the final draft.
Zhengwen Sun conceived and designed the experiments, authored or reviewed drafts of the article, and approved the final draft.
Data Availability
The following information was supplied regarding data availability:
The raw measurements are available in the Supplemental Files.
References
- Bustos et al. (2010).Bustos R, Castrillo G, Linhares F, Puga MI, Rubio V, Pérez-Pérez J, Solano R, Leyva A, Paz-Ares J. A central regulatory system largely controls transcriptional activation and repression responses to phosphate starvation in Arabidopsis. PLOS Genetics. 2010;6(9):e1001102. doi: 10.1371/journal.pgen.1001102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen et al. (2020).Chen C, Chen H, Zhang Y, Thomas HR, Frank MH, He Y, Xia R. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Molecular Plant. 2020;13:1194–1202. doi: 10.1016/j.molp.2020.06.009. [DOI] [PubMed] [Google Scholar]
- Chiou et al. (2006).Chiou T, Aung K, Lin S, Wu C, Chiang S, Su C. Regulation of phosphate homeostasis by MicroRNA in Arabidopsis. The Plant Cell. 2006;18:412–421. doi: 10.1105/tpc.105.038943. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chiou & Lin (2011).Chiou T, Lin S. Signaling network in sensing phosphate availability in plants. Annual Review of Plant Biology. 2011;62:185–206. doi: 10.1146/annurev-arplant-042110-103849. [DOI] [PubMed] [Google Scholar]
- Deng et al. (2014).Deng W, Wang Y, Liu Z, Cheng H, Xue Y. HemI: a toolkit for illustrating heatmaps. PLOS ONE. 2014;9(11):e111988. doi: 10.1371/journal.pone.0111988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guo et al. (2015).Guo M, Ruan W, Li C, Huang F, Ming Z. Integrative comparison of the role of the PHOSPHATE RESPONSE1 subfamily in phosphate signaling and homeostasis in rice. Plant Physiology. 2015;168:1762–1776. doi: 10.1104/pp.15.00736. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Karthikeyan et al. (2007).Karthikeyan AS, Varadarajan DK, Jain A, Held MA, Carpita NC, Raghothama KG. Phosphate starvation responses are mediated by sugar signaling in Arabidopsis. Planta. 2007;225(4):907–918. doi: 10.1007/s00425-006-0408-8. [DOI] [PubMed] [Google Scholar]
- Klecker et al. (2014).Klecker M, Gasch P, Peisker H, Dörmann P, Schlicke H, Grimm B, Mustroph A. A shoot-specific hypoxic response of Arabidopsis sheds light on the role of the phosphate-responsive transcription factor PHOSPHATE STARVATION RESPONSE1. Plant Physiology. 2014;165(2):774–790. doi: 10.1104/pp.114.237990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Koichiro, Glen & Sudhir (2021).Koichiro T, Glen S, Sudhir K. MEGA11: molecular evolutionary genetics analysis version 11. Molecular Biology and Evolution. 2021;38(7):3022–3027. doi: 10.1093/molbev/msab120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lei et al. (2022).Lei K, Cheng J, An Y, Li X, An G. Organ specific transcriptome analysis of upland cotton (Gossypium hirsutum) in response to low phosphorus stress during early stage of growth. Soil Science and Plant Nutrition. 2022;68:463–472. doi: 10.1080/00380768.2022.2098533. [DOI] [Google Scholar]
- Lei et al. (2011).Lei M, Zhu C, Liu Y, Karthikeyan AS, Bressan RA, Raghothama KG, Liu D. Ethylene signalling is involved in regulation of phosphate starvation-induced gene expression and production of acid phosphatases and anthocyanin in Arabidopsis. The New Phytologist. 2011;189(4):1084–1095. doi: 10.1111/j.1469-8137.2010.03555.x. [DOI] [PubMed] [Google Scholar]
- Letunic & Bork (2021).Letunic I, Bork P. Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Research. 2021;49(W1):W293–W296. doi: 10.1093/nar/gkab301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li et al. (2014).Li F, Fan G, Wang K, Sun F, Yuan Y, Song G, Li Q, Ma Z, Lu C, Zou C, Chen W, Liang X, Shang H, Liu W, Shi C, Xiao G, Gou C, Ye W, Xu X, Zhang X, Wei H, Li Z, Zhang G, Wang J, Liu K, Kohel RJ, Percy RG, Yu JZ, Zhu YX, Wang J, Yu S. Genome sequence of the cultivated cotton Gossypium arboreum. Nature Genetics. 2014;46(6):567–572. doi: 10.1038/ng.2987. [DOI] [PubMed] [Google Scholar]
- Lin et al. (2013).Lin H, Gao J, Zhang Z, Shen Y, Lan H, Liu L, Xiang K, Zhao M, Zhou S, Zhang Y, Gao S, Pan G. Transcriptional responses of maize seedling root to phosphorus starvation. Molecular Biology Reports. 2013;40(9):5359–5379. doi: 10.1007/s11033-013-2636-x. [DOI] [PubMed] [Google Scholar]
- Lin et al. (2010).Lin S, Santi C, Jobet E, Lacut E, El Kholti N, Karlowski WM, Verdeil JL, Breitler JC, Périn C, Ko SS, Guiderdoni E, Chiou TJ, Echeverria M. Complex regulation of two target genes encoding SPX-MFS proteins by rice miR827 in response to phosphate starvation. Plant Cell Physiology. 2010;51(12):2119–2131. doi: 10.1093/pcp/pcq170. [DOI] [PubMed] [Google Scholar]
- Liu et al. (2014).Liu T, Lin W, Huang T, Chiou TJ. MicroRNA-mediated surveillance of phosphate transporters on the move. Trends in Plant Science. 2014;19(10):647–655. doi: 10.1016/j.tplants.2014.06.004. [DOI] [PubMed] [Google Scholar]
- Liu et al. (2017).Liu Y, Xie Y, Wang H, Ma X, Yao W, Wang H. Light and ethylene coordinately regulate the phosphate starvation response through transcriptional regulation of PHOSPHATE STARVATION RESPONSE1. The Plant Cell. 2017;29(9):2269–2284. doi: 10.1105/tpc.17.00268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lv et al. (2014).Lv Q, Zhong Y, Wang Y, Wang Z, Zhang L, Shi J, Wu Z, Liu Y, Mao C, Yi K. SPX4 negatively regulates phosphate signaling and homeostasis through its interaction with PHR2 in rice. The Plant Cell. 2014;26(4):1586–1597. doi: 10.1105/tpc.114.123208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ma et al. (2021).Ma Z, Zhang Y, Wu L, Zhang G, Sun Z, Li Z, Jiang Y, Ke H, Chen B, Liu Z, Gu Q, Wang Z, Wang G, Yang J, Wu J, Yan Y, Meng C, Li L, Li X, Mo S, Wu N, Ma L, Chen L, Zhang M, Si A, Yang Z, Wang N, Wu L, Zhang D, Cui Y, Cui J, Lv X, Li Y, Shi R, Duan Y, Tian S, Wang X. High-quality genome assembly and resequencing of modern cotton cultivars provide resources for crop improvement. Nature Genetics. 2021;53(9):1385–1391. doi: 10.1038/s41588-021-00910-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nilsson et al. (2012).Nilsson L, Lundmark M, Jensen PE, Nielsen TH. The Arabidopsis transcription factor PHR1 is essential for adaptation to high light and retaining functional photosynthesis during phosphate starvation. Physiologia Plantarum. 2012;144(1):35–47. doi: 10.1111/j.1399-3054.2011.01520.x. [DOI] [PubMed] [Google Scholar]
- Pant et al. (2008).Pant BD, Buhtz A, Kehr J, Scheible WR. MicroRNA399 is a long-distance signal for the regulation of plant phosphate homeostasis. The Plant Journal. 2008;53(5):731–738. doi: 10.1111/j.1365-313X.2007.03363.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pant et al. (2015).Pant BD, Burgos A, Pant P, Cuadros-Inostroza A, Willmitzer L, Scheible WR. The transcription factor PHR1 regulates lipid remodeling and triacylglycerol accumulation in Arabidopsis thaliana during phosphorus starvation. Journal of Experimental Botany. 2015;66(7):1907–1918. doi: 10.1093/jxb/eru535. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Paterson et al. (2012).Paterson AH, Wendel JF, Gundlach H, Guo H, Jenkins J, Jin D, Llewellyn D, Showmaker KC, Shu S, Udall J, Yoo MJ, Byers R, Chen W, Doron-Faigenboim A, Duke MV, Gong L, Grimwood J, Grover C, Grupp K, Hu G, Lee TH, Li J, Lin L, Liu T, Marler BS, Page JT, Roberts AW, Romanel E, Sanders WS, Szadkowski E, Tan X, Tang H, Xu C, Wang J, Wang Z, Zhang D, Zhang L, Ashrafi H, Bedon F, Bowers JE, Brubaker CL, Chee PW, Das S, Gingle AR, Haigler CH, Harker D, Hoffmann LV, Hovav R, Jones DC, Lemke C, Mansoor S, Ur Rahman M, Rainville LN, Rambani A, Reddy UK, Rong JK, Saranga Y, Scheffler BE, Scheffler JA, Stelly DM, Triplett BA, Van Deynze A, Vaslin MF, Waghmare VN, Walford SA, Wright RJ, Zaki EA, Zhang T, Dennis ES, Mayer KF, Peterson DG, Rokhsar DS, Wang X, Schmutz J. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres. Nature. 2012;492(7429):423–427. doi: 10.1038/nature11798. [DOI] [PubMed] [Google Scholar]
- Péret et al. (2011).Péret B, Clément M, Nussaume L, Desnos T. Root developmental adaptation to phosphate starvation: better safe than sorry. Trends in Plant Science. 2011;16(8):442–450. doi: 10.1016/j.tplants.2011.05.006. [DOI] [PubMed] [Google Scholar]
- Ren et al. (2012).Ren F, Guo Q, Chang L, Chen L, Zhao C, Zhong H, Li X. Brassica napus PHR1 gene encoding a MYB-like protein functions in response to phosphate starvation. PLOS ONE. 2012;7:e44005. doi: 10.1371/journal.pone.0044005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rubio et al. (2001).Rubio V, Linhares F, Solano R, Martín AC, Iglesias J, Leyva A, Paz-Ares J. A conserved MYB transcription factor involved in phosphate starvation signaling both in vascular plants and in unicellular algae. Genes Development. 2001;15(16):2122–2133. doi: 10.1101/gad.204401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sawers et al. (2017).Sawers RJH, Svane SF, Quan C, Grønlund M, Wozniak B, Gebreselassie MN, González-Muñoz E, Chávez Montes RA, Baxter I, Goudet J, Jakobsen I, Paszkowski U. Phosphorus acquisition efficiency in arbuscular mycorrhizal maize is correlated with the abundance of root-external hyphae and the accumulation of transcripts encoding PHT1 phosphate transporters. The New Phytologist. 2017;214(2):632–643. doi: 10.1111/nph.14403. [DOI] [PubMed] [Google Scholar]
- Schmittgen & Livak (2008).Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nature Protocols. 2008;3(6):1101–1108. doi: 10.1038/nprot.2008.73. [DOI] [PubMed] [Google Scholar]
- Schmitz, Grotewold & Stam (2022).Schmitz RJ, Grotewold E, Stam M. Cis-regulatory sequences in plants: their importance, discovery, and future challenges. The Plant Cell. 2022;34(2):718–741. doi: 10.1093/plcell/koab281. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sega & Pacak (2019).Sega P, Pacak A. Plant PHR transcription factors: put on a map. Genes. 2019;10(12):1018. doi: 10.3390/genes10121018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun et al. (2016).Sun L, Song L, Zhang Y, Zheng Z, Liu D. Arabidopsis PHL2 and PHR1 act redundantly as the key components of the central regulatory system controlling transcriptional responses to phosphate starvation. Plant Physiology. 2016;170(1):499–514. doi: 10.1104/pp.15.01336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Veneklaas et al. (2012).Veneklaas EJ, Lambers H, Bragg J, Finnegan PM, Lovelock CE, Plaxton WC, Price CA, Scheible WR, Shane MW, White PJ, Raven JA. Opportunities for improving phosphorus-use efficiency in crop plants. The New Phytologist. 2012;195(2):306–320. doi: 10.1111/j.1469-8137.2012.04190.x. [DOI] [PubMed] [Google Scholar]
- Wang et al. (2018).Wang M, Tu L, Yuan D, Zhu L, Shen C, Li J, Liu F, Pei L, Wang P, Zhao G, Ye Z, Huang H, Yan F, Ma Y, Zhang L, Liu M, You J, Yang Y, Liu Z, Huang F, Li B, Qiu P, Zhang Q, Zhu L, Jin S, Yang X, Min L, Li G, Chen L, Zheng H, Lindsey K, Lin Z, Udall JA, Zhang X. Reference genome sequences of two cultivated allotetraploid cottons, Gossypium hirsutum and Gossypium barbadense. Nature Genetics. 2018;51:224–229. doi: 10.1038/s41588-018-0282-x. [DOI] [PubMed] [Google Scholar]
- Wang et al. (2012).Wang K, Wang Z, Li F, Ye W, Wang J, Song G, Yue Z, Cong L, Shang H, Zhu S, Zou C, Li Q, Yuan Y, Lu C, Wei H, Gou C, Zheng Z, Yin Y, Zhang X, Liu K, Wang B, Song C, Shi N, Kohel RJ, Percy RG, Yu JZ, Zhu YX, Wang J, Yu S. The draft genome of a diploid cotton Gossypium raimondii. Nature Genetics. 2012;44(10):1098–1103. doi: 10.1038/ng.2371. [DOI] [PubMed] [Google Scholar]
- Woo et al. (2012).Woo J, Macpherson CR, Liu J, Wang H, Kiba T, Hannah MA, Wang X, Bajic VB, Chua NH. The response and recovery of the Arabidopsis thaliana transcriptome to phosphate starvation. BMC Plant Biology. 2012;12:62. doi: 10.1186/1471-2229-12-62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu et al. (2018).Xu Y, Liu F, Han G, Cheng B. Genome-wide identification and comparative analysis of phosphate starvation-responsive transcription factors in maize and three other gramineous plants. Plant Cell Reports. 2018;37(5):711–726. doi: 10.1007/s00299-018-2262-0. [DOI] [PubMed] [Google Scholar]
- Xue et al. (2017).Xue Y, Xiao B, Zhu S, Mo X, Liang C, Tian J, Liao H, Miriam G. GmPHR25, a GmPHR member up-regulated by phosphate starvation, controls phosphate homeostasis in soybean. Journal of Experimental Botany. 2017;68(17):4951–4967. doi: 10.1093/jxb/erx292. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zeng et al. (2014).Zeng H, Wang G, Hu X, Wang H, Du L, Zhu Y. Role of microRNAs in plant responses to nutrient stress. Plant and Soil. 2014;374:1005–1021. doi: 10.1007/s11104-013-1907-6. [DOI] [Google Scholar]
- Zhang et al. (2015).Zhang T, Hu Y, Jiang W, Fang L, Guan X, Chen J, Zhang J, Saski CA, Scheffler BE, Stelly DM, Hulse-Kemp AM, Wan Q, Liu B, Liu C, Wang S, Pan M, Wang Y, Wang D, Ye W, Chang L, Zhang W, Song Q, Kirkbride RC, Chen X, Dennis E, Llewellyn DJ, Peterson DG, Thaxton P, Jones DC, Wang Q, Xu X, Zhang H, Wu H, Zhou L, Mei G, Chen S, Tian Y, Xiang D, Li X, Ding J, Zuo Q, Tao L, Liu Y, Li J, Lin Y, Hui Y, Cao Z, Cai C, Zhu X, Jiang Z, Zhou B, Guo W, Li R, Chen Z. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement. Nature Biotechnology. 2015;33(5):531–537. doi: 10.1038/nbt.3207. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The following information was supplied regarding data availability:
The raw measurements are available in the Supplemental Files.






