Skip to main content
Journal of Animal Science logoLink to Journal of Animal Science
. 2022 Nov 14;100(12):skac377. doi: 10.1093/jas/skac377

Gastrointestinal dynamics, immune response, and nutrient digestibility of weanling pigs fed diets supplemented with enzymatically treated yeast1

Emmanuel O Alagbe 1, Ayodeji S Aderibigbe 2, Hagen Schulze 3, Kolapo M Ajuwon 4, Olayiwola Adeola 5,
PMCID: PMC9762883  PMID: 36373005

Abstract

The objective of this trial was to investigate the effect of enzymatically treated yeast (ETY) on the growth performance, nutrient digestibility, immune response, and gut health of weanling pigs. A total of 192 weanling pigs (6.0 ± 1.04 kg) were allocated to 4 corn and soybean-based diets with increasing concentrations of ETY (0, 1, 2, or 4 g/kg) for a 43-d trial. There were 8 replicate pens (4 replicate pens per sex) and 6 pigs per replicate. The experiment was set up as a randomized complete block design with body weight used as a blocking factor. Pigs had ad libitum access to water and diets for the duration of the study. There was no effect of ETY supplementation on the growth performance indices of weanling pigs. At day 14, there was a quadratic decrease (P < 0.05) in the apparent total tract digestibility (ATTD) of acid detergent fiber (ADF). At day 28, there was a linear increase (P < 0.05) in the ATTD of neutral detergent fiber and a quadratic decrease (P < 0.05) in the ATTD of ADF. On day 14, there was a linear increase (P < 0.05) in serum catalase activity with ETY supplementation. There was a linear increase (P < 0.01) in the gene expression of glutathione peroxidase-4 in the ileal mucosa of pigs. Increasing dietary ETY supplementation linearly decreased (P < 0.05) the gene expression of ileal peptide transporter 1. There was a tendency for a quadratic effect (P = 0.07) in the ileal villus height to crypt depth ratio with ETY supplementation. In addition, there was a tendency for a linear increase (P = 0.06) in ileal digesta butyrate with ETY supplementation. In conclusion, the current study demonstrated that dietary ETY supplementation could partly ameliorate the deleterious effects of post-weaning stress by enhancing the antioxidative status of weanling pigs. However, prolonged supplementation of ETY may be needed to see its effect on growth performance.

Keywords: antioxidation, butyrate, intestinal health, postbiotics, weanling pigs, yeast


Enzymatically treated yeast (ETY) did not significantly improve the growth performance of pigs. However, proof exists that ETY may enhance the antioxidative status of pigs, which may set them up for better lifetime development.

Introduction

The period following weaning is fraught with challenges that could affect piglet lifetime growth, proper development, and gut health (Khafipour et al., 2014). Although subtherapeutic levels of antibiotics have been used to ameliorate the deleterious effects associated with weaning, its usage has come under increased scrutiny in recent years (Marshall and Levy, 2011; Lillehoj et al., 2018). As a result of this, there has been a global search for alternative feed additives to maintain piglet health and performance. (Thacker, 2013; Lu et al., 2019; Zamojska et al., 2021).

The use of postbiotic enzymatically treated yeast (ETY) has garnered interest in helping pigs better cope with stressors associated with weaning (Kiarie et al., 2011). The ETY used in this study is obtained from non-genetically modified Saccharomyces cerevisiae yeast strains. It contains cell wall components (β 1,3/1,6-glucans and mannan-oligosaccharides)—40%, proteins—36%, and other intracellular bioactive constituents (Jach and Serefko, 2018). In addition, much of the protein present in ETY is in the form of short peptides, and this distinguishes ETY from other commercially available yeast products. The β-glucans and mannan components of yeast can confer beneficial effects on the growth performance and health of animals by modulating the immune system and improving gut health (Dritz et al., 1995; Samuelsen et al., 2014; Kim et al., 2019). The yeast intracellular components—peptides and minerals, have also been shown to promote intestinal development and improve feed palatability (Sauer et al., 2011; Oliveira et al., 2016; Jach and Serefko, 2018). Considering the beneficial effects of ETY components in animals, ETY could be advantageous to help transition piglets upon weaning.

We hypothesized that dietary inclusion of ETY having high nutritional value would improve the growth performance, nutrient digestibility, and health of newly weaned pigs suggesting a reduction in weaning-induced disruptions. Therefore, the objective of the current study was to evaluate the impact of ETY on the gastrointestinal milieu, antioxidant status, immune response, and performance of newly weaned pigs.

Materials and Methods

All the protocols of animal experiments in this study were reviewed and approved by the Purdue University Animal Care and Use Committee (West Lafayette, IN).

Animals, diets, and experimental design

A total of 192 weanling pigs (Duroc × Landrace × Yorkshire, average initial body weight (BW) of 6.0 ±1.04 kg, 18 to 23 days of age, 1:1 gilt to barrow ratio) were assigned to 4 treatments in a randomized complete block design with BW used as a blocking factor. Each dietary treatment consisted of 8 replicate pens (4 replicate pens per sex) and 6 pigs per replicate.

The experimental diets were fed as mash and comprised of a corn and soybean-based diet with four levels of ETY (LivaltaCell HY40; AB Agri Ltd., Peterborough, Cambridgeshire, UK) at 0, 1, 2, or 4 g/kg, with 2 phases; the pre-starter diets fed from days 0 to 14 and starter diets from days 14 to 43 (Table 1). The chemical composition of ETY is outlined in Supplementary Table S1. All the diets were prepared to meet the nutrient requirements of pigs outlined in NRC (2012). Phytase (Quantum blue; AB Vista, Marlborough, UK) was added to all experimental diets at 500 phytase units per kg, and titanium dioxide was added at 5 g/kg as an indigestible marker. Pigs had ad libitum access to water and diets for 43 d.

Table 1.

Ingredient and nutrient composition of diets, as-fed basis1

Pre-starter diet Starter diet
Ingredient, g/kg
Barley 50.00 50.00
Corn 308.50 445.66
Wheat middlings 40.00 40.00
Soybean meal (48% CP) 296.00 307.00
Fish meal 40.00 0.00
Dried whey 164.65 41.16
Soybean oil 30.00 35.00
Ground limestone 9.30 15.00
Monocalcium phosphate 1.50 5.90
Salt 3.35 3.35
Vitamin premix2 2.50 2.50
Mineral premix3 0.70 0.70
Selenium premix4 0.50 0.50
l-Lysine-HCl 4.80 5.20
dl-Methionine 1.10 1.16
l-Threonine 1.70 1.79
l-Tryptophan 0.40 0.08
Phytase premix5 20.00 20.00
Titanium dioxide premix6 25.00 25.00
Total 1,000.00 1,000.00
Lactose, g/kg (calculated) 120.00 30.00
Analyzed nutrient (g/kg as-fed)
Gross energy, kcal/kg 4,287.00 4,271.00
Crude protein 206.73 197.07
Crude fiber 33.43 34.80
Neutral detergent fiber 85.31 103.38
Acid detergent fiber 29.54 34.57

1Enzymatically treated yeast was added at 0, 1, 2, or 4 g/kg at the expense of corn in both pre-starter and starter diets.

2Provided the following quantities per kg of complete diet: vitamin A, 6,600 IU; vitamin D3, 660 IU; vitamin E, 44 IU; menadione, 2.2 mg; riboflavin, 8.8 mg; D-pantothenic acid, 22 mg; niacin, 33 mg; vitamin B12, 0.04 mg.

3Provided the following quantities per kg of complete diet: I, 0.26 mg; Mn, 12.0 mg; Cu, 6.33 mg; Fe, 136 mg; Zn, 104 mg.

4Provided 0.3 mg Se/kg of complete diet.

5Phytase product (Quantum blue; AB Vista, Marlborough, United Kingdom) contained 5,000 units/g; 1 g of phytase added to 199 g of corn for 200 times dilution and added at 20 g/kg to deliver 500 FTU/ kg diet for 1.5 g digestible P and 1.6 g Ca/kg.

6Prepared as 5 g titanium dioxide added to 20 g corn.

Sample collection and processing

Body weight and feed intake were recorded on days 14, 28, and 42 to determine the average daily gain (ADG), average daily feed intake (ADFI), and gain to feed ratio (G:F). Fresh fecal samples were collected for 3 consecutive days to represent each of days 14, 28, and 42. The topmost part of the fecal samples was carefully collected from the pen floor while disregarding the part touching the floor that may have been contaminated with urine or feed. Fecal samples were stored at −20 °C until further analysis for determination of the apparent total tract digestibility (ATTD) of nutrients. A diarrhea score system was set up with scores ranging from 1 to 4 (1 = normal feces, 2 = pasty feces, 3 = semi-liquid feces, and 4 = watery feces). Diarrhea scores were assessed visually by two independent evaluators, and results were recorded daily from days 0 to 14. Blood samples were collected via the anterior vena cava into non-heparinized tubes on days 14 and 43 from the heaviest pig in each pen. Serum was obtained by ­centrifugation of blood samples at 3,000 × g for 15 min at 4 °C, then the aspirated serum was stored appropriately at −80 °C until further analyses.

On day 43, animals were euthanized using a captive bolt (one pig per pen). Ileal segments were excised from the heaviest pig in each pen and flushed with cold phosphate buffered saline (VWR International); they were then cut longitudinally in half to expose the lumen and mucosa scraping was carried out with glass slides. Mucosal scrapings were subsequently placed in 1.5 mL of Trizol reagent (Invitrogen, Grand Island, NY) and rapidly frozen in liquid nitrogen at −80 °C for PCR analysis. A portion of the ileal mucosa scrapings was stored in empty 2 mL tubes for gut immune marker assays.

In addition, ileal digesta was immediately preserved using BioFreeze sampling kits (Alimetrics Diagnostics Ltd., Espoo, Finland) following the recommended protocol by the manufacturer. Samples preserved in Biofreeze buffer were used for volatile fatty acid (VFA), short-chain fatty acid (SCFA), and microbiome analysis because a preliminary study showed no response using cecal digesta. Portions of the ileal digesta were also collected in plastic containers and stored at −20 °C to determine the apparent ileal digestibility (AID) of nutrients. For the histology assay, tissue sections from the ileum and jejunum were excised, flushed in ice-cold 10% phosphate buffered saline (VWR International, Radnor, PA), stapled to cut-out cardboard, and placed in 10% buffered formalin (VWR International).

Total RNA extraction and reverse transcription

Total RNA was extracted from the mucosa stored in the Trizol reagent following the manufacturer’s protocol. The RNA concentrations were determined using the NanoDrop 1000 (Thermo Fisher Scientific, Waltham, MA), and the RNA integrity was verified using 1% agarose gel electrophoresis (Supplementary Figure S1). Subsequently, 2 mg of total RNA from each sample was reverse transcribed into cDNA using the MMLV reverse transcription reagent (Promega, Madison, WI). The cDNA was then diluted 1:10 with nuclease-free water (Ambion, Austin, TX) and stored at −80 °C, pending further analyses (Osho and Adeola, 2019).

Quantitative real-time PCR analysis

Real-time PCR of Interleukin 1β (IL-1β), Tumor necrosis factor alpha (TNFα), Interleukin 10 (IL-10), Claudin 4 (CLDN4), Occludin 1 (OCLN), Zonula occludens 1 (ZO-1), Sodium/glucose cotransporter 1 (SGLT1), Peptide transporter 1 (PEPT1), Heme oxygenase 1 (HMOX1), Superoxide dismutase-1 (SOD1), and Glutathione peroxidase-4 (GPX4) genes was carried out using the Bio-Rad CFX thermocycler (Bio-Rad, Temecula, CA) with the SYBR real-time PCR mix (Biotool, Houston, TX) in a total reaction volume of 20 μL. The PCR reactions were incubated for 3 min at 95 °C. Afterward, samples were subjected to 40 cycles of an amplification protocol as follows: 95 °C for 10 s, primer-specific annealing temperature for 30 s, and 95 °C for 10 s. A melt curve analysis was performed for each gene after the PCR run. The primers used are listed in Table 2. Primers were designed with the Primer Blast software (NCBI–NIH, Bethesda, MD). Samples were analyzed in duplicates, and the acceptable coefficient of variation was set at ≤5%. Relative gene expression was calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001) with normalization against the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Table 2.

Sequences of primers used for the real-time PCR analysis1

Target gene Primer sequence (5ʹ to 3ʹ) Annealing temperature (˚C) References
IL-1β F: CCAAAGAGGGACATGGAGAA 55.7 Oladele et al. (2021)
R: GGGCTTTTGTTCTGCTTGAG
HMOX1 F: CCTGCTCAACATTCAGCTGTT 59.7 Current study
R: GCGAGGGTCTCTGGTCCTTA
IL-10 F: TGCCCAGCTCAGCACTGCTC 62.2 Current study
R: CACTGGGCCGAAGGCAGCTC
PEPT1 F: CAGACTTCGACCACAACGGA 57.1 Oladele et al. (2021)
R: TTATCCCGCCAGTACCCAGA
SGLT1 F: AATGCGGCTGACATCTCTGT 62.3 Lu et al. (2020)
R: CCAACGGTCCCACGATTAGT
GPX4 F: AGAACGGCTGTGTGGTGAAG 59.5 Current study
R: TAGAGGTAGCACGGCAGGTC
SOD1 F: GTTGGAGACCTGGGCAATGT 61.4 Zhang et al. (2020)
R: TCAGACCATGGCATGAGGGA
Claudin-4 F: CTCTCGGACACCTTCCCAAG 59.5 Ogunribido et al. (2022)
R: GCAGTGGGGAAGGTCAAAGG
Occludin F: CTACTCGTCCAACGGGAAAG 59.5 Oladele et al. (2021)
R: ACGCCTCCAAGTTACCACTG
ZO-1 F: AAGCCCTAAGTTCAATCACAATCT 55.7 Ogunribido et al., 2022
R: ATCAAACTCAGGAGGCGGC
TNFα F: CGTCGCCCACGTTGTAGCCAAT 55.9 Oladele et al. (2021)
R: GCCCATCTGTCGGCACCACC
GAPDH F: GTTTGTGATGGGCGTGAAC 55.7 Oladele et al. (2021)
R: ATGGACCGTGGTCATGAGT

1F, Forward primer; R, Reverse primer; IL, Interleukin; HMOX1, Heme oxygenase 1; PEPT1, Peptide transporter 1; SGLT1, Sodium/glucose cotransporter 1; GPX4, Glutathione peroxidase 4; SOD1, Superoxide dismutase type 1; CLDN4, Claudin-4; OCLN, Occludin; ZO-1, Zonula occludens 1; TNFα, Tumor necrosis factor alpha; GAPDH, Glyceraldehyde-3-phosphate dehydrogenase.

Serum, microbiome, volatile fatty acid, and histology analyses

The activities of serum glutathione peroxidase (GPX) (Abcam, Waltham, MA), SOD (Cayman Chemical, Ann Arbor, MI), catalase (Cayman Chemical, Ann Arbor, MI), TNFα (Thermo Fisher Scientific, Waltham, MA), IL-10 (Thermo Fisher Scientific, Waltham, MA), and Immunoglobulin G (IgG) (Bethyl Lab, Montgomery, TX) were measured as recommended by the manufacturer. The concentrations of haptoglobin (HPT; Abcam, Waltham, MA) and C-reactive phase protein (CRP; Abcam, Waltham, MA) in serum samples were also measured using commercial ELISA kits. For all the ELISA analyses, serum samples and standards were analyzed in duplicates using a single assay to avoid inter-assay coefficient of variation (CV) and intra-assay CV of ≤5% was regarded as acceptable for all assays. Microbiome analysis, SCFA, and VFA analysis were carried out by Alimetrics Diagnostics Ltd., Espoo, Finland. QuantiBiom analysis panel (Alimetrics Diagnostics Ltd, Espoo, Finland) was used to quantify the total eubacterial numbers, SCFA and VFA concentration in the samples. The analyses were conducted with rRNA gene-targeted qPCR microbial assay using SYBR Green I chemistry and gas chromatography (Agilent Technologies, Santa Clara, CA, USA) using pivalic acid (Sigma-Aldrich, St. Louis, MO, USA) as an internal standard, respectively. ProxiMap analysis panel (Alimetrics Diagnostics Ltd, Espoo, Finland) was used to quantify selected abundant bacterial taxa present in the upper intestinal tract with rRNA gene-targeted qPCR microbial assay using SYBR Green I chemistry.

Tissue sections (4 mm) for histology were prepared and stained with hematoxylin and eosin by the Purdue Histology and Phenotyping Laboratory. Villus height and crypt depth were then measured using a microscope with an electronic camera (National Optical and Scientific Instruments, Inc., Schertz, TX) and an ImageJ macro (ImageJ open-source software version 1.8). Villus height was defined as the distance from the tip of the villus to the crypt mouth, whereas crypt depth was defined as the distance from the base of the villi to the submucosa. Villus height to crypt depth (VH:CD) ratio was also calculated.

Gut immune markers

The mucosa collected for gut immune assays were individually lysed in a radioimmunoprecipitation assay (RIPA) buffer (1% NP40, 50 mM Tris pH 7.4, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA) containing a protease inhibitor mixture (Sigma, P8340, 1:1,000 dilution) and 0.625 mg/mL N-ethylmaleimide (Sigma, E3876). After incubation on ice for 10 min, the supernatant was obtained by centrifugation at 1,000 × g for 15 min at 4 °C, followed by careful aspiration. The activities of IL-10, TNFα, and immunoglobulin A (IgA) were measured in the mucosa-derived supernatant following the protocol in each ELISA kit. The protein concentration of each sample was then used to normalize the gut immune markers using a Bicinchoninic Acid Assay (Thermo Fisher Scientific, Waltham, MA).

Chemical analysis

Experimental diets and fecal samples were ground using a centrifugal grinder (ZM 200; Retsch GmbH, Haan, Germany). All the ground samples were passed through a 0.5-mm screen. The ground experimental diets and fecal samples were then analyzed for dry matter (DM) by drying at 105 °C for 24 h in a forced-air drying oven (Precision Scientific Co., Chicago, IL; method 934.01; AOAC, 2006). Gross energy (GE) in samples was analyzed using an isoperibol bomb calorimeter (Parr 6200; Parr Instrument Co., Moline, IL), and nitrogen (N) using the combustion method (TruMac N; LECO Corp., St. Joseph, MI; method 990.03; AOAC, 2000). The concentration of titanium was measured following the technique outlined by Myers et al. (2004). The crude fiber (CF), acid detergent fiber (ADF), and neutral detergent fiber (NDF) were also measured using a fiber analyzer (Ankom 2000 Fiber Analyzer, Ankom Technology, Macedon, NY).

Calculations and statistical analysis

The ATTD (%) of nutrients in the experimental diets and fecal samples were determined using the following equations (Adeola, 2001):

ATTD,% = 100  [(TiI/TiO) × (No/Ni) × 100]

where TiI and TiO are the concentrations of titanium (g/kg DM) in diets and fecal samples, respectively; Ni and No are the concentration of nutrients (g/kg DM) in diets and fecal samples, respectively. The AID (%) of nutrients was also calculated using the same equation.

Outliers, defined as values outside of ±1.5 × interquartile range for all datasets, were identified and removed. The growth performance, AID of nutrients, gut immune markers, mRNA abundance, histology, microbiome, VFA, and SCFA data were analyzed by ANOVA using the General Linear Model (GLM) procedure of SAS (SAS Inst. Inc., Cary, NC). The experimental diets were the fixed effects, and replicate blocks were the random effects. The ATTD of nutrients was analyzed using the GLM procedure of SAS as a 4 × 3 factorial arrangement of treatments consisting of 4 diets at 3 ages (days 14, 28, and 42). The serum immune response data was analyzed using the GLM procedure of SAS as a 4 × 2 factorial arrangement of treatments consisting of 4 diets at 2 ages (days 14 and 43). The IML procedure of SAS was used to generate the contrast coefficients, which were used to test the linear and quadratic effects of increasing levels of ETY. The pen was considered as the experimental unit. The diarrhea frequency data were analyzed using the LOGISTIC procedure of SAS. The data were expressed as the proportion of diarrhea scores ≥2 divided by the total number of pens. Statistical significance and tendency were declared at P < 0.05 and 0.05 ≤ P ≤ 0.10, respectively.

Results

The average initial BW of pigs in this trial was 6.0 ±1.04 kg. There was no effect of ETY supplementation on the BW, ADG, ADFI, and G:F of weanling pigs (Table 3). The ATTD of DM, digestible energy (DE), N, and ADF increased (P < 0.05) with age (Table 4). On day 14, there was a quadratic response (P < 0.05) on the ATTD of ADF and there was a tendency (P = 0.07) for a linear decrease in the ATTD of DM on day 28. A linear increase (P < 0.05) in the ATTD of NDF was observed as well as a linear decrease (P < 0.05) in the ATTD of ADF on day 28. There was no ETY effect on the AID of DM, N, or ileal digestible energy (IDE) in pigs. There was no effect of ETY supplementation on the diarrhea scores of weanling pigs from days 0 to 14 (Supplementary Table S2).

Table 3.

Growth performance of weanling pigs fed diets supplemented with ETY from days 0 to 421

Diet BW, kg Days 0 to 14 Days 14 to 42 Days 0 to 42
ETY, g/kg Day 0 Day 14 Day 28 Day 42 ADG, g/d ADFI, g/d G:F, g/kg ADG, g/d ADFI, g/d G:F, g/kg ADG, g/d ADFI, g/d G:F, g/kg
0 6.0 8.0 12.8 22.0 142.4 196.0 707.4 499.5 805.0 620.4 380.9 602.0 632.0
1 6.1 8.1 12.9 22.0 144.2 196.6 734.1 495.6 819.6 606.5 378.5 611.9 620.8
2 6.0 8.0 12.4 20.8 142.4 198.9 715.9 458.9 719.8 639.1 353.4 546.2 649.0
4 6.0 8.0 12.9 22.0 140.3 189.5 741.7 502.1 807.6 624.1 381.5 601.6 636.4
SEM2 0.04 0.20 0.32 0.61 14.35 14.79 42.27 18.21 32.12 13.91 14.46 24.83 14.08
P-values
L - 0.899 0.999 0.949 0.885 0.746 0.641 0.978 0.784 0.577 0.932 0.764 0.594
Q - 0.810 0.451 0.237 0.922 0.753 0.996 0.133 0.126 0.665 0.209 0.203 0.697

1ETY, Enzymatically treated yeast; BW, Body weight; ADG, Average daily gain; ADFI, Average daily feed intake; G:F, Gain to feed ratio; L, Linear effect of ETY; Q, Quadratic effect of ETY. Data are means of 8 replicate pens.

2SEM, standard error of mean.

Table 4.

Apparent total tract digestibility (ATTD) of nutrients in weanling pigs fed ETY supplemented diets1

Age Diet Item
ETY, g/kg DM, % Energy, % DE, kcal/kg N, % CF, % ADF, % NDF, %
Day 14 0 79.5 76.7 3,289 69.8 43.2 18.7 59.2
1 77.5 74.5 3,186 68.6 36.1 17.4 61.7
2 80.0 77.6 3,324 71.2 45.6 27.8 53.7
4 79.8 77.0 3,310 69.3 40.1 20.6 59.4
Day 28 0 82.0 80.2 3,423 77.0 46.1 39.8 47.7
1 81.4 79.0 3,372 75.9 42.3 32.9 50.9
2 81.7 79.8 3,400 76.3 41.0 35.4 49.4
4 80.5 78.5 3,352 75.0 40.0 31.8 53.6
Day 42 0 83.0 82.2 3,510 77.7 47.2 40.5 48.1
1 82.4 81.8 3,492 77.5 39.9 35.2 51.2
2 83.0 82.5 3,517 78.2 43.7 35.9 51.6
4 82.5 82.0 3,499 77.0 44.7 38.7 49.6
SD2 1.59 1.80 76.79 2.91 7.37 6.31 4.45
P-values
Age <0.01 <0.01 <0.01 <0.05 0.373 <0.01 <0.01
L - Day 14 0.172 0.195 0.099 0.871 0.884 0.277 0.529
Q - Day 14 0.466 0.665 0.477 0.568 0.864 0.044 0.078
L - Day 28 0.073 0.136 0.118 0.216 0.145 0.044 0.021
Q - Day 28 0.694 0.994 0.908 0.981 0.453 0.412 0.861
L - Day 42 0.620 0.966 0.902 0.678 0.882 0.857 0.694
Q - Day 42 0.987 0.803 0.903 0.598 0.171 0.089 0.109

1ETY, Enzymatically treated yeast; DM, Dry matter; DE, Digestible energy; N, Nitrogen; CF, Crude fiber; ADF, Acid detergent fiber; NDF, Neutral detergent fiber; L, Linear effect of ETY; Q, Quadratic effect of ETY. Data are means of 8 replicate pens.

2SD, standard deviation of residuals for interaction.

The serum concentrations of CRP, SOD, catalase, IgG, and TNFα increased (P < 0.01) with age, but the levels of HPT and IL-10 decreased (P < 0.01) with age in pigs (Table 5). On day 14, there was a linear increase (P < 0.05) in catalase with ETY supplementation. There was tendency for a quadratic response (P = 0.06) on serum IgG with ETY supplementation on day 43. The effect of ETY on gut immune markers and relative abundance of genes on day 43 are summarized in Table 6. There was no effect of ETY on the gut immune mucosal markers—IL-10, TNFα, and IgA in weanling pigs. However, ETY supplementation linearly increased (P < 0.01) the gene expression of GPX4 in the ileal mucosa of pigs. The mRNA relative abundance of ileal mucosa CLDN4, ZO-1, HMOX1, IL-1β, TNFα, and IL-10 genes was unaffected by ETY inclusion in the diet of pigs.

Table 5.

Serum immune response markers in weanling pigs fed ETY supplemented diets at days 14 and 431

Age Diet Acute phase proteins Antioxidant markers Antibody Inflammatory
ETY, g/kg HPT, mg/mL CRP, ug/mL SOD, U/mL GPX, U/mL Catalase, U/mL IgG, mg/mL TNFα, ng/mL IL-10, pg/mL
Day 14 0 1.53 136.66 12.04 0.80 19.97 4.79 0.04 3.95
1 1.20 160.55 10.80 0.78 24.32 4.26 0.04 2.26
2 1.08 157.64 12.20 0.80 21.63 4.70 0.04 2.54
4 1.01 163.69 11.38 0.85 27.10 5.01 0.04 3.45
Day 43 0 0.15 266.45 87.06 0.74 39.37 6.26 0.13 0.84
1 0.24 300.36 97.76 0.80 39.75 8.10 0.13 1.75
2 0.63 288.59 85.13 0.59 40.63 11.09 0.14 0.76
4 0.42 289.94 93.59 0.79 39.46 8.96 0.13 1.53
SD2 0.886 86.972 6.423 0.336 5.249 3.733 0.015 2.101
P-values
Age <0.01 <0.01 <0.01 0.373 <0.01 <0.01 <0.01 <0.01
L - Day 14 0.290 0.599 0.939 0.762 0.025 0.833 0.811 0.933
Q - Day 14 0.559 0.738 0.989 0.832 0.833 0.814 0.713 0.146
L - Day 43 0.506 0.726 0.365 0.911 0.974 0.156 0.592 0.739
Q - Day 43 0.478 0.620 0.863 0.420 0.677 0.058 0.636 0.970

1ETY, Enzymatically treated yeast; HPT, Haptoglobin; CRP, C-Reactive Protein; SOD, Superoxide dismutase; GPX, Glutathione peroxidase; IgG, Immunoglobulin G; TNFα, Tumor necrosis factor α; IL-10, Interleukin 10; L, Linear effect of ETY; Q, Quadratic effect of ETY. Data are means of 8 replicate pens.

2SD, standard deviation of residuals for interaction.

Table 6.

Effect of ETY on gut immune markers and relative abundance of tight junction, antioxidant, and inflammatory genes in the ileal mucosa of weanling pigs at day 431

Diet Gut immune markers2 Relative abundance of genes3
Inflammatory Antibody Tight junction proteins Antioxidant Inflammatory
ETY, g/kg IL-10, ng/g TNFα, ng/g IgA, mg/g OC1 CLDN4 ZO-1 HMOX1 GPX4 SOD1 IL-1β TNFα IL-10
0 649.3 19.3 233.3 1.6 1.1 1.1 1.3 1.0 1.3 1.4 1.2 1.0
1 489.7 13.5 370.8 4.0 0.9 1.2 1.1 1.1 1.3 1.6 1.1 1.2
2 532.5 13.7 307.9 0.8 0.9 0.9 2.1 1.5 0.6 1.1 1.6 0.8
4 546.6 13.2 293.1 2.2 0.8 1.1 1.1 1.4 1.0 1.1 1.3 0.7
SD4 207.20 8.09 202.98 1.40 0.26 0.32 0.82 0.24 0.55 0.55 0.72 0.47
P-values
L 0.524 0.234 0.842 0.767 0.147 0.788 0.842 0.001 0.187 0.231 0.758 0.202
Q 0.257 0.344 0.610 0.993 0.541 0.474 0.122 0.111 0.179 0.969 0.586 0.854

1ETY, Enzymatically treated yeast; IL, Interleukin; TNFα, Tumor necrosis factor α; IgA, Immunoglobulin A; OCLN, Occludin 1; CLDN4, Claudin 4; ZO-1, Zonula occludens 1; HMOX1, Heme oxygenase 1; GPX4, Glutathione peroxidase 4; SOD1, Superoxide dismutase type 1; L, Linear effect of ETY; Q, Quadratic effect of ETY.

2Data are means of 8 replicate pens.

3Data are means of 8, 8, 7, and 8 replicate pens for the 0, 1, 2, and 4 g/kg ETY diets, respectively.

4SD, standard deviation.

The effect of ETY on the relative mRNA abundance of nutrient transporter genes and histomorphology of ileal and jejunal tissues in weanling pigs are outlined in Table 7. Dietary supplementation with ETY linearly decreased (P < 0.05) the gene expression of PEPT1 but had no effect on SGLT1 in the ileum of pigs. In addition, there was a tendency for a quadratic effect (P = 0.07) in ileal VH:CD ratio of pigs with ETY supplementation. There was also a tendency for a linear decrease in the jejunal VH (P = 0.07) and VH:CD ratio (P = 0.08). The effect of ETY on ileal digesta microbes and molar concentrations of short-chain fatty acids in weanling pigs at day 43 are summarized in Table 8. There was a tendency for a linear increase (P = 0.06) in ileal digesta butyrate concentration in pigs as ETY supplementation increased. The inclusion of ETY in the diet of pigs did not affect the molar concentrations of total SCFA or VFA. The proportion of Lactobacillus reuteri to total Lactobacillus showed a tendency to reduce (P = 0.07) with ETY supplementation.

Table 7.

Effect of ETY on the relative abundance of nutrient transporters genes in the ileal mucosa, and histomorphology of ileal and jejunal tissues in weanling pigs at day 431

Diet Ileum Jejunum
Nutrient transporter genes Histomorphology Histomorphology
ETY, g/kg SGLT1 PEPT1 VH, mm CD, mm VH:CD Ratio VH, mm CD, mm VH:CD Ratio
0 1.09 0.99 0.38 0.38 1.07 0.55 0.39 1.46
1 1.17 1.35 0.47 0.32 1.58 0.53 0.38 1.47
2 1.06 0.28 0.44 0.33 1.51 0.48 0.39 1.33
4 1.02 0.70 0.45 0.33 1.50 0.48 0.42 1.24
SD2 0.339 0.412 0.066 0.074 0.383 0.089 0.072 0.285
P-values
L 0.576 0.035 0.235 0.228 0.100 0.067 0.411 0.080
Q 0.805 0.242 0.124 0.215 0.069 0.487 0.505 0.934

1ETY, Enzymatically treated yeast; SGLT1, Sodium/glucose cotransporter 1; PEPT1, Peptide transporter 1; VH, Villus height; CD, Crypt depth; VH:CD ratio, Villus height to crypt depth ratio; L, Linear effect of ETY; Q, Quadratic effect of ETY. Data are means of 8, 8, 7, and 8 replicate pens for the 0, 1, 2, and 4 g/kg ETY diets, respectively.

2SD, standard deviation.

Table 8.

Effect of ETY on ileal digesta microbes (16S rRNA gene copies) and molar concentrations of short-chain fatty acids and volatile fatty acids in weanling pigs at day 431

Diet Relative proportion of total Lactobacillus2 T.E3 Total SCFA, mmol/kg4 Short chain fatty acids4 VFA, mmol/kg4
ETY, g/kg L.A L.R L.J Acetate, mmol/kg Propionate, mmol/kg Butyrate, mmol/kg Lactate, mmol/kg
0 35.9 2.6 0.9 11.25 8.8 2.6 0.7 0.6 8.0 2.9
1 36.4 2.4 11.1 11.30 9.6 3.0 0.6 0.8 8.8 3.2
2 43.7 1.7 4.2 11.13 8.3 3.0 0.8 0.8 7.5 3.2
4 34.9 0.5 5.0 11.14 7.4 3.1 0.7 0.8 6.4 3.3
SD5 21.10 2.41 9.97 0.346 3.65 0.75 0.33 0.21 4.18 0.70
P-values
L 0.976 0.071 0.819 0.392 0.313 0.264 0.949 0.059 0.342 0.261
Q 0.480 0.799 0.310 0.897 0.731 0.576 0.864 0.137 0.707 0.605

1ETY, Enzymatically treated yeast; SCFA, short-chain fatty acid; VFA, volatile fatty acid; LA, Lactobacillus amylovorus gene copies per g of sample; LR, Lactobacillus reuteri gene copies per g of sample; LJ, Lactobacillus johnsonii gene copies per g of sample; TE, Total eubacteria 16S rRNA gene copies per g of sample. Data are means of 8, 8, 7, and 8 replicate pens for the 0, 1, 2, and 4 g/kg ETY diets, respectively.

2Values were log-transformed for statistical analyses.

3Log-transformed values.

4Square root transformed values.

5SD, standard deviation.

Discussion

Post-weaning stress is common in weanling pigs; it is marked by changes in the physiology of pigs which can lead to reduced growth performance and a propensity for infections due to attenuated immunity (Ma et al., 2021). Alternative feed additives that can function as growth promoters and help boost the immunity of weanling pigs are of current interest. Out of many of these alternatives, postbiotics such as yeast extracts have garnered a decent amount of focus as potential replacements for antibiotic growth promoters due to their bioactive properties (Jach and Serefko, 2018; Anjos et al., 2019). Therefore, this study aimed to investigate the effect of ETY on the growth performance, nutrient digestibility, and gut health of weanling pigs.

In the current study, the inclusion of ETY in the diet of pigs did not impact growth performance. However, pigs fed increasing levels of ETY did not show any sign of a reduction in BW, ADG, ADFI, and G:F. This result is consistent with Sun et al. (2015), who reported that weaned pigs fed a yeast cell wall-based additive at 2 g/kg did not show exceptional improvements in BW, ADG, ADFI, and G:F at the end of week 1; and Hiss and Sauerwein (2003) who did not observe any difference in growth performance between the control pigs and pigs fed yeast-derived-β-glucan supplemented diets. However, our result contrasts with recently published data by Christensen et al. (2022) that showed an increased growth performance with ETY supplementation, specifically on the day 42 BW and ADG of pigs. The disparity in growth performance between this study and Christensen et al. (2022) could be due to experimental location variations and diet composition differences. In the current study, pigs fed the 2 g/kg ETY diet had numerically lower BW on day 42 compared with the pigs in other dietary groups, and this could be due to the reduction in ADFI in these pigs.

Several studies have used the ATTD of nutrients as indicators of efficiency of feed additives in swine (Mountzouris et al., 2006). The ATTD of DM, GE, DE, N, and ADF increased with age in this study. This indicates the pigs’ upregulated demand for nutrients and the corresponding efficiency in nutrient utilization as pigs grew older, which was expected. In addition, the activity of hindgut microbes is higher in older pigs and allows for higher ATTD of nutrients, except for N (Zhao et al., 2015; Pu et al., 2020). However, there was no effect of ETY on the ATTD of GE, N, and CF in the current study. This is contrary to a recent report by Christensen et al. (2022) that showed improvements in the ATTD of DM and GE with ETY supplementation. In the current study, there was an improvement in the ATTD of NDF with increasing dietary ETY on day 28. Previous studies have shown that dietary yeast culture may improve NDF digestibility (Plata et al., 1994) because of its modulatory effect on gut microbial population (Girard, 1996; Denev et al., 2007). It is pertinent to state that the decrease in ATTD of ADF in this study contrasts observations in previous studies using a yeast-supplemented diet in pigs (Chen et al., 2021). However, there was no effect of ETY on the ileal digestibility of nutrients in pigs, which is consistent with previous research (Chen et al., 2021). Similarly, ETY did not alleviate diarrhea occurrence in piglets. This result corroborates several studies highlighting post-weaning diarrhea as a multifactorial disorder, which makes it difficult to select a singular dietary solution (Rhouma et al., 2017).

Intestinal antioxidant capacity and gut immune markers are important indicators for evaluating the gut health of pigs (Hu et al., 2013; Kim et al., 2019; Wu et al., 2021). Catalase is an enzyme that functions in living cells to prevent ROS-mediated diseases and oxidative damage. The observed increase in serum concentration of catalase with ETY is likely due to the antioxidant characteristic of yeast β-glucan as reports have shown that it can increase the production of antioxidants via the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway to alleviate oxidative stress (Liu et al., 2020; He et al., 2022). On another note, the quadratic effect of ETY on serum IgG of pigs on day 43 is difficult to explain. However, the pigs fed the 0 g/kg ETY diet had the lowest serum IgG. There was no ETY effect on proinflammatory and ­anti-inflammatory ­cytokine concentrations in the serum. More research is needed to better understand the immune-modulating mode of action of ETY in healthy pigs but also challenged pigs.

The mRNA abundance of ileal mucosa tight junction proteins, antioxidants, and inflammatory markers were evaluated in pigs. We observed that ETY supplementation increased ileal mucosa mRNA expression of GPX4, but not HMOX1 or SOD1. The protein coded by the GPX4 gene is an important antioxidant enzyme that prohibits tissue damage by preventing membrane lipid peroxidation (Casañas-Sánchez et al., 2015). Due to the function of yeast β-glucan in oxidative defense, it is plausible that with higher dietary inclusion of ETY, there was a corresponding Nrf2 response that led to upregulated GPX4 expression in ETY-fed pigs, thereby reducing oxidative damage (He et al., 2022; Wang et al., 2022). Tight junction proteins such as OCLN, CLDN4, and ZO-1, are necessary for maintaining intestinal barrier functions and are indicators of a healthy intestinal epithelium in a pig (Lee et al., 2018). However, there was no effect of ETY inclusion on the mRNA expression of OCLN, CLDN4, and ZO-1. It has been reported that prolonged exposure to stress factors results in an impaired intestinal epithelial barrier. However, it is possible that post-weaning stress levels in this study were insufficient to monitor the effects on tight junction proteins (Yong et al., 2021).

The transition to solid feed for weanling pigs and a predisposition to infection is accompanied by intestinal damage, which could result in the upregulated engagement of peptide transporters, leading to excess peptide uptake (Vavricka et al., 2006; Moeser et al., 2007; Nosworthy et al., 2013). Pigs fed ETY-supplemented diets had lower ileal mucosal mRNA abundance of PEPT1. This suggests that ETY-fed pigs had no need for excess peptide uptake to repair intestinal epithelial lining, which would require further validating studies. On another note, the tendency for increased ileal digesta butyrate in ETY-fed pigs alludes to the beneficial effect of ETY in stimulating gut development (Tan et al., 2014; Kim, 2021). This is also supported by the tendency for improved ileal VH:CD ratio in ETY-fed pigs, as a lower VH:CD ratio is indicative of an increased tissue turnover rate and intestinal damage (Shen et al., 2009; Guilloteau et al., 2010; Kim and Duarte, 2021). However, the tendency for decreased jejunal VH and VH:CD ratio is contrary to reports by Christensen et al. (2022). There were no changes in the mRNA abundance of proinflammatory and anti-inflammatory cytokines in the ileal mucosa of pigs fed ETY-supplemented diets. This finding suggests that ETY may not necessarily upregulate the gene expression of cytokines in non-challenged pigs. The tendency for decreased Lactobacillus reuteri in the ileal digesta of pigs fed ETY diets was unusual compared to other studies that used yeast-supplemented feed (Zhang et al., 2021). This aberrance could be partly attributed to the high variability in the microbial data.

In conclusion, it is evident that post-weaning stress impairs proper gut development and the health of piglets. However, our results indicate that dietary supplementation of ETY in the diet of newly weaned pigs may reduce some of these disruptions. In this study, dietary ETY influenced intestinal health by promoting antioxidative activity without negatively affecting growth performance.

Supplementary Material

skac377_suppl_Supplementary_Material

Acknowledgment

The authors would thank Livalta, Peterborough, UK for their financial support toward this research. The authors also recognize Pat Jaynes for her technical assistance and all the members of the Adeola lab for their help regarding the fieldwork for this trial. Presented at the 15th International Symposium on Digestive Physiology of Pigs, May 17 to 20, Rotterdam, The Netherlands.

Glossary

Abbreviations

ADF

acid detergent fiber

ADFI

average daily feed intake

ADG

average daily gain

AID

apparent ileal digestibility

AOAC

Association of Official Analytical Chemists

ATTD

apparent total tract digestibility

BW

body weight

CD

crypt depth

cDNA

complementary deoxyribonucleic acid

CF

crude fiber

CLDN4

claudin 4

CRP

c-reactive phase proteins

DE

digestible energy

DM

dry matter

ETY

enzymatically treated yeast

FI

feed intake

G:F

gain to feed ratio

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

GE

gross energy

GLM

general linear model

GPX

glutathione peroxidase

GPX4

glutathione peroxidase-4

HMOX1

heme oxygenase 1

HPT

haptoglobin

IDE

ileal digestible energy

IgA

immunoglobulin A

IgG

immunoglobulin G

IL-10

interleukin 10

IL-1β

interleukin-1 beta

mRNA

messenger ribonucleic acid

N

nitrogen

NDF

neutral detergent fiber

NRC

National Research Council

Nrf2

nuclear factor erythroid 2-related factor 2

OCLN

occludin

PCR

polymerase chain reaction

PEPT1

peptide transporter 1

RIPA

radioimmunoprecipitation assay

ROS

reactive oxygen species

rRNA

ribosomal RNA

SCFA

short chain fatty acid

SGLT1

sodium/glucose cotransporter 1

SOD1

superoxide dismutase-1

TNFα

tumor necrosis factor alpha

VFA

volatile fatty acid

VH

villus height

VH:CD

villus height to crypt depth ratio

ZO-1

zonula occludens 1

Footnotes

1

Presented at the 15th International Symposium on Digestive Physiology of Pigs, May 17–20, 2022, Rotterdam, The Netherlands. Alagbe, E., H. Schulze, K. Ajuwon, and O. Adeola. 2022. Enzymatically treated yeast in diets of weanling pigs. Animal Science Proceedings, 13:224.

Contributor Information

Emmanuel O Alagbe, Department of Animal Sciences, Purdue University, West Lafayette, IN 47907, USA.

Ayodeji S Aderibigbe, Division of Agriculture Science, College of Agriculture and Food Sciences, Florida A&M University, Tallahassee, FL 32307, USA.

Hagen Schulze, Livalta, AB Agri Ltd, 64 Innovation Way, Lynchwood, Peterborough, PE2 6FL, UK.

Kolapo M Ajuwon, Department of Animal Sciences, Purdue University, West Lafayette, IN 47907, USA.

Olayiwola Adeola, Department of Animal Sciences, Purdue University, West Lafayette, IN 47907, USA.

Conflicts of Interest Statement

Hagen Schulze is an employee of Livalta, Peterborough, UK; other authors declare that there are no conflicts of interest in the current study.

Literature Cited

  1. Adeola, O. 2001. Digestion and balance techniques in pigs. In: Lewis A. J. and Southern L. L., editors. Swine nutrition. 2nd ed. Washington (DC):CRC Press; p. 903–916 doi: 10.1201/9781420041842.ch40 [DOI] [Google Scholar]
  2. Anjos, C. M., Gois F. D., dos Anjos C., de Souza Rocha V., de Sá e Castro D. E., Allaman I. B., Silva F. L., de Oliveira Carvalho P. L., Meneghetti C. B., and Costa L. B.. . 2019. Effects of dietary beta-glucans, glucomannans and mannan oligosaccharides or chlorohydroxyquinoline on the performance, diarrhea, hematological parameters, organ weight and intestinal health of weanling pigs. Livest. Sci 223:39–46. doi: 10.1016/j.livsci.2019.02.018. [DOI] [Google Scholar]
  3. AOAC. 2000. Official methods of analysis. 17th ed. Arlington (VA): Association of Official Analytical Chemists. [Google Scholar]
  4. AOAC. 2006. Official methods of analysis. 18th ed. Gaithersburg (MD): Association of Official Analytical Chemists. [Google Scholar]
  5. Casañas-Sánchez, V., Pérez J. A., Fabelo N., Quinto-Alemany D., and Díaz M. L.. . 2015. Docosahexaenoic (DHA) modulates phospholipid-hydroperoxide glutathione peroxidase (Gpx4) gene expression to ensure self-protection from oxidative damage in hippocampal cells. Front. Physiol. 6:1–11. doi: 10.3389/fphys.2015.00203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen, Y., Wang J. A., You J., Chen M. J., Tian M., Chen F., Zhang S., and Guan W.. . 2021. Effects of Saccharomyces cerevisiae fermentation product on the nutrient digestibility and ileal digesta characteristics of cannulated growing pigs fed corn- or barley-sorghum-based diets. Anim. Feed Sci. Technol. 274:114887. doi: 10.1016/j.anifeedsci.2021.114887. [DOI] [Google Scholar]
  7. Christensen, B., Zhu C., Mohammadigheisar M., Schulze H., Huber L. A., and Kiarie E. G.. . 2022. Growth performance, immune status, gastrointestinal tract ecology, and function in nursery pigs fed enzymatically treated yeast without or with pharmacological levels of zinc. J. Anim. Sci. 100:1–4. doi: 10.1093/jas/skac094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Denev, S., Tzonka P., Radulova P., Stancheva N., Staykova G., Beev G., Todorova P., and Tchobanova S.. . 2007. Yeast cultures in ruminant nutrition. Bulg. J. Agric. Sci 13:357–374. [Google Scholar]
  9. Dritz, S. S., Shi J., Kielian T. L., Goodband R. D., Nelssen J. L., Tokach M. D., Chengappa M. M., Smith J. E., and Blecha F.. . 1995. Influence of dietary β-glucan on growth performance, nonspecific immunity, and resistance to Streptococcus infection in weanling pigs. J. Anim. Sci. 73:3341–3350. doi: 10.2527/1995.73113341x. [DOI] [PubMed] [Google Scholar]
  10. Girard, I. D. 1996. Characterization of stimulatory activities from Saccharomyces cerevisiae on the growth and activities of ruminal bacteria. PhD Diss. University of Kentucky, Ann Arbor. [Google Scholar]
  11. Guilloteau, P., Martin L., Eeckhaut V., Ducatelle R., Zabielski R., and Van Immerseel F.. . 2010. From the gut to the peripheral tissues: The multiple effects of butyrate. Nutr. Res. Rev. 23:366–384. doi: 10.1017/S0954422410000247. [DOI] [PubMed] [Google Scholar]
  12. He, L., Guo J., Wang Y., Wang L., Xu D., Yan E., Zhang X., and Yin J.. . 2022. Effects of dietary yeast and beta-glucan supplementation on meat quality, antioxidant capacity and gut microbiota of finishing pigs. Antioxidants 11:1340. doi: 10.3390/antiox11071340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hiss, S., and Sauerwein H.. . 2003. Influence of dietary ß-glucan on growth performance, lymphocyte proliferation, specific immune response and haptoglobin plasma concentrations in pigs. J. Anim. Physiol. Anim. Nutr. (Berl) 87:2–11. doi: 10.1046/j.1439-0396.2003.00376.x. [DOI] [PubMed] [Google Scholar]
  14. Hu, C. H., Xiao K., Luan Z. S., and Song J.. . 2013. Early weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen-activated protein kinases in pigs. J. Anim. Sci. 91:1094–1101. doi: 10.2527/jas.2012-5796. [DOI] [PubMed] [Google Scholar]
  15. Jach, M. E., and Serefko A.. . 2018. Chapter 9 - Nutritional yeast biomass: Characterization and application. In: Holban A. M. and Grumezescu A. M. B. T.-D.. Microbiome and Health, editors. Handbook of Food Bioengineering: Academic Press. p. 237–270. doi: 10.1016/B978-0-12-811440-7.00009-0 [DOI] [Google Scholar]
  16. Khafipour, E., Munyaka P. M., Nyachoti C. M., Krause D. O., and Rodriguez-Lecompte J. C.. . 2014. Effect of crowding stress and Escherichia coli K88+ challenge in nursery pigs supplemented with anti-Escherichia coli K88+ probiotics. J. Anim. Sci. 92:2017–2029. doi: 10.2527/jas.2013-7043. [DOI] [PubMed] [Google Scholar]
  17. Kiarie, E., Bhandari S., Scott M., Krause D. O., and Nyachoti C. M.. . 2011. Growth performance and gastrointestinal microbial ecology responses of piglets receiving Saccharomyces cerevisiae fermentation products after an oral challenge with Escherichia coli (K88). J. Anim. Sci. 89:1062–1078. doi: 10.2527/jas.2010-3424. [DOI] [PubMed] [Google Scholar]
  18. Kim, C. H. 2021. Control of lymphocyte functions by gut microbiota-derived short-chain fatty acids. Cell. Mol. Immunol. 18:1161–1171. doi: 10.1038/s41423-020-00625-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kim, S. W., and Duarte M. E.. . 2021. Understanding intestinal health in nursery pigs and the relevant nutritional strategies. Anim. Biosci. 34:338–344. doi: 10.5713/ab.21.0010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim, K., Ehrlich A., Perng V., Chase J. A., Raybould H., Li X., Atwill E. R., Whelan R., Sokale A., and Liu Y.. . 2019. Algae-derived β-glucan enhanced gut health and immune responses of weaned pigs experimentally infected with a pathogenic E. coli. Anim. Feed Sci. Technol. 248:114–125. doi: 10.1016/j.anifeedsci.2018.12.004. [DOI] [Google Scholar]
  21. Lee, B., Moon K. M., and Kim C. Y.. . 2018. Tight junction in the intestinal epithelium: Its association with diseases and regulation by phytochemicals. J. Immunol. Res 2018:2645465. doi: 10.1155/2018/2645465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lillehoj, H., Liu Y., Calsamiglia S., Miyakawa M. E. F., Chi F., Cravens R. L., Oh S., and Gay C. G.. . 2018. Phytochemicals as antibiotic alternatives to promote growth and enhance host health. Vet. Res. 49:1–18. doi: 10.1186/s13567-018-0562-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Liu, L., Wu C., Chen D., Yu B., Huang Z., Luo Y., Zheng P., Mao X., Yu J., Luo J., . et al. 2020. Selenium-enriched yeast alleviates oxidative stress-induced intestinal mucosa disruption in weaned pigs. I. Peluso, editor. Oxid. Med. Cell. Longev 2020:5490743. doi: 10.1155/2020/5490743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Livak, K. J., and Schmittgen T. D.. . 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Method. 408:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  25. Lu, H., Wilcock P., Adeola O., and Ajuwon K. M.. . 2019. Effect of live yeast supplementation to gestating sows and nursery piglets on postweaning growth performance and nutrient digestibility. J. Anim. Sci. 97:2534–2540. doi: 10.1093/jas/skz150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lu, H., Shin S., Kuehn I., Bedford M., Rodehutscord M., Adeola O., and Ajuwon K. M.. . 2020. Effect of phytase on nutrient digestibility and expression of intestinal tight junction and nutrient transporter genes in pigs. J. Anim. Sci. 98:1–12. doi: 10.1093/jas/skaa206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ma, D., Guedes J. M., Duttlinger A. W., Johnson J. S., Zuelly S. M., Lay D. C., Richert B. T., and Kim Y. H. B.. . 2021. Impact of L-glutamine as replacement of dietary antibiotics during post-weaning and transport recovery on carcass and meat quality attributes in pigs. Livest. Sci 244:104350. doi: 10.1016/j.livsci.2020.104350. [DOI] [Google Scholar]
  28. Marshall, B. M., and Levy S. B.. . 2011. Food animals and antimicrobials: Impacts on human health. Clin. Microbiol. Rev. 24:718–733. doi: 10.1128/CMR.00002-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Moeser, A. J., Vander Klok C., Ryan K. A., Wooten J. G., Little D., Cook V. L., and Blikslager A. T.. . 2007. Stress signaling pathways activated by weaning mediate intestinal dysfunction in the pig. Am. J. Physiol. Gastrointest. Liver Physiol. 292:173–181. doi: 10.1152/ajpgi.00197.2006. [DOI] [PubMed] [Google Scholar]
  30. Mountzouris, K. C., Xypoleas I., Kouseris I., and Fegeros K.. . 2006. Nutrient digestibility, faecal physicochemical characteristics and bacterial glycolytic activity of growing pigs fed a diet supplemented with oligofructose or trans-galactooligosaccharides. Livest. Sci. 105:168–175. doi: 10.1016/j.livsci.2006.06.003. [DOI] [Google Scholar]
  31. Myers, W., Ludden P. A., Nayigihugu V., and Hess B.. . 2004. Technical note: A procedure for the preparation and quantitative ­analysis of samples for titanium dioxide. J. Anim. Sci. 82:179–183. doi: 10.2527/2004.821179x. [DOI] [PubMed] [Google Scholar]
  32. Nosworthy, M. G., Bertolo R. F., and Brunton J. A.. . 2013. Ontogeny of dipeptide uptake and peptide transporter 1 (PepT1) expression along the gastrointestinal tract in the neonatal Yucatan miniature pig. Br. J. Nutr. 110:275–281. doi: 10.1017/S0007114512005041. [DOI] [PubMed] [Google Scholar]
  33. NRC. 2012. Nutrient requirements of swine. 11th ed. Washington (DC): National Academic Press. [Google Scholar]
  34. Ogunribido, T. Z., Bedford M. R., Adeola O., and Ajuwon K. M.. . 2022. Effects of supplemental myo-inositol on growth performance and apparent total tract digestibility of weanling piglets fed reduced protein high-phytate diets and intestinal epithelial cell proliferation and function. J. Anim. Sci. 100:1–11. doi: 10.1093/jas/skac187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Oladele, P., Li E., Lu H., Cozannet P., Nakatsu C., Johnson T., Adeola O., and Ajuwon K. M.. . 2021. Effect of a carbohydrase admixture in growing pigs fed wheat-based diets in thermoneutral and heat stress conditions. J. Anim. Sci. 99:1–10. doi: 10.1093/jas/skab254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Oliveira, R., Haese D., Kill J., Lima A., Malini P., and Thompson G.. . 2016. Palatability of cat food with sodium pyrophosphate and yeast extract. Ciência Rural 46:2202–2205. doi: 10.1590/0103-8478cr20151651. [DOI] [Google Scholar]
  37. Osho, S. O., and Adeola O.. . 2019. Impact of dietary chitosan oligosaccharide and its effects on coccidia challenge in broiler chickens. Br. Poult. Sci. 60:766–776. doi: 10.1080/00071668.2019.1662887. [DOI] [PubMed] [Google Scholar]
  38. Plata, F. P., Mendoza M G. D., Bárcena-Gama J. R., and Gonzalez M S.. . 1994. Effect of a yeast culture (Saccharomyces cerevisiae) on neutral detergent fiber digestion in steers fed oat straw based diets. Anim. Feed Sci. Technol. 49:203–210. doi: 10.1016/0377-8401(94)90046-9. [DOI] [Google Scholar]
  39. Pu, G., Li P., Du T., Niu Q., Fan L., Wang H., Liu H., Li K., Niu P., Wu C., . et al. 2020. Adding appropriate fiber in diet increases diversity and metabolic capacity of distal gut microbiota without altering fiber digestibility and growth rate of finishing pig. Front. Microbiol. 11:533. doi: 10.3389/fmicb.2020.00533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Rhouma, M., Fairbrother J. M., Beaudry F., and Letellier A.. . 2017. Post weaning diarrhea in pigs: Risk factors and non-colistin-based control strategies. Acta. Vet. Scand. 59:31. doi: 10.1186/s13028-017-0299-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Samuelsen, A. B. C., Schrezenmeir J., and Knutsen S. H.. . 2014. Effects of orally administered yeast-derived beta-glucans: A review. Mol. Nutr. Food Res. 58:183–193. doi: 10.1002/mnfr.201300338. [DOI] [PubMed] [Google Scholar]
  42. Sauer, N., Mosenthin R., and Bauer E.. . 2011. The role of dietary nucleotides in single-stomached animals. Nutr. Res. Rev. 24:46–59. doi: 10.1017/S0954422410000326. [DOI] [PubMed] [Google Scholar]
  43. Shen, Y. B., Piao X. S., Kim S. W., Wang L., Liu P., Yoon I., and Zhen Y. G.. . 2009. Effects of yeast culture supplementation on growth performance, intestinal health, and immune response of nursery pigs. J. Anim. Sci. 87:2614–2624. doi: 10.2527/jas.2008-1512. [DOI] [PubMed] [Google Scholar]
  44. Sun, Y., Park I., Guo J., Weaver A. C., and Kim S. W.. . 2015. Impacts of low-level aflatoxin in feed and the use of modified yeast cell wall extract on growth and health of nursery pigs. Anim. Nutr. 1:177–183. doi: 10.1016/j.aninu.2015.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Tan, J., McKenzie C., Potamitis M., Thorburn A. N., Mackay C. R., and Macia L.. . 2014. Chapter three - The role of short-chain fatty acids in health and disease. In: Alt F. W. B. T.-A., editor. Advances in Immunology Vol. 121. Academic Press. p. 91–119. doi: 10.1016/B978-0-12-800100-4.00003-9. [DOI] [PubMed] [Google Scholar]
  46. Thacker, P. A. 2013. Alternatives to antibiotics as growth promoters for use in swine production: A review. J. Anim. Sci. Biotechnol. 4:35. doi: 10.1186/2049-1891-4-35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Vavricka, S. R., Musch M. W., Fujiya M., Kles K., Chang L., Eloranta J. J., Kullak-Ublick G. A., Drabik K., Merlin D., and Chang E. B.. . 2006. Tumor necrosis factor-alpha and interferon-gamma increase PepT1 expression and activity in the human colon carcinoma cell line Caco-2/bbe and in mouse intestine. Pflugers Arch. 452:71–80. doi: 10.1007/s00424-005-0007-8. [DOI] [PubMed] [Google Scholar]
  48. Wang, T., Cheng K., Li Q., and Wang T.. . 2022. Effects of yeast hydrolysate supplementation on intestinal morphology, barrier, and anti-inflammatory functions of broilers. Anim. Biosci. 35:858–868. doi: 10.5713/ab.21.0374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wu, Y., Li X., Liu H., Du Y., Zhou J., Zou L., Xiong X., Huang H., Tan Z., and Yin Y.. . 2021. A water-soluble β-glucan improves growth performance by altering gut microbiome and health in weaned pigs. Anim. Nutr. 7:1345–1351. doi: 10.1016/j.aninu.2021.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Yong, Y., Li J., Gong D., Yu T., Wu L., Hu C., Liu X., Yu Z., Ma X., Gooneratne R., . et al. 2021. ERK1/2 mitogen-activated protein kinase mediates downregulation of intestinal tight junction proteins in heat stress-induced IBD model in pig. J. Therm. Biol. 101:103103. doi: 10.1016/j.jtherbio.2021.103103. [DOI] [PubMed] [Google Scholar]
  51. Zamojska, D., Nowak A., Nowak I., and Macierzyńska-Piotrowska E.. . 2021. Probiotics and postbiotics as substitutes of antibiotics in farm animals: A review. Animal. 11:3431. doi: 10.3390/ani11123431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Zhang, Y., Dong Z., Yang H., Liang X., Zhang S., Li X., Wan D., and Yin Y.. . 2020. Effects of dose and duration of dietary copper administration on hepatic lipid peroxidation and ultrastructure alteration in piglets’ model. J. Trace Elem. Med. Biol. 61:126561. doi: 10.1016/j.jtemb.2020.126561. [DOI] [PubMed] [Google Scholar]
  53. Zhang, G., Zhao J. B., Dong W. X., Song X. M., Lin G., Li D. F., and Zhang S.. . 2021. Yeast-derived mannan-rich fraction as an alternative for zinc oxide to alleviate diarrhea incidence and improve growth performance in weaned pigs. Anim. Feed Sci. Technol. 281:115111. doi: 10.1016/j.anifeedsci.2021.115111. [DOI] [Google Scholar]
  54. Zhao, W., Wang Y., Liu S., Huang J., Zhai Z., He C., Ding J., Wang J., Wang H., Fan W., . et al. 2015. The dynamic distribution of porcine microbiota across different ages and gastrointestinal tract segments. PLoS One 10:e0117441. doi: 10.1371/journal.pone.0117441. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

skac377_suppl_Supplementary_Material

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES