ABSTRACT
We analyzed a cohort of Trichosporon asahii strains with different MICs of fluconazole and voriconazole and evaluated the presence of ERG11 mutations. ERG11 mutation conferring an amino acid change was found and its resistance potential was evaluated by cloning into Saccharomyces cerevisiae susceptible host strain. Transformants were not resistant to either fluconazole nor voriconazole. Our results suggest that ERG11 variants exist among T. asahii isolates, but are not responsible for resistance phenotypes.
KEYWORDS: Trichosporon asahii, antifungal resistance, 14-alpha-demethylase, mutations, ERG11
INTRODUCTION
Reports of invasive Trichosporon asahii infections (TAI) are increasing worldwide (1, 2). Azole drugs are considered the best treatment choice for TAI, but the emergence of isolates with diminished in vitro susceptibility to these compounds have been reported in different parts of the world (3–5).
Given that there is a lack of standardized clinical resistance breakpoints for the interpretation of the antifungal susceptibility testing of T. asahii, a recent study proposed epidemiological cutoff values to separate wild-type (WT) from non-wild-type (NWT) isolates (5). Mutations in ERG11, which encodes the target 14-α-sterol demethylase (Erg11p), have been proposed as a main mechanism of azole resistance in T. asahii (6, 7). In a case report of a Chinese women with chronic skin T. asahii infection, consecutive isolates recovered after 15 years of azole exposure showed several prominent ERG11 mutations (8).
Despite the evidence suggesting that ERG11 mutations may be one of the key elements related to azole resistance in T. asahii, further analysis with more clinical isolates is necessary to better define its relevance in clinical practice. Therefore, to better investigate the relationship between ERG11 mutations and azole resistance in T. asahii, we analyzed the 14-α-sterol demethylase gene in a cohort of 37 epidemiologically distinct clinical strains with different inhibitory concentrations to fluconazole and voriconazole. The study protocol was approved by the local ethics committee (Federal University of São Paulo, São Paulo, Brazil, n. 401.893/2013).
CBS2470T and an additional 36 clinical strains of T. asahii from the Special Laboratory of Mycology from the Federal University of São Paulo were selected and analyzed. These strains were recovered from clinical specimens of different Brazilian Hospitals from 2001 to 2017. All strains had species identification confirmed by sequence analysis of the intergenic spacer region (9). The strain selection criterium was based on their antifungal susceptibility profile. Antifungal susceptibility testing of fluconazole (Sigma-Aldrich, Saint Louis, MO, USA) and voriconazole (Sigma) were carried out according to the Clinical and Laboratory Standards Institute. MICs were read after 48 h of incubation at 37°C (5, 10). Strains with MICs above the epidemiological cutoff values proposed by Francisco et al. for either fluconazole or voriconazole were considered azole NWT (5). Among the 37 T. asahii strains, 20 were considered azole WT and 17 NWT (Table 1).
TABLE 1.
Trichosporon asahii strains, IGS1 genotypes, antifungal susceptibility profiles, ERG11 alleles, and GenBank accession numbers
| Strain name | IGS1 genotype | Fluconazole MIC (mg/L) | Voriconazole MIC (mg/L) | Azole wild-typea | ERG11 allele | ERG11p variant | GenBank accession no. |
|---|---|---|---|---|---|---|---|
| CBS2479 | 1 | 2 | 0.03 | Yes | 1 | 1 | ON755867 |
| LEMI2122 | 4 | 0.5 | 0.03 | Yes | 2 | 1 | ON755869 |
| LEMI3921 | 1 | 4 | 0.25 | Yes | 2 | 1 | ON755870 |
| LEMI9204 | 1 | 8 | 0.25 | No | 2 | 1 | ON755871 |
| LEMI9390 | 1 | 32 | 0.25 | No | 3 | 2 | ON755895 |
| LEMI4771 | 1 | 2 | 0.06 | Yes | 2 | 1 | ON755872 |
| LEMI7926 | 3 | 2 | 0.03 | Yes | 2 | 1 | ON755873 |
| LEMI924/2016 | 3 | 64 | 1 | No | 3 | 2 | ON755896 |
| LEMI926/2016 | 3 | 64 | 1 | No | 3 | 2 | ON755897 |
| LEMI928/2016 | 3 | 64 | 0.5 | No | 3 | 2 | ON755898 |
| LEMI3930 | 1 | 32 | 2 | No | 2 | 1 | ON755868 |
| LEMI9177 | 1 | 1 | 0.03 | Yes | 2 | 1 | ON755874 |
| LEMI9143 | 1 | 2 | 0.06 | Yes | 2 | 1 | ON755875 |
| LEMI9190 | 1 | 2 | 0.03 | Yes | 2 | 1 | ON755876 |
| LEMI9194 | 1 | 4 | 0.25 | Yes | 2 | 1 | ON755877 |
| LEMI9195 | 1 | 2 | 0.06 | Yes | 2 | 1 | ON755878 |
| LEMI9376.A | 1 | 32 | 0.5 | No | 3 | 2 | ON755899 |
| LEMI9376.B | 1 | 16 | 0.5 | No | 2 | 1 | ON755879 |
| LEMI1376/2017 | 3 | 4 | 0.06 | Yes | 2 | 1 | ON755880 |
| LEMI1383/2017 | 5 | 2 | 0.06 | Yes | 2 | 1 | ON755881 |
| LEMI9468 | 7 | 32 | 0.06 | No | 3 | 2 | ON755900 |
| LEMI9469 | 1 | 2 | 0.03 | Yes | 2 | 1 | ON755882 |
| LEMI9607 | 1 | 4 | 0.03 | Yes | 2 | 1 | ON755883 |
| LEMI9829 | 1 | 16 | 0.25 | No | 2 | 1 | ON755884 |
| LEMI10099 | 1 | 8 | 0.125 | Yes | 2 | 1 | ON755885 |
| LEMI10208 | 1 | 8 | 0.25 | No | 2 | 1 | ON755886 |
| LEMI236/2015 | 1 | 4 | 0.125 | Yes | 2 | 1 | ON755887 |
| LEMI242/2015 | 1 | 4 | 0.125 | Yes | 2 | 1 | ON755888 |
| LEMI9131A | 1 | 16 | 1 | No | 2 | 1 | ON755889 |
| LEMI9131B | 1 | 16 | 1 | No | 3 | 2 | ON755903 |
| LEMI963/2016 | 1 | 32 | 1 | No | 3 | 2 | ON755901 |
| LEMI9743A | 1 | 64 | 1 | No | 3 | 2 | ON755902 |
| LEMI9743B | 1 | 64 | 1 | No | 2 | 1 | ON755890 |
| LEMI3786 | 1 | 8 | 0.125 | Yes | 2 | 1 | ON755891 |
| LEMI341/2015 | 1 | 8 | 0.25 | No | 2 | 1 | ON755892 |
| LEMI1643/2017 | 1 | 4 | 0.125 | Yes | 2 | 1 | ON755893 |
| LEMI1640/2017 | 1 | 4 | 0.25 | Yes | 2 | 1 | ON755894 |
According to the ECV proposed by Francisco et al. (5).
Strains were cultured overnight in yeast extract, peptone, dextrose (YPD) broth at 37°C. After 10 min centrifugation (3,500 rpm), the pellets were washed twice with sterile water and DNA extraction was carried out with Zymo Research Quick-DNA Fungal/Bacterial kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. For the primers design, the ERG11 open reading frame (ORF) with additional 400 bp upstream and downstream region were selected and copied from the T. asahii CBS2479 genome (NCBI: PRJNA296794), and in silico analyses were carried out by using the software AmpliFx (Institute of NeuroPhysiopathology, Aix Marseille Université, Marseille, France). The following primers were designed for amplification of a 3096 bp region that included the ERG11 ORF: forward TAF1 5′-TCCGCATTGAATCGGGCAAA-3′ (451 bp upstream the ORF) and reverse TAR1 5′-ACGCAATCGGAAGCTTGTCA-3′ (409 bp downstream the ORF). The PCR conditions for DNA amplification were set as following: 95°C for 5 min, 35 cycles of 98°C for 30 s, 58°C for 30 s, 72°C for 3.5 min, and a final extension at 72°C for 5 min. For DNA sequencing, another set of primers were designed: TAF2 5′-AGCATTAGCGGCCGTCTGT-3′, TAF3 5′-AACCCGACTAACGCCCAGAT-3′, TAF4 5′-TGGTAAGTCTTGCGTGCAGT-3′, TAF5 5′-TCTAAGGACGGCACGTATGT-3′. The PCR products were purified using the ZR DNA sequencing cleanup kit (Zymo Research) and sent for Sanger sequencing with the primers TAF1, TAF2, TAF3, TAF4, and TAF5. Sanger sequencing files alignment and contigs were constructed using the software Lasergene Molecular Biology v.17.2 (DNA Star Lasergene, Madison, WI, USA). The ERG11 contigs were further aligned and translated to proteins with the MEGA v.10 software (11). DNA sequencing analyses revealed three ERG11 alleles. The first allele, represented by the strain CBS2479T, was classified as WT for azole susceptibility. The second allele, represented by most of the strains (27, 73%), contained a single mutation (A705G). These strains were either WT (20, 74.1%) or NWT (7, 25.9%) to azole drugs (Table 1). The third allele (9, 24.3%), represented only by NWT strains, had one mutation (A705G) at the second intron and another one at the fifth exon (G1952T). These strains also showed a 20 bp tandem repeat insertion (CTGGGTTGGCTGGCTGCTGG) in the third intron at the position 1330 (Fig. 1). All DNA sequences were deposited at the GenBank (Table 1). The predicted Erp11p sequences were retrieved, aligned and compared. The three ERG11 alleles produced two different Erp11p variants (Fig. 1). The variant 1 Erg11p was found in most of the isolates (n = 28, 75.7%), either WT (n = 20, 70%) or NWT (n = 8, 30%). Variant 2 with a point mutation conferring G432W was represented only by azole NWT strains (n = 9, 24.3%).
FIG 1.
(A) Five-exon Trichosporon asahii lanoterol 14-α demethylase gene (ERG11) representation from the GenBank database (A1Q1_02098). (B) Representation of the three different alleles found for the gene ERG11 (red, intronic mutation or insertion; black and asterisk, nonsynonymous mutation at the fifth exon). (C) Erg11p variants (red, G432W polymorphism).
ERG11 allele 3 from a NWT strain (LEMI924/2016) and the reference strain CBS2479 were cloned onto the plasmid pRS416 and transformed into the haploid strain Saccharomyces cerevisiae BY4741 through gap-repair cloning, as previously described (12). Synthetic-defined medium lacking uracil (SD-ura) was used to select transformants and screened by PCR. PCR products were sequenced to confirm the ERG11 haplotypes. Then, MICs for fluconazole and voriconazole were evaluated in nutrient-rich (YDP) and nutrient-limited (SD-ura) media. S. cerevisiae clones harboring Candida auris ERG11 mutation Y132F or K143R and the empty plasmid were used as positive controls. The S. cerevisiae expressing ERG11p variants 1 and 2 had the same MIC values to fluconazole (2 to 4 μg/mL) and voriconazole (0.25 μg/mL). The empty vector showed similar MICs to fluconazole (4 μg/mL) and voriconazole (0.125 to 0.25 μg/mL), while the transformants expressing the C. auris ERG11 harboring the mutations Y132 or K143R (Table 2) showed higher MICs to fluconazole (>16 to 32 μg/mL) and voriconazole (0.25 to 1 μg/mL).
TABLE 2.
Azole susceptibility of Saccharomyces cerevisiae expressing Trichosporon asahii and Candida auris ERG11 alleles 1 and 3
| Fluconazole MIC (mcg/mL) |
Voriconazole MIC (mcg/mL) |
|||
|---|---|---|---|---|
| Plasmid | YPDa | SD-urab | YPD | SD-ura |
| Empty vector | 4 | 4 | 0.125 | 0.25 |
| C. auris ERG11 Y132F | 32 | 32 | 1 | 1 |
| C. auris ERG11 K143R | 16 | 16 | 0.25 | 0.5 |
| T. asahii ERG11 CBS2479 | 2 | 4 | 0.25 | 0.25 |
| T. asahii ERG11 LEMI924/2016 | 2 | 4 | 0.25 | 0.25 |
yeast extract, peptone, dextrose medium.
Synthetic-defined medium lacking uracil.
Specific amino acid substitutions altering the azole biding affinity of the 14-α-sterol demethylase are leading to the rise of antifungal resistance in the genus Candida and Aspergillus (13). However, Trichosporon is a basidiomycetous fungi that is phylogenetically distant from the ascomycetous genera such as Candida and Aspergillus. Indeed, the ERG11s are highly variable among the different fungal species, and homology below 50% is found when amino acid residue sequences of T. asahii and Candida albicans are compared (14). Therefore, the genetic background of the basidiomycetes may elicit distinct biological responses when challenged to host and antifungal stresses.
Despite the reports of ERG11 mutations causing fluconazole resistance in Cryptococcus spp. strains (15), analyses of different cohorts, including azole-resistant strains, have shown different results. Analysis of more than 300 C. neoformans strains from Uganda revealed that ERG11 mutations were not associated with higher fluconazole MIC values (16). Likewise, a study investigating the relation of azole susceptibility profile and ERG11 mutations among Cryptococcus gattii strains from the U.S. Pacific Northwestern region found high genetic variability without correlation with fluconazole resistance (17). Five different ERG11 variants were found and cloned into S. cerevisiae. Similar to our experiments with T. asahii, none of the ERG11 variants were related to high azole MICs after the cloning experiments. Therefore, there is evidence that ERG11 variability may be a common feature among the basidiomycetes, but it is not usually related to azole resistance. Indeed, recent transcriptomic data point out that hyperexpression of efflux plasma components may be a relevant mechanism of azole resistance in these two clinically relevant basidiomycetous genera (18, 19). Moreover, a study demonstrated that T. asahii azole NWT strains show active efflux of rhodamine 6G (20).
In conclusion, our analyses showed that ERG11 mutations are not the main mechanism of azole resistance in the cohort of T. asahii clinical isolates analyzed in this study. Other mechanisms, such as efflux and target hyperexpression, need to be investigated in order to elucidate the main drivers of azole resistance in T. asahii.
ACKNOWLEDGMENTS
J.N.d.A. has received a research grant from Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP n. 2018/19347-4).
The study was partially supported by a grant received from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq 311372/2020-1).
Contributor Information
João Nobrega de Almeida, Jr., Email: joao.nobregaa@einstein.br, jnaj99@gmail.com.
David S. Perlin, Email: david.perlin@hmh-cdi.org.
REFERENCES
- 1.de Almeida Júnior JN, Hennequin C. 2016. Invasive Trichosporon infection: a systematic review on a re-emerging fungal pathogen. Front Microbiol 7:1629. 10.3389/fmicb.2016.01629. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Nobrega de Almeida J, Francisco EC, Holguín Ruiz A, Cuéllar LE, Rodrigues Aquino V, Verena Mendes A, Queiroz-Telles F, Santos DW, Guimarães T, Maranhão Chaves G, Grassi de Miranda B, Araújo Motta F, Vargas Schwarzbold A, Oliveira M, Riera F, Sardi Perozin J, Pereira Neves R, França E Silva ILA, Sztajnbok J, Fernandes Ramos J, Borges Botura M, Carlesse F, de Tarso de O E Castro P, Nyirenda T, Colombo AL. 2021. Epidemiology, clinical aspects, outcomes and prognostic factors associated with Trichosporon fungaemia: results of an international multicentre study carried out at 23 medical centres. J Antimicrob Chemother 76:1907–1915. 10.1093/jac/dkab085. [DOI] [PubMed] [Google Scholar]
- 3.Arabatzis M, Abel P, Kanellopoulou M, Adamou D, Alexandrou-Athanasoulis H, Stathi A, Platsouka E, Milioni A, Pangalis A, Velegraki A. 2014. Sequence-based identification, genotyping and EUCAST antifungal susceptibilities of Trichosporon clinical isolates from Greece. Clin Microbiol Infect 20:777–783. 10.1111/1469-0691.12501. [DOI] [PubMed] [Google Scholar]
- 4.Guo L-N, Yu S-Y, Hsueh P-R, Al-Hatmi AMS, Meis JF, Hagen F, Xiao M, Wang H, Barresi C, Zhou M-L, de Hoog GS, Xu Y-C. 2019. Invasive infections due to Trichosporon: species distribution, genotyping, and antifungal susceptibilities from a multicenter study in China. J Clin Microbiol 57:e01505-18. 10.1128/JCM.01505-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Francisco EC, de Almeida Junior JN, de Queiroz Telles F, Aquino VR, Mendes AVA, de Andrade Barberino MGM, de Tarso O Castro P, Guimarães T, Hahn RC, Padovan ACB, Chaves GM, Colombo AL. 2019. Species distribution and antifungal susceptibility of 358 Trichosporon clinical isolates collected in 24 medical centres. Clin Microbiol Infect 25:909.e1–909.e5. 10.1016/j.cmi.2019.03.026. [DOI] [PubMed] [Google Scholar]
- 6.Kushima H, Tokimatsu I, Ishii H, Kawano R, Shirai R, Kishi K, Hiramatsu K, Kadota J-I. 2012. Cloning of the lanosterol 14-α-demethylase (ERG11) gene in Trichosporon asahii: a possible association between G453R amino acid substitution and azole resistance in T. asahii. FEMS Yeast Res 12:662–667. 10.1111/j.1567-1364.2012.00816.x. [DOI] [PubMed] [Google Scholar]
- 7.Kushima H, Tokimatsu I, Ishii H, Kawano R, Watanabe K, Kadota J-I. 2017. A new amino acid substitution at G150S in lanosterol 14-α demethylase (Erg11 protein) in multi-azole-resistant Trichosporon asahii. Med Mycol J 58:E23–E28. 10.3314/mmj.16-00027. [DOI] [PubMed] [Google Scholar]
- 8.Xia Z, Yu H, Wang C, Ding X, Zhang D, Tan X, Chen J, Hu S, Yang R. 2020. Genomic and transcriptome identification of fluconazole-resistant genes for Trichosporon asahii. Med Mycol 58:393–400. 10.1093/mmy/myz088. [DOI] [PubMed] [Google Scholar]
- 9.Sugita T, Nakajima M, Ikeda R, Matsushima T, Shinoda T. 2002. Sequence analysis of the ribosomal DNA intergenic spacer 1 regions of Trichosporon species. J Clin Microbiol 40:1826–1830. 10.1128/JCM.40.5.1826-1830.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Rodriguez-Tudela JL, Diaz-Guerra TM, Mellado E, Cano V, Tapia C, Perkins A, Gomez-Lopez A, Rodero L, Cuenca-Estrella M. 2005. Susceptibility patterns and molecular identification of Trichosporon species. Antimicrob Agents Chemother 49:4026–4034. 10.1128/AAC.49.10.4026-4034.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol 35:1547–1549. 10.1093/molbev/msy096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Healey KR, Kordalewska M, Jiménez Ortigosa C, Singh A, Berrío I, Chowdhary A, Perlin DS. 2018. Limited ERG11 mutations identified in isolates of Candida auris directly contribute to reduced azole susceptibility. Antimicrob Agents Chemother 62:e01427-18. 10.1128/AAC.01427-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Perlin DS, Rautemaa-Richardson R, Alastruey-Izquierdo A. 2017. The global problem of antifungal resistance: prevalence, mechanisms, and management. Lancet Infect Dis 17:e383–e392. 10.1016/S1473-3099(17)30316-X. [DOI] [PubMed] [Google Scholar]
- 14.Zhang J, Li L, Lv Q, Yan L, Wang Y, Jiang Y. 2019. The Fungal CYP51s: their functions, structures, related drug resistance, and inhibitors. Front Microbiol 10:691. 10.3389/fmicb.2019.00691. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Rogers TR, Verweij PE, Castanheira M, Dannaoui E, White PL, Arendrup MC, Subcommittee on Antifungal Susceptibility Testing (AFST) of the ESCMID European Committee for Antimicrobial Susceptibility Testing (EUCAST) . 2022. Molecular mechanisms of acquired antifungal drug resistance in principal fungal pathogens and EUCAST guidance for their laboratory detection and clinical implications. J Antimicrob Chemother 77:2053–2073. 10.1093/jac/dkac161. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Atim PB, Meya DB, Gerlach ES, Muhanguzi D, Male A, Kanamwanji B, Nielsen K. 2022. Lack of association between Fluconazole susceptibility and ERG11 nucleotide polymorphisms in cryptococcus neoformans clinical isolates from Uganda. JoF 8:508. 10.3390/jof8050508. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Gast CE, Basso LR, Bruzual I, Wong B. 2013. Azole resistance in Cryptococcus gattii from the Pacific Northwest: investigation of the role of ERG11. Antimicrob Agents Chemother 57:5478–5485. 10.1128/AAC.02287-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Basso LR, Gast CE, Bruzual I, Wong B. 2015. Identification and properties of plasma membrane azole efflux pumps from the pathogenic fungi Cryptococcus gattii and Cryptococcus neoformans. J Antimicrob Chemother 70:1396–1407. 10.1093/jac/dku554. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Li H, Wang C, Chen Y, Zhang S, Yang R. 2017. Integrated transcriptomic analysis of Trichosporon Asahii uncovers the core genes and pathways of fluconazole resistance. Sci Rep 7:17847. 10.1038/s41598-017-18072-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Padovan ACB, Rocha WPdS, Toti ACdM, Freitas de Jesus DF, Chaves GM, Colombo AL. 2019. Exploring the resistance mechanisms in Trichosporon asahii: triazoles as the last defense for invasive trichosporonosis. Fungal Genet Biol 133:103267. 10.1016/j.fgb.2019.103267. [DOI] [PubMed] [Google Scholar]