Skip to main content
3 Biotech logoLink to 3 Biotech
. 2022 Dec 21;13(1):19. doi: 10.1007/s13205-022-03428-4

Expression of heterologous heparan sulphate binding protein of Helicobacter pylori on the surface of Lactobacillus rhamnosus GG

Ashok Kumar Yadav 1,4,, Sudarshan Reddy Varikuti 4, Ashwani Kumar 2, Manoj Kumar 3, Nabendu Debanth 1, Hemalatha Rajkumar 4,
PMCID: PMC9768065  PMID: 36568501

Abstract

Helicobacter pylori (H. pylori) is one of most commonly found pathogen in the stomach. In spite of emergence of different treatment strategies, H. pylori infection remains difficult to treat. The bioengineered probiotic lactobacilli that could displace H. pylori and simultaneously present immunogenic peptides such as heparan sulphate binding protein (Hsbp) to elicit immune response could emerge as a potential therapeutic agent. The aim of this study was to discover the anti-H. pylori activities and faster exclusion of H. pylori from host cells by the recombinant strain of Lactobacillus expressing the immunogenic Hsbp protein. The results were promising and showed a 65% reduction in H. pylori adhesion after two hours of pre-incubation with recombinant-LGG and HeLa S3 cells, followed by the adhesion of H. pylori pathogen (P < 0.002). Additionally, 36% and 39% reduction were examined in co-incubation and post-incubation with recombinant-LGG, respectively. When challenged with H. pylori, the proinflammatory cytokine expression was also down regulated in recombinant-LGG treated HeLa S3 cells. This promising result provides a new insight of bioengineered probiotic lactobacilli which could displace H. pylori and simultaneously has immunogenic properties thereby may be useful to prevent H. pylori infection.

Supplementary Information

The online version contains supplementary material available at 10.1007/s13205-022-03428-4.

Keywords: Bioengineered probiotic, Lactic acid bacteria, Heterologous protein, Immunogenic proteins, Competitive adhesion, Anti-inflammatory cytokine

Introduction

Probiotics, especially lactic acid bacteria (LAB) have been extensively studied and subsequently utilized for producing metabolites, food grade enzymes and other nutraceutical components (Ruiz Rodríguez et al. 2019; Terpou et al. 2019). Owing to their generally safer attributes, LAB have also been investigated in previous studies for regulated gene expression and as a delivery vehicle (Bermúdez-Humarán et al. 2011; Kobierecka et al. 2015). For example, genetically engineered live vaccine has been successfully developed for Lactobacillus casei, Lactobacillus acidophilus and Lactobacillus johnsonii (Bermúdez-Humarán et al. 2011; Pontes et al. 2011; Wyszyńska et al. 2015). These recombinant lactobacilli have been shown to induce both mucosal as well as systemic immune responses (Liu et al. 2014). Different studies with L. lactis, a probiotic bacterium, have been explored in food industry to produce peptides, proteins, and oral vaccines (Jørgensen et al. 2014; Song et al. 2017). Moreover, it produces less protease with no endotoxins (Pei et al. 2005).

Numerous expression systems have been reported for heterologous protein production in LAB (Mathiesen et al. 2004). The pSIP expression vector system has shown to be very effective for intracellular expression (Böhmer et al. 2012), secretion (Anbazhagan et al. 2013), and also for surface anchoring (Fredriksen et al. 2010, 2012) of various proteins across different Lactobacillus species (Reveneau et al. 2002). Keeping this into the mind, cell surface expression of specific antigens on lactobacilli using a modified, food grade, pSIP503 vector can be a significant step towards development of oral vaccine. Particularly, when the innate immuno-adjuvanticity of certain lactobacilli strains can augment the efficacy of vaccine candidate.

It has been observed that the presence of H. pylori in gastric mucosa is the primary contributor to chronic gastritis, which ultimately leads to peptic ulcer and in worst cases, gastric adenocarcinoma (Kusters et al. 2006). Studies have demonstrated that the proteins which show higher affinity toward different glycosaminoglycans such as Hsbp and several outer membrane proteins (OMPs) are expressed by H. pylori and play an important role in its adhesion to gastric mucosa (Ruiz-Bustos et al. 2000; Kim et al. 2021; Martín et al. 2020). Thus, expression of Hsbp on the surface of probiotic Lactobacillus could be an alternative approach to improve immune response against H. pylori infections.

In this study, we have constructed an expression vector system (pSIP503 vector) using signal sequence from probiotic L. plantarum (LP21) and anchor sequence from L. rhamnosus GG. This modified expression system has successfully displayed the Hsbp on the surface of probiotic LGG strain and simultaneously exhibited competitive inhibition of H. pylori adhesion. Additionally, the level of inflammatory cytokines was also reduced. Therefore, our modified probiotic LGG can be used for therapeutic approach in oral vaccine preparation against H. pylori infection.

Material and methods

Bacterial strains and plasmids

In our study, bacterial strains such as E. coli XL-1 and LGG (ATCC53103) were used for cloning and expression of Hsbp protein, respectively (Table 1). H. pylori 26,695 strain and Lactobacillus specific expression vector pSIP503 with Gus reporter gene were generously gifted by Dr. Niyaj Ahmed, University of Hyderabad, India, and Dr. Lars Axelsson, Nofima, Norway, respectively. Lactobacilli cultures were grown in MRS (deMan-Rogosa-Sharpe) broth at 37 °C without shaking. Growth pattern of LGG and recombinant-LGG at various pH was also monitored by spectrophotometer (OD600nm) (Fig. S1). Antibiotic erythromycin (Erthro) with a concentration of 200 μg/ml was used for screening of recombinant clones. H. pylori 26,695 was cultured on Columbia agar (Oxoid Ltd. UK), supplemented with 7% (v/v) sheep blood and 7% (v/v) horse serum (Gibco New Zealand Ltd.) at 37 °C under microaerophilic conditions (6–12% O2, 5–8% CO2) for 48–72 h.

Table 1.

List of bacterial cultures and plasmids used in this study

Plasmid/Strain Relevant characteristics References/Source
pJET1.2/blunt Ampr, blunt ended PCR cloning vector Thermo scientific
pSIP503 Erytr, Nisin inducible Lars Axelsson, Nofima, Norway
LP21 Human origin
LGG Human origin Goldin Gorbach
E. coli DH5α Ff80dlacZ_M15_(lacZYA-rgF)U169 endA1 recA1 hsdR17 (rK– mK +) deoR

Construction of pSIP503 vector

To express the heterologous protein on the bacterial surface, pSIP503 plasmid vector was modified. In brief, the genomic DNA of LP21 and LGG was isolated as described earlier (Pospiech and Neumann 1995). High fidelity Q5 DNA polymerase (New England Biolab, UK) was used for all the PCR process using specific primers as mentioned in Table 2. The fusion gene was constructed by using signal sequences from cold shock protein (Csp) of LP21 and anchor peptide fragments containing MPQTG motif ranging 1303–1480 amino acids of cell envelope proteinase PrtR of LGG along with multiple cloning sites and gene of interest (Hsbp). Both signal and anchor regions were amplified by PCR.

Table 2.

List of primers used in this study

Primers Sequences Restriction site
Csp1 GTATCCATGGTGTCAAAAGCGCTTAAGATAGTGA NcoI
Csp2 GCTGCCCCGGGGGACCAGCTCGAGGAATTCCATATGTTTCTGGGCCATGATGCCCCCTG NEXT *
PrtR1 CATATGGAATTCCTCGAGCTGGTCCCCCGGGGCAGCCAGAAGAATCTAGCTGGGTTC NEXT*
PrtR2 ACCG AAGCTT TTAGACGCGCTTTTTACGTGATACA HindIII
HsbpF ATTTCATATGACGCAAGTCATTGATGGGCCTTTTG NdeI
HsbpR AGGACTCGAGAGCGTAGCTAGCGAAACGCG XhoI

*NEXT: N-NdeI, E- EcoRI, X- XhoI, T- Thrombin

A sixty-six nucleotides fragment covering the signal peptide region of CspI was PCR amplified using specific primers Csp1 and Csp2 from the genomic DNA of LP21. The anchor peptide region containing MPQTG motif was amplified using specific primers PrtR1 and PrtR2 from the genomic DNA of LGG. The PCR amplified signal and anchor fragments were fused using primers Csp2 (reverse primer) and PrtR1 (forward primer) by overlap PCR technique. The purified fusion construct containing signal sequences, multiple cloning sites and anchor sequences was cloned into the pJET1.2 cloning vector. The fusion construct was further subcloned into pSIP503 expression vector predigested with NcoI and HindIII restriction enzymes resulted in pSIP503CMR vector. The green fluorescent protein (gfp) gene was excited by restriction digestion from the plasmid pAcGFP1-N1, and gus gene from pSIP503 was further subcloned into a modified pSIP503CMR expression vector. The genomic DNA of H. pylori was used as the template for amplification of hsbp gene using primer pair HsbpF/HsbpR. The resulting Hsbp amplicon was cloned into pSIP503CMR vector for expression on the surface of the Lactobacillus strain.

Electroporation of LGG

Electroporation was carried out as per the method described earlier (Majidzadeh Heravi et al. 2012) with few changes. Briefly, the overnight grown Lactobacillus culture was inoculated into 12-ml MRS broth supplemented with 2% glycine and 0.5 M sucrose. The inoculated bacterial culture was incubated at 37 °C till the early exponential phase (OD600 = 0.20–0.40). The grown bacterial cells were harvested at 3000 g for 20 min at 4 °C. The harvested bacterial cells were washed twice with cold 50 mM EDTA buffer. Final washing was carried out using 0.3 M sucrose as an electroporation buffer. After electroporation, cells were immediately diluted in 0.5 ml of MRS broth for further incubation. The transformed bacterial cells were plated on MRS agar containing antibiotic erythromycin and incubated for 36 to 48 h.

Expression of heterologous protein in LGG

Fluorescent microscopy

The recombinant-LGG strain was cultured in MRS broth at 37 °C for the expression of heterologous protein (Gfp, Gus, and Hsbp) under the control of nisA promoter. The recombinant-LGG strain was induced with nisin as described previously (Pavan et al. 2000) with slight modification. Briefly, the bacterial cells were grown at 37 °C for 8 h. to achieve an OD600 of 0.30. The freshly grown recombinant-LGG cultures were induced with different concentrations (0, 5, 10, 25, 50, 75 and 100 ng/ml) of nisin. The induced cultures were further grown at 37 °C for different times (0, 2, 4, 6, 8 and 10) to optimize the expression. The induced cells were harvested, washed, and resuspended in 10 mM phosphate-buffered saline (PBS). The recombinant-LGG cell-pellets containing gfp were examined using a fluorescent microscope. The green fluorescent signal was excited at 488 nm wavelength and detected at the wavelength range of 500–550 nm. The LGG harbouring pSIP-CMR plasmid was used as a control.

Gus assay

To evaluate the efficiency of modified pSIP503CMR vector, the β-glucuronidase assay was carried out (Keersmaecker et al. 2006). Briefly, 25 mM p-nitrophenyl βD-glucuronic acid (PNPG) (Sigma) was used as a substrate for Gus activity assay. The reaction was performed in triplicate to ascertain that enzyme activity. Similarly, all treatments were performed with sodium-phosphate buffer but without cells as control. The enzyme activity was calculated and expressed as Miller Unit equivalents (MU) (Miller 1972).

SDS-PAGE and western blot analysis of Hsbp protein

The nisin-induced recombinant-LGG cultures were harvested by centrifugation at 6000 g for 20 min to extract surface layer proteins. The cells were washed with ice-cold 0.85% (w/v) NaCl. The surface proteins were extracted by resuspending the washed cells into 2 M Guanidine-HCl (Gu-HCl) (Åvall-Jääskeläinen et al. 2008) and subsequently incubated for 2 h at 37 °C. After incubation, the mixtures were centrifuged and the supernatant was dialyzed against water at 4 °C for overnight to remove the salts. The precipitated proteins were collected by centrifugation (10,000 g at 4 °C) for 20 min and lyophilized. The lyophilized proteins were dissolved in PBS buffer and separated on 10% SDS-PAGE and then transferred to PVDF membrane for identification of desired proteins.

HeLa S3 cell cultures

For the adhesion assay, a 15 day-old (well-differentiated) HeLa S3 culture (ECACC 87110901: derived from the parent HeLa cell line) was used. HeLa S3 cells were cultured into Dulbecco’s Modified Eagle’s Medium/Nutrient Mixture F-12 Ham (Sigma Aldrich) supplemented with 10% heat-inactivated foetal bovine serum (Gibco, Invitrogen), and 1% nonessential amino acids solution (Sigma) along with antibiotics antimycotics solution (100X Sigma). The medium was replaced on alternate days with fresh media. The HeLa S3 cells were grown at standard conditions (37 °C, 5% CO2, 95% humidity) in a 24-well tissue culture plate. After two weeks, cells were washed in PBS buffer and transferred into the culture medium without antibiotics and antimycotic solution and then used for adhesion experiments.

Adhesion assay

Adhesion assay was carried out on HeLa S3 cell lines with H. pylori, recombinant-LGG and non-recombinant LGG. Adhesion of the bacterial cultures was measured as described before with modifications (Jacobsen et al. 1999). Briefly, the percent adhesion was enumerated by counting CFU on agar plates rather than microscopic examination.

Competitive adhesion assay

The competitive adhesion assays were performed on HeLa S3 cells with non-recombinant LGG as well as recombinant-LGG expressing Hsbp against H. pylori using three variants.

  1. Competitive inhibition (Pre-incubation): About 1 × 107 cfu/well of recombinant-LGG was added on HeLa S3 cells and incubated for 2 h, followed by addition of H. pylori (1 × 107 cfu/well) and incubated for another 4 h at 37 °C.

  2. Competition adhesion (Co-incubation): Both recombinant-LGG (1 × 107 cfu/well) and H. pylori (1 × 107 cfu/well) were added in each of 24-well tissue culture plate and incubated for 4 h at 37 °C.

  3. Competitive exclusion (post-incubation): About 1 × 107 cfu/well of H. pylori was added on HeLa S3 cells and incubated for 2 h, followed by addition of recombinant-LGG (1 × 107 cfu/well) and incubated for another 4 h at 37 °C.

Similarly, all the three variants of adhesion studies were performed for non-recombinant LGG.

Real-time quantitative PCR analysis of pro-inflammatory cytokines

HeLa S3 cells were stimulated with H. pylori alone and after treatment with non-recombinant LGG and recombinant-LGG for 4 h, total RNA was isolated using the usual Trizol technique, and the expression of pro-inflammatory cytokines (COX-2, IL-1, IL-6, IL-8, and NF-κβ) was assessed using real-time PCR. The integrity and purity of the extracted RNA was ascertained by agarose gel electrophoresis as well as through a spectrophotometer (TECAN). First-strand cDNA was synthesized from 1.0 µg of RNA as per manufacturer-recommended protocol (Invitrogen) with random hexamer and oligo dT primers, and it was diluted 5 times before performing the quantitation assay. qRT-PCR was carried out using SYBR Green I Master technology (Invitrogen) with pro-inflammatory cytokines gene-specific primer. The primers (Table 3) were synthesized from Sigma-Aldrich. The GAPDH gene was used as an internal control.

Table 3.

List of primers used for qPCR study

Primer Sequence (5’-3’) References
COX-2 _For TGCCCAGCTCCTGGCCCGCCGCTT (Tsuzaki et al. 2003)
COX-2 _Rev GTGCATCAACACAGGCGCCTCTTC
IL-1β_For TACGAATCTCCGACCACCACTACAG
IL-1β_Rev TGGAGGTGGAGAGCTTTCAGTTCATATG
IL-6_For ATGAACTCCTTCTCCACAAGCGC
IL-6_Rev GAAGAGCCCTCAGGCTGGACTG
NF-κB _For TACGAATCTCCGACCACCACTACAG
NF-κB_Rev TGGAGGTGGAGAGCTTTCAGTTCATATG
IL-8_For GACCACACTGCGCCAACA (Bezzerri et al. 2011)
IL8_Rev GCTCTCTTCCATCAGAAAGTTACATAATTT

Results

Construction of plasmids

Employing the gene-specific primers listed in Table 2, a PCR experiment using the genomic DNA of the probiotic bacteria LP21 and LGG yielded unique amplicons of 107 bp for the cspI signal sequence and 577 bp for the prtR anchor sequence, respectively (Fig. S5). Subsequently, overlap PCR assays was carried out using primer pairs, i.e. Csp2 (reverse primer) and PrtR1 (forward primer) and amplified the fusion product of 648 bp (Fig. S2). The digested fusion product with NcoI and HindIII and cloned in pSIP503 expression vector. The recombinant pSIP503CMR plasmid was further confirmed by colony PCR to ascertain the presence of signal and anchor sequences.

Expression of heterogonous protein on the surface of LGG

It is important to evaluate the expression efficiency of novel plasmid pSIP503CMR to display heterologous protein on the host cell surface. The reported genes gfp and gusA were used in this study to evaluate the expression efficiency of constructed pSIP503CMR expression vector. Genomic DNA of H. pylori was used to amplified hsbp gene of size 1.5 kb using primers pairs HsbpF/ HsbpR. The PCR amplicons were cloned in pSIP503CMR expression vector. Further, recombinant plasmid pSIP503CMR-Hsbp was transformed in competent LGG cells, and erythromycin (200 µg/ml) resistant positive clones were selected. Further, expression of reporter gene gfp and gusA was determined at different concentrations of nisin (0.1 to 100 ng/ml). The recombinant-LGG bacteria expressing GFP protein was observed using fluorescent microscopy (Fig. S3), while no fluorescence was detected in control LGG harbouring pSIP503CMR without gfp gene.

Functional display of gus protein

The functional display of heterologous proteins was ascertained by the Gus activity assays. The recombinant-LGG cultures containing gus gene were induced with different concentrations of nisin. We observed the highest activity (279.3 ± 9.5 MU; OD600 0.3) of GusA enzyme at 50 ng/ml of nisin concentration (Fig. 1A). Interestingly, it has been observed that the GusA activity was decreased (139.7 ± 10.5 MU and 73.7 ± 13.4 MU), when the concentration of nisin was increased (75 ng/ml and 100 ng/ml) as shown in Fig. 1A. Further, GusA activity was also examined at the different incubation time (0, 2, 4, 6, 8 and 10 h) after induction, and the highest GusA activity (279.3 ± 13.5 MU) was observed at 8 h of incubation after induction with 50 ng/ml nisin (Fig. 1B). Gus activity was also measured in negative control group with empty vector and shown in Fig. 1A, B. Results of this study depicted that recombinant-LGG with Gus gene showed statistically significant enzyme activity as compared to negative control group (P < 0.002) at different nisin concentration and different incubation time.

Fig. 1.

Fig. 1

GUS activity measured during growth of recombinant-LGG with pSIP503SR-Gus and negative control group with empty vector. The cultures were induced at OD600 0.3. A Different nisin concentration and B Different incubation time after induction. The data shown are the averages of three independent separate experiments. Error bars represent standard error of mean (± SEM). Recombinant-LGG with pSIP503R-Gus showed significant Gus activity as compared to negative control group (P < 0.05)

Extraction and immunoblotting of Hsbp protein

After successful surface expression, recombinant Hsbp protein was extracted with GuHCL method as described earlier (Åvall-Jääskeläinen et al. 2008). The extracted recombinant Hsbp protein was analysed on 10% SDS-PAGE. Anti-Hsbp antibody was used to confirm 72 kDa protein in immunoblotting technique (Fig. S4).

Adhesion assay

The capacity of the recombinant-LGG strain to attach HeLa S3 cells in competition with H. pylori was shown using a competitive adhesion assay. According to the results of adhesion assay, the recombinant-LGG strain had more adhesion potential on HeLa S3 cells (296.6–7.9 cfu/well) than the non-recombinant LGG strain (258.6–4.6 cfu/well) (Fig. 2A) (p < 0.002). The capacity of H. pylori to adhere to HeLa S3 cells is also seen in Fig. 2A (186.34.9 cfu/well).

Fig. 2.

Fig. 2

Adhesion assay of non-recombinant LGG, recombinant-LGG, and H. pylori to HeLa S3 cells. A Adhesion potential of recombinant-LGG, non-recombinant LGG and H. pylori. B Adhered H. pylori on HeLa S3 cells after Pre-incubation, Co-incubation, and Post-incubation with non-recombinant LGG and recombinant-LGG. Recombinant-LGG replace H. pylori from HeLa S3 cells significantly (P < 0.002) as compared to non-recombinant LGG in pre-incubation and post-incubation adhesion assays. The data are the mean (± SEM) of triplicate values. All experiments were repeated twice independently. *P < 0.03; **P < 0.002; ***P < 0.0002

Competitive adhesion assay

In the pre-incubation study, it was shown that recombinant-LGG more effectively competed with H. pylori for colonization of HeLa S3 cells than non-recombinant-LGG, reducing the quantity of adherent H. pylori (63.6 ± 3.8 cfu/well) by 65% (Fig. 2B) (P < 0.002). In co-incubation assay, the recombinant-LGG showed 36% reduction in adhesion of H. pylori (119.3 ± 3.5 cfu/well) (P < 0.03). Further, in post-incubation assay, recombinant-LGG also decreased colonization of H. pylori (143.3 ± 6.0 cfu/well) up to 39% on HeLa S3 cells (Fig. 2B) (P < 0.002). This investigation was effective in demonstrating that our recombinant-LGG has a good adhesion potential against H. pylori to HeLa S3 cells when compared to non-recombinant LGG.

qPCR analysis of inflammatory cytokines

To further understand and compare the effect of recombinant-LGG on H. pylori-induced inflammation in HeLa S3 cells, the expression level of various pro-inflammatory cytokines, i.e. COX-2, IL-1β, IL-6, IL-8, and NF-κB, was measured using qPCR. Initially, the exposure of HeLa S3 cells with H. pylori for 4 h induced the expression of mRNA of pro-inflammatory cytokines. However, when H. pylori-exposed HeLa S3 cells were treated with non-recombinant LGG, the expression of cytokines was downregulated moderately, i.e. COX-2 (1.94 ± 0.09), IL-1β (1.75 ± 0.29), IL-6 (1.81 ± 0.22), IL-8 (2.03 ± 0.23), and NF-κB (1.66 ± 0.26). On the other hand, recombinant-LGG significantly downregulated the expression of pro-inflammatory cytokines, i.e. COX-2 (1.38 ± 0.10) (P < 0.002), IL-1β (1.28 ± 0.20) (P < 0.03), IL-6 (1.09 ± 0.20) (P < 0.03), IL-8 (1.11 ± 0.10) (P < 0.03), and NF-κB (1.19 ± 0.10) (P < 0.03) (Fig. 3).

Fig. 3.

Fig. 3

Relative expression of pro-inflammatory genes in HeLa S3 cells treated with H. pylori alone and co-incubated with non-recombinant LGG and recombinant-LGG strain separately for 4 h. Each experiment result shows the mean ± standard error of mean of three independent experiments. Recombinant-LGG reduces expression of all the pro-inflammatory genes significantly as compared to non-recombinant-LGG. *P < 0.03; **P < 0.002

Statistically, the expression of the COX-2 gene was reduced more significantly than other four pro-inflammatory gene (P < 0.002) in the presence of recombinant-LGG as compared to non-recombinant LGG. According to the results of our study, it seems that Hsbp expressing recombinant-LGG exerts anti-inflammatory effects via a considerable reduction in transcriptional levels of pro-inflammatory cytokine genes.

Discussion

Novel therapeutic approaches such as oral vaccines are warranted to counter the antibiotic resistance in H. pylori-mediated gastrointestinal illness (Selgrad and Malfertheiner 2008). In this study, we have demonstrated the surface display of Hsbp protein, an immunogenic adhesin protein of H. pylori, on LGG competitively inhibits H. pylori infection in Hela3 cells. Additionally, our study indicated that the novel recombinant plasmid with the CspI signal sequence and PrtR anchor region effectively downregulated important pro-inflammatory signalling molecules.

Regular consumption of products that contain LAB has been demonstrated to suppress H. pylori infection (Ji and Yang 2020; Kuo et al. 2013). Recombinant LAB has been demonstrated to be safe for antigen delivery as they colonize very easily in the human GI tract (Cano Garrido et al. 2015). These attributes make them suitable candidates for mucosal vaccines with long-lasting effects. In this context, the development of cell surface anchoring systems that are capable of displaying proteins on the microbial cell surface, including live vaccines, is an emerging area of interest (Yang et al. 2014). LGG is one such strain with well-characterized safety attributes, which can be used as a potentially safe carrier of vaccines (Segers and Lebeer 2014). In this study, we selected the LGG strain as a host for the construction of an expression system for cell surface display of Hsbp protein. For the display of a targeted protein on the surface of a bacterial strain, a strong signal from CspI protein and the anchoring domain of PrtR are critical (Bron et al. 2011; Ji et al. 2021). For efficient surface expression of heterologous protein, an N-terminal deletion fusion strategy was employed using CspI signal peptide of L. plantarum (Bron et al. 2011) and the C-terminal region of cell envelop proteinase (PrtR) from LGG (Ji et al. 2021) was used as an anchor. pSIP503 plasmid was used as the expression system containing NICE system.

Other investigators (Axelsson et al. 2003) have also described the modified pSIP503CMR expression vector, with gus gene between CspI signal and PrtR anchor. The study reported maximum Gus activity (279.33 ± 4.90 MU) at OD600 0.3 with 50 ng/ml of nisin. LAB such as L. sakei Lb790 and L. plantarum NC8, showed maximum Gus activities (352 MU) at different concentrations of nisin (Axelsson et al. 2003). In our study, the maximum Gus activity was 279.3 ± 4.90 MU with 50 ng/ml nisin concentration. The difference in Gus activity may be due to the variation in the expression host used in the study. The modified pSIP503CMR expression system may be more efficient to express a desired protein on the bacterial surface (P < 0.002). By exploiting this expression system, we have expressed Hsbp protein from H. pylori on the surface of LGG cells.

The epithelial surface adhesion of pathogenic bacteria (Krachler and Orth 2013) is a critical preliminary step in several infectious diseases and is considered a major attribute that confers virulence to a pathogenic strain (Sun et al. 2012). Probiotic strains have also shown effective adhesive capabilities mimicking similar adherence mechanisms as used by the pathogens. Studies have demonstrated that the surface layer protein of LAB such as L. helveticus R0052 can competitively exclude pathogenic bacterial strains such as E. coli (Johnson-Henry et al. 2007). Another study demonstrated competitive exclusion of S. typhimurium by surface layer protein of L. crispatus in HeLa cells (Chen et al. 2007). L. plantarum Lp91, a proven probiotic, was significantly studied for its adhesion capability on Caco-2 cell lines (Duary et al. 2011). In this study, recombinant-LGG showed higher adhesion potential to Hela S3 Cells as compared to non-recombinant LGG (P < 0.002). The pre-incubated HeLa S3 cells with recombinant-LGG reduced the H. pylori adhesion by 65% (P < 0.002), while in co-incubation and post-incubation experiments adhesion of H. pylori were reduced by 36% and 39%, respectively. The results of the present investigation demonstrated that the recombinant-LGG shows more exclusion capabilities of H. pylori in pre-incubation strategy (P < 0.002). The exclusion of pathogenic bacteria by probiotic strains may be inhibited by steric hindrance or by blocking the receptor with specific adhesin protein analogs. The recombinant probiotic lactobacillus strains expressing adhesive outer membrane proteins of pathogens could provide an alternative strategy for management of infectious diseases.

Probiotic Lactobacillus species have been reported to decrease H. pylori adhesion leading to reduced gastric inflammation (Lesbros et al. 2007). Some studies demonstrated that the LGG showed anti-inflammatory potential by suppressing the pro-inflammatory cytokines (Li et al. 2009). Moreover, the production of pro-inflammatory cytokines, i.e. IL-8, IL-6, COX-2, and NF-κB, after gastrointestinal infection of H. pylori infection leads to the accumulation and stimulation of neutrophils causing inflammatory damage to the gastric mucosa. The major pathogenicity factors (CagA, VacA, and NapA) of H. pylori induce the production of pro-inflammatory cytokines (IL-6, IL-8, NF-κB, and COX-2) by dysregulation of immune response that contributes to the increased inflammation (Kinoshita et al. 2013). Therefore, we examined pro-inflammatory cytokine’s expression at mRNA level in H. pylori-infected HeLa S3 cells and showed significant downregulation of IL-6, IL-8, COX-2, NF-κB and IL-1β mRNA in recombinant-LGG exposed HeLa S3 cells (P < 0.002). However, the exact molecular mechanism through which pro-inflammatory cytokines are suppressed by recombinant-LGG is of great interest and can be studied further.

The current findings from our study showed that a recombinant-LGG strain expressing Hsbp protein can efficiently demonstrate competitive exclusion of H. pylori and reduce the H. pylori-induced gastric mucosal inflammation. Hence, recombinant Lactobacillus strains, designed to express proteins that have a role in bacterial adhesion and are also able to generate an immunogenic response, may become an alternative strategy in the gastro intestinal tract (GIT) inflammatory diseases (Carvalho et al. 2017).

Conclusions

Orally ingested genetically modified probiotic bacteria are promising vehicles for carrying immunogenic peptides to the mucosal sites and stimulating the immune system (Sahoo et al. 2020). Therefore, genetically modified LGG expressing Hsbp on its surface may provide an alternative oral vaccine strategy to inhibit H. pylori infection. Moreover, this strategy has another indirect advantage such as the natural health benefits of probiotics. Additionally, supporting in vivo studies are also required to evaluate the efficacy of Hsbp expressing recombinant-LGG strain against H. pylori infection.

Supplementary Information

Below is the link to the electronic supplementary material.

13205_2022_3428_MOESM1_ESM.pptx (1.2MB, pptx)

Supplementary file1 Fig. S1 Growth curve of (A) recombinant-LGG and (B) non-recombinant LGG at different pH-2.5, 4.0 and 6.5. Growth pattern of recombinant-LGG and non-recombinant-LGG at different pH on various time intervals were non-significant (P>0.05). Fig. S2 Agarose gel showing PCR amplification of Signal and anchor sequences. (A) 1. Csp signal from genomic DNA of LP 21, 2. PrtR Anchor from Genomic DNA of LGG, M. 50 bp DNA Ladder, (B) Overlap PCR amplification fusion product using Csp_F_Nco1/PrtR_R_HindIII, M. 1kb DNA Ladder. Fig. S3 Expression study of recombinant LGG expressing green fluorescent protein. (A) Control: LGG cells harbouring pSIP503CMR (B) Fluorescence detection of recombinant-LGG cells harbouring pSIP503CMR-Gfp induced with 50 ng/ml of nisin using fluorescent microscope. Fig. S4 SDS-PAGE and western blot of Hsbp protein isolated from recombinant-LGG. SDS-PAGE showing the expression of Hsbp protein induced with nisin, Lane: 1. Un-induced LGG culture harbouring pSIP503CMR-Hsbp cell lysate, 2. LGG culture harbouring LGG-pSIP503CMR-Hsbp cell lysate induced with 25 ng/ml of nisin, 3. LGG culture harbouring LGG-pSIP503CMR-Hsbp cell lysate induced with 50 ng/ml of nisin. B. Western blot showing recombinant Hsbp protein using Novex ECL Chemiluminescent detection system. Fig. S5 Nucleotide sequence of the fusion construct. 1-6: NcoI, 7-71: Csp (signal sequence), 72-107 NEXT (NdeI, EcoRI, XhoI, Thrombin), 108-638: prtR (Anchor sequence) and 638-644: HindIII (PPTX 1272 KB)

Author contributions

AKY received funds, conducted experiments, and wrote the manuscript. SVR conduct experiments of qPCR and analysed data. ND, AK and MK analysed data of the manuscript. RH thoroughly revised the manuscript for its intellectual content and gave final approval for the corrected version of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research work was financially supported by the Indian Council of Medical Research (ICMR), New Delhi, under the ICMR-PDF (3/1/3/PDF(7)/2013-HRD) program and Science and Engineering Research Board, Government of India, under Early Carrier Research Award (No. ECR/2017/000270) Grant.

Data availability

All data generated or analysed during this study are included in this published article (and its supplementary information files).

Declarations

Conflict of interest

The authors declare no competing interests.

Ethical approval

This article does not contain any studies with human participants or animals performed by any of the authors.

References

  1. Anbazhagan K, Sasikumar P, Gomathi S, Priya HP, Selvam GS. In vitro degradation of oxalate by recombinant Lactobacillus plantarum expressing heterologous oxalate decarboxylase. J Appl Microbiol. 2013;115(3):880–887. doi: 10.1111/jam.12269. [DOI] [PubMed] [Google Scholar]
  2. Åvall-Jääskeläinen S, Hynönen U, Ilk N, Pum D, Sleytr U, Palva A. Identification and characterization of domains responsible for self-assembly and cell wall binding of the surface layer protein of Lactobacillus brevis ATCC 8287. BMC Microbiol. 2008;8:165. doi: 10.1186/1471-2180-8-165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Axelsson L, Lindstad G, Naterstad K. Development of an inducible gene expression system for Lactobacillus sakei. Lett Appl Microbiol. 2003;37(2):115–120. doi: 10.1046/j.1472-765X.2003.01360.x. [DOI] [PubMed] [Google Scholar]
  4. Bermúdez-Humarán LG, Kharrat P, Chatel J-M, Langella P. Lactococci and lactobacilli as mucosal delivery vectors for therapeutic proteins and DNA vaccines. Microb Cell Fact. 2011;10(1):S4. doi: 10.1186/1475-2859-10-S1-S4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bezzerri V, Borgatti M, Finotti A, Tamanini A, Gambari R, Cabrini G. Mapping the transcriptional machinery of the IL-8 gene in human bronchial epithelial cells. J Immunol. 2011;187(11):6069. doi: 10.4049/jimmunol.1100821. [DOI] [PubMed] [Google Scholar]
  6. Böhmer N, Lutz-Wahl S, Fischer L. Recombinant production of hyperthermostable CelB from Pyrococcus furiosus in Lactobacillus sp. Appl Microbiol Biotechnol. 2012;96(4):903–912. doi: 10.1007/s00253-012-4212-z. [DOI] [PubMed] [Google Scholar]
  7. Bron P, Baarlen P, Kleerebezem M. Emerging molecular insights into the interaction between probiotics and the host intestinal mucosa. Nat Rev Microbiol. 2011;10:66–78. doi: 10.1038/nrmicro2690. [DOI] [PubMed] [Google Scholar]
  8. Cano Garrido O, Seras J, Garcia-Fruitos E. Lactic acid bacteria: reviewing the potential of a promising delivery live vector for biomedical purposes. Microb Cell Fact. 2015;14:137. doi: 10.1186/s12934-015-0313-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Carvalho RDDO, do Carmo FLR, de Oliveira Junior A, Langella P, Chatel J-M, Bermúdez-Humarán LG, Azevedo V, de Azevedo MS. Use of wild type or recombinant lactic acid bacteria as an alternative treatment for gastrointestinal inflammatory diseases: a focus on inflammatory bowel diseases and mucositis. Front Microbiol. 2017;8:800–800. doi: 10.3389/fmicb.2017.00800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen X, Xu J, Shuai J, Chen J, Zhang Z, Fang W. The S-layer proteins of Lactobacillus crispatus strain ZJ001 is responsible for competitive exclusion against Escherichia coli O157:H7 and Salmonella typhimurium. Int J Food Microbiol. 2007;115(3):307–312. doi: 10.1016/j.ijfoodmicro.2006.11.007. [DOI] [PubMed] [Google Scholar]
  11. Duary RK, Rajput Y, Batish V, Grover S. Assessing the adhesion of putative indigenous probiotic lactobacilli to human colonic epithelial cells. Indian J Med Res. 2011;134:664–671. doi: 10.4103/0971-5916.90992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fredriksen L, Mathiesen G, Sioud M, Eijsink VGH. Cell wall anchoring of the 37-kilodalton oncofetal antigen by Lactobacillus plantarum for mucosal cancer vaccine delivery. Appl Environ Microbiol. 2010;76(21):7359–7362. doi: 10.1128/AEM.01031-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fredriksen L, Kleiveland C, Olsen Hult L, Lea T, Nygaard C, Eijsink V, Mathiesen G. Surface display of N-terminally anchored invasin by Lactobacillus plantarum activates NF- B in monocytes. Appl Environ Microbiol. 2012;78:5864–5871. doi: 10.1128/AEM.01227-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Jacobsen CN, Rosenfeldt V, Hayford AE, Møller PL, Michaelsen K, Paerregaard A, Sandström B, Tvede M, Jakobsen M. Screening of probiotic activities of forty-seven strains of Lactobacillus spp. by in vitro techniques and evaluation of the colonization ability of five selected strains in humans. Appl Environ Microbiol. 1999;65:4949–4956. doi: 10.1128/AEM.65.11.4949-4956.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ji J, Yang H. Using probiotics as supplementation for Helicobacter pylori antibiotic therapy. Int J Mol Sci. 2020;21(3):1136. doi: 10.3390/ijms21031136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ji D, Ma J, Xu M, Agyei D. Cell-envelope proteinases from lactic acid bacteria: biochemical features and biotechnological applications. Compr Rev Food Sci Food Safety. 2021;20(1):369–400. doi: 10.1111/1541-4337.12676. [DOI] [PubMed] [Google Scholar]
  17. Johnson-Henry K, Hagen K, Gordonpour M, Tompkins T, Sherman P. Surface-layer protein extracts from Lactobacillus helveticus inhibit enterohaemorrhagic Escherichia coli O157:H7 adhesion to epithelial cells. Cell Microbiol. 2007;9:356–367. doi: 10.1111/j.1462-5822.2006.00791.x. [DOI] [PubMed] [Google Scholar]
  18. Jørgensen CM, Vrang A, Madsen SM. Recombinant protein expression in Lactococcus lactis using the P170 expression system. FEMS Microbiol Lett. 2014;351(2):170–178. doi: 10.1111/1574-6968.12351. [DOI] [PubMed] [Google Scholar]
  19. Keersmaecker S, Braeken K, Verhoeven T, Vélez M, Lebeer S, Vanderleyden J, Hols P. Flow cytometric testing of green fluorescent protein-tagged Lactobacillus rhamnosus GG for response to defensins. Appl Environ Microbiol. 2006;72:4923–4930. doi: 10.1128/AEM.02605-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim MG, Kim CL, Kim YS, Jang JW, Lee GM. Selective endocytosis of recombinant human BMPs through cell surface heparan sulfate proteoglycans in CHO cells: BMP-2 and BMP-7. Sci Rep. 2021;11(1):3378. doi: 10.1038/s41598-021-82955-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kinoshita H, Hirata Y, Nakagawa H, Sakamoto K, Hayakawa Y, Takahashi R, Nakata W, Sakitani K, Serizawa T, Hikiba Y, Akanuma M, Shibata W, Maeda S, Koike K. Interleukin-6 mediates epithelial-stromal interactions and promotes gastric tumorigenesis. PLoS One. 2013;8(4):e60914–e60914. doi: 10.1371/journal.pone.0060914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kobierecka P, Wyszyńska A, Maruszewska-Cheruiyot M, Wojtania A, Żylińska J, Bardowski J, Jagusztyn-Krynicka E. Lactic acid bacteria as a surface display platform for Campylobacter jejuni antigens. J Mol Microbiol Biotechnol. 2015;25:1–10. doi: 10.1159/000368780. [DOI] [PubMed] [Google Scholar]
  23. Krachler AM, Orth K. Targeting the bacteria–host interface: strategies in anti-adhesion therapy. Virulence. 2013;4:284–294. doi: 10.4161/viru.24606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kuo C-H, Wang SSW, Lu C-Y, Hu H-M, Kuo F-C, Weng B-C, Wu C-C, Liu C-J, Tsai P-Y, Lee T-C, Chen L-W, Cheng K-H, Chang L-L, Wu D-C. Long-term use of probiotic-containing yogurts is a safe way to prevent <i>Helicobacter pylori</i>: based on a Mongolian Gerbil's model. Biochem Res Int. 2013;2013:594561. doi: 10.1155/2013/594561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kusters J, van Vliet A, Kuipers E. Pathogenesis of Helicobacter pylori infection. Clin Microbiol Rev. 2006;19:449–490. doi: 10.1128/CMR.00054-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lesbros D, Corthesy-Theulaz I, Blum A. Helicobacter pylori and probiotics. J Nutr. 2007;137:812S–818S. doi: 10.1093/jn/137.3.812S. [DOI] [PubMed] [Google Scholar]
  27. Li N, Russell WM, Douglas-Escobar M, Hauser N, Lopez M, Neu J. Live and heat-killed Lactobacillus rhamnosus GG: effects on proinflammatory and anti-inflammatory cytokines/chemokines in gastrostomy-fed infant rats. Pediatr Res. 2009;66(2):203–207. doi: 10.1203/PDR.0b013e3181aabd4f. [DOI] [PubMed] [Google Scholar]
  28. Liu J-K, Wei C-H, Hou X-L, Yu L-Y. Passive protection of mice pups through oral or intranasal immunization of dams with recombinant Lactobacillus casei vaccine against ETEC F41. Res Vet Sci. 2014;96(2):283–287. doi: 10.1016/j.rvsc.2014.01.010. [DOI] [PubMed] [Google Scholar]
  29. Majidzadeh Heravi R, Rouzbeh L, Sankian M, Kermanshahi H, Varasteh AR. Optimization and comparison of two electrotansformation methods for lactobacilli. Biotechnology. 2012;11:50–54. doi: 10.3923/biotech.2012.50.54. [DOI] [Google Scholar]
  30. Martín C, Fernández-Vega I, Suárez J, Quirós L. Adherence of Lactobacillus salivarius to hela cells promotes changes in the expression of the genes involved in biosynthesis of their ligands. Front Immunol. 2020;10:3019. doi: 10.3389/fimmu.2019.03019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Mathiesen G, Namløs H, Risoen PA, Axelsson L, Eijsink V. Use of bacteriocin promoters for gene expression in Lactobacillus plantarum C11. J Appl Microbiol. 2004;96:819–827. doi: 10.1111/j.1365-2672.2004.02206.x. [DOI] [PubMed] [Google Scholar]
  32. Miller JH. Experiments in molecular genetics. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory; 1972. [Google Scholar]
  33. Pavan S, Hols P, Delcour J, Geoffroy M-C, Grangette C, Kleerebezem M, Mercenier A. Adaptation of the Nisin-controlled expression system in Lactobacillus plantarum: a tool to study in vivo biological effects. Appl Environ Microbiol. 2000;66:4427–4432. doi: 10.1128/AEM.66.10.4427-4432.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Pei H, Liu J, Cheng Y, Sun C, Wang C, Lu Y, Ding J, Zhou J, Xiang H. Expression of SARS-coronavirus nucleocapsid protein in Escherichia coli and Lactococcus lactis for serodiagnosis and mucosal vaccination. Appl Microbiol Biotechnol. 2005;68(2):220–227. doi: 10.1007/s00253-004-1869-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Pontes D, Azevedo M, Chatel J-M, Langella P, Azevedo V, Miyoshi A. Lactococcus lactis as live vector: heterologous protein production and DNA delivery systems. Protein Expr Purif. 2011;79:165–175. doi: 10.1016/j.pep.2011.06.005. [DOI] [PubMed] [Google Scholar]
  36. Pospiech A, Neumann B. A versatile quick-prep of genomic DNA from gram-positive bacteria. Trends Genet. 1995;11(6):217–218. doi: 10.1016/S0168-9525(00)89052-6. [DOI] [PubMed] [Google Scholar]
  37. Reveneau N, Geoffroy M-C, Locht C, Chagnaud P, Mercenier A. Comparison of the immune responses induced by local immunizations with recombinant Lactobacillus plantarum producing tetanus toxin fragment C in different cellular locations. Vaccine. 2002;20:1769–1777. doi: 10.1016/S0264-410X(02)00027-0. [DOI] [PubMed] [Google Scholar]
  38. Ruiz Rodríguez LG, Mohamed F, Bleckwedel J, Medina R, De Vuyst L, Hebert EM, Mozzi F. Diversity and functional properties of lactic acid bacteria isolated from wild fruits and flowers present in Northern Argentina. Front Microbiol. 2019 doi: 10.3389/fmicb.2019.01091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Ruiz-Bustos E, Sierra A, Romero MJ, Rodríguez-Jaramillo M, Ascencio F. Protection of BALB/c mice against experimental Helicobacter pylori infection by oral immunisation with H. pylori heparan sulphate-binding proteins coupled to cholera toxin ??-subunit. J Med Microbiol. 2000;49:535–541. doi: 10.1099/0022-1317-49-6-535. [DOI] [PubMed] [Google Scholar]
  40. Sahoo A, Mandal AK, Dwivedi K, Kumar V. A cross talk between the immunization and edible vaccine: current challenges and future prospects. Life Sci. 2020;261:118343–118343. doi: 10.1016/j.lfs.2020.118343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Segers ME, Lebeer S. Towards a better understanding of Lactobacillus rhamnosus GG - host interactions. Microb Cell Fact. 2014;13(1):S7. doi: 10.1186/1475-2859-13-S1-S7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Selgrad M, Malfertheiner P. New strategies for Helicobacter pylori eradication. Curr Opin Pharmacol. 2008;8:593–597. doi: 10.1016/j.coph.2008.04.010. [DOI] [PubMed] [Google Scholar]
  43. Song AA-L, In LLA, Lim SHE, Rahim RA. A review on Lactococcus lactis: from food to factory. Microb Cell Fact. 2017;16(1):55. doi: 10.1186/s12934-017-0669-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Sun Y, Wilkinson B, Standiford T, Akinbi H, O'Riordan M. Fatty acids regulate stress resistance and virulence factor production for listeria monocytogenes. J Bacteriol. 2012;194:5274–5284. doi: 10.1128/JB.00045-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Terpou A, Papadaki A, Lappa IK, Kachrimanidou V, Bosnea LA, Kopsahelis N. Probiotics in food systems: significance and emerging strategies towards improved viability and delivery of enhanced beneficial value. Nutrients. 2019;11(7):1591. doi: 10.3390/nu11071591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Tsuzaki M, Bynum D, Almekinders L, Yang X, Faber J, Banes AJ. ATP modulates load-inducible IL-1β, COX 2, and MMP-3 gene expression in human tendon cells. J Cell Biochem. 2003;89(3):556–562. doi: 10.1002/jcb.10534. [DOI] [PubMed] [Google Scholar]
  47. Wyszyńska A, Kobierecka P, Bardowski J, Jagusztyn-Krynicka EK. Lactic acid bacteria—20 years exploring their potential as live vectors for mucosal vaccination. Appl Microbiol Biotechnol. 2015;99(7):2967–2977. doi: 10.1007/s00253-015-6498-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yang B, Chen H, Gu Z, Fengwei T, Ross R, Stanton C, Chen Y, Chen W, Zhang H. Synthesis of conjugated linoleic acid by the linoleate isomerase complex in food-derived lactobacilli. J Appl Microbiol. 2014 doi: 10.1111/jam.12524. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

13205_2022_3428_MOESM1_ESM.pptx (1.2MB, pptx)

Supplementary file1 Fig. S1 Growth curve of (A) recombinant-LGG and (B) non-recombinant LGG at different pH-2.5, 4.0 and 6.5. Growth pattern of recombinant-LGG and non-recombinant-LGG at different pH on various time intervals were non-significant (P>0.05). Fig. S2 Agarose gel showing PCR amplification of Signal and anchor sequences. (A) 1. Csp signal from genomic DNA of LP 21, 2. PrtR Anchor from Genomic DNA of LGG, M. 50 bp DNA Ladder, (B) Overlap PCR amplification fusion product using Csp_F_Nco1/PrtR_R_HindIII, M. 1kb DNA Ladder. Fig. S3 Expression study of recombinant LGG expressing green fluorescent protein. (A) Control: LGG cells harbouring pSIP503CMR (B) Fluorescence detection of recombinant-LGG cells harbouring pSIP503CMR-Gfp induced with 50 ng/ml of nisin using fluorescent microscope. Fig. S4 SDS-PAGE and western blot of Hsbp protein isolated from recombinant-LGG. SDS-PAGE showing the expression of Hsbp protein induced with nisin, Lane: 1. Un-induced LGG culture harbouring pSIP503CMR-Hsbp cell lysate, 2. LGG culture harbouring LGG-pSIP503CMR-Hsbp cell lysate induced with 25 ng/ml of nisin, 3. LGG culture harbouring LGG-pSIP503CMR-Hsbp cell lysate induced with 50 ng/ml of nisin. B. Western blot showing recombinant Hsbp protein using Novex ECL Chemiluminescent detection system. Fig. S5 Nucleotide sequence of the fusion construct. 1-6: NcoI, 7-71: Csp (signal sequence), 72-107 NEXT (NdeI, EcoRI, XhoI, Thrombin), 108-638: prtR (Anchor sequence) and 638-644: HindIII (PPTX 1272 KB)

Data Availability Statement

All data generated or analysed during this study are included in this published article (and its supplementary information files).


Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES