Summary
Pulmonary veno-occlusive disease (PVOD) is a rare form of pulmonary hypertension characterized by the preferential remodeling of the pulmonary venules. Hereditary PVOD is caused by biallelic variants of the EIF2AK4 gene. Three PVOD patients who carried the compound heterozygous variants of EIF2AK4 and two healthy controls were recruited and induced pluripotent stem cells (iPSCs) were generated from human peripheral blood mononuclear cells (PBMCs). The EIF2AK4 c.2965C>T variant (PVOD#1), c.3460A>T variant (PVOD#2), and c.4832_4833insAAAG variant (PVOD#3) were corrected by CRISPR-Cas9 in PVOD-iPSCs to generate isogenic controls and gene-corrected-iPSCs (GC-iPSCs). PVOD-iPSC-endothelial cells (ECs) exhibited a decrease in GCN2 protein and mRNA expression when compared with control and GC-ECs. PVOD-ECs exhibited an abnormal EC phenotype featured by excessive proliferation and angiogenesis. The abnormal phenotype of PVOD-ECs was normalized by protein kinase B inhibitors AZD5363 and MK2206. These findings help elucidate the underlying molecular mechanism of PVOD in humans and to identify promising therapeutic drugs for treating the disease.
Keywords: PVOD, IPSC, endothelial cell, differentiation, EIF2AK4
Highlights
-
•
IPS cell lines from three PVOD patients carrying EIF2AK4 mutations were established.
-
•
Patient-specific iPSC-derived ECs elucidated single-cell phenotype of PVOD.
-
•
PVOD-ECs exhibited excessive proliferation and angiogenesis.
-
•
AZD5363 and MK2206 could reverse the malfunctional phenotype of PVOD-ECs.
In this article, Zhou and colleagues show that PVOD-iPSC-ECs exhibited a decrease in GCN2 protein and mRNA expression, when compared to control and GC-ECs. PVOD-ECs exhibited an abnormal endothelial cell phenotype featured by excessive proliferation and angiogenesis, and the malfunctional phenotype was normalized by AZD5363 and MK2206. These findings help elucidate the underlying molecular mechanism of PVOD.
Introduction
Pulmonary veno-occlusive disease (PVOD) is a rare and devastating cause of pulmonary hypertension (PH) (Montani et al., 2016), which results in the progressive increase in pulmonary vascular resistance, culminating in right heart failure and death (Simonneau et al., 2013). The pulmonary venous system is primarily involved in PVOD, which is characterized by significant pulmonary capillary dilatation and intense proliferation (Mandel et al., 2000; Montani et al., 2009).Through specific pulmonary arterial hypertension (PAH) therapy treatment, PVOD can be characterized by poor prognosis and the possibility of developing severe pulmonary edema. Lung transplantation is the destination therapy for eligible patients (Montani et al., 2016). To date, PVOD remains a poorly understood entity. Thus, identifying the critical pathophysiological mechanisms in mediating pulmonary capillary remodeling would be pivotal for inhibiting and reversing PVOD. The dysfunction of pulmonary endothelial cells (ECs) plays a central role in the initiation and progression of PVOD. Microvascular EC proliferation can be observed in both lung tissues of PVOD patients and the mitomycin-induced rat PVOD model (Perros et al., 2015).
In 2014, the French PH network reported the genealogy of 13 PVOD families with heritable disease, which pointed to eukaryotic translation initiation factor 2 alpha kinase 4 (EIF2AK4) as a major gene that is linked to PVOD development (Eyries et al., 2014). Furthermore, the 2015 ESC/ERS guidelines recommend that the presence of biallelic variants of EIF2AK4 is sufficient to confirm the diagnosis of PVOD, without performing a hazardous lung biopsy for histological confirmation (Galiè et al., 2016). The EIF2AK4 gene codes for general control nonderepressible 2 (GCN2), which belongs to the family of four kinases that phosphorylate the α-subunit of eukaryotic translation initiation factor 2 (eIF2α). GCN2 has been demonstrated to be involved in responses to other triggers, including viral infections, hypoxia, and UV radiation (Donnelly et al., 2013). The expression of GCN2 decreases in pulmonary tissues of PVOD patients (Perros et al., 2015). Heme oxygenase 1 (HO-1) and CCAAT-enhancer-binding protein (C/EBP) homologous protein (CHOP) were reported as the two downstream effectors of GCN2 signaling and ER stress in rat PVOD samples (Manaud et al., 2020), However, there is limited knowledge on how EIF2AK4 biallelic variants cause PVOD in humans.
Induced pluripotent stem cells (iPSCs) made from human adult cells by defined transcription factors can be differentiated into functional cells of different lineages. This provides a promising cell source for translational and regenerative medicine (Guo et al., 2019; Matsa et al., 2014), and it opens an exciting avenue for the generation of patient-specific ECs for cardiovascular disease-modeling and therapeutics. iPSCs can capture the genetic diversity of the patients and are particularly useful for exploring the disease pathogenesis caused by complex genetic variants. Using human-based and patient-specific iPSC-ECs as cellular models, the underlying mechanisms of the human cardiac disease phenotype can be observed, and therapeutic compounds can be screened. Disease-specific iPSC-ECs have been generated and applied to investigate the PAH caused by the bone morphogenetic protein receptor type II (BMPR2) variant (Gu et al., 2017).
The present study generated iPSC lines from three PVOD patients who carried EIF2AK4 variants (PVOD#1: c.2965C>T and c.4724T>C; PVOD#2: c.4736T>C and c.3460A>T; PVOD#3: c.1942A>T and c.4832_4833insAAAG) and two healthy control subjects. Using CRISPR-Cas9 genome-editing technology, the GC-PVOD-iPSC lines were generated as isogenic controls, and the p.Arg989Trp variant (c.2965C>T), p.Lys1154Ter variant (c.3460A>T) and p.Pro1611fs variant (c.4832_4833insAAAG) were corrected. Then, control-iPSC-ECs, PVOD-iPSC-ECs, and GC-PVOD-iPSC-ECs were successfully generated. Afterward, the GCN2 expression, proliferation, and angiogenesis of iPSC-ECs and gene expression profile were compared to determine the mechanism of PVOD at the cellular level and, further, to verify whether AKT inhibitors imatinib and amifostine can effectively rescue the dysfunctional EC phenotype of PVOD.
Results
Clinical characteristics
The recruited PVOD#1 patient was a 39-year-old female, the recruited PVOD#2 patient was a 26-year-old male, and the recruited PVOD#3 patient was a 42-year-old female. These patients exhibited a reduced diffusing lung capacity of carbon monoxide, severe pre-capillary PH, interlobular septal thickening and mediastinal lymlphadenopathy, and centrilobular ground-glass opacification (Figure 1A). These patients were initially diagnosed with PAH, and the genetic screening of PAH-related genes (BMPR2, KCNK3, CAV1, SMAD9, BMPR1B, ACVRL1, ENG, GDF2, SMAD4, EIF2AK4, KCNA5, NOTCH3, and TOPBP1) revealed the compound heterozygous variants in the EIF2AK4 gene pore region of these patients (Figure S1B). The details for the mutations information are presented in Figure 1B. According to the ESC/ERS guidelines, these patients were categorized as having PVOD. The two mutant sites of these patients were inherited from their father and mother, respectively. The PVOD#1 patient has a brother who carries the R989W mutation but does not present any signs of PVOD (Figure S1A). The two healthy control subjects included a 32-year-old male and a 22-year-old female. These subjects had no history of heart disease, serious infections, or obvious genetic diseases (Yang et al., 2018).
Figure 1.
Generation and characterization of PVOD patients-specific induced pluripotent stem cells (iPSCs) and gene-corrected PVOD-iPSCs (GC-PVOD-iPSCs)
(A) The high-resolution computed tomography (CT) of the chest from three PVOD patients showed significant centrilobular ground-glass opacification (The red arrows indicated) and interlobular septal thickening.
(B) The EIF2AK4 mutation sites information in three PVOD patients and their pathogenicity classification. VUS means uncertain significance, and LP means likely pathogenic.
(C) Strategy of correcting EIF2AK4 c.2965 C>T (PVOD#1) variant, c.3460A>T variant (PVOD#2), and c.4832_4833insAAAG variant (PVOD#3). The homologous sequences are shown between the red lines.
(D) DNA sequencing demonstrates variant sites on EIF2AK4 (PVOD#1: c.2965C>T and c.4724T>C; PVOD#2: c.4736T>C and c.3460A>T; PVOD#3: c.1942A>T and c.4832_4833insAAAG) of the three iPSC lines.
Generation and characterization of PVOD-iPSCs and GC-PVOD-iPSCs
PVOD-iPSCs and control-iPSCs were generated from peripheral blood mononuclear cells (PBMCs) derived from three PVOD patients and two healthy control subjects through the nonintegrated Sendai-viral transduction of reprogramming factors (OCT3/4, SOX-2, KLF-4, and C-MYC). Since the biallelic mutations of the EIF2AK4 gene can cause heritable PVOD, and the heterozygous mutation remains insufficient (Eyries et al., 2014), the p.Arg989Trp variant (c.2965C>T), p.Lys1154Ter variant (c.3460A>T), and p.Pro1611fs variant (c.4832_4833insAAAG) were corrected using the CRISPR-Cas9 system with ssODNs as the isogenic controls for PVOD-iPSCs (Figure 1C). All three iPSC lines exhibited typical human pluripotent stem cell-like morphologies (Figure S1C). The immunofluorescence staining revealed that most of the cells were positive for NANOG, OCT4, SSEA-1, and TRA-1 (Figure S2A). The normal karyotypes of PVOD-iPSCs are presented in Figure S2B. This was also verified by regular real-time qPCR, while probing for pluripotency markers (Figure S2D). The EIF2AK4 compound heterozygous variants were further validated by genetic workup in all iPSC lines (Figure 1D), and the cell line was not contaminated with mycoplasma (Figure S2C).
Differentiation and characterization of iPSC-ECs
The three iPSC lines were differentiated into ECs, according to a monolayer differentiation protocol (Paik et al., 2018), This comprised three key steps: mesoderm induction, endothelial specification, and EC purification (Figure S3A). All groups of iPSC-ECs obtained from the three subjects exhibited similar EC cobblestone morphologies, a positive CD144 (VE-cadherin) immunostaining, and an acetylated LDL uptake (Figure 2A). There were no significant differences in cell size among the control-iPSC-ECs, PVOD-iPSC-ECs, and GC-PVOD-iPSC-ECs. Next, western blot and real-time qPCR were performed to determine the effect of compound heterozygous variants on the EIF2AK4 gene expression. As shown in Figure 2B, PVOD-iPSC-ECs had a significant low level of endogenous GCN2 protein and EIF2AK4 mRNA, when compared with those in control-iPSC-ECs. However, the GCN2 expression was rescued in GC-PVOD-iPSC-ECs.
Figure 2.
Excessive angiogenesis and proliferation of PVOD patients induced pluripotent stem cell-derived endothelial cells (PVOD-iPSC-ECs)
(A) Endothelial cells (ECs) differentiated from control, gene-corrected (GC), and PVOD-iPSCs exhibit typical cobblestone morphology, incorporate 3,3′-dioctadecylindocarbocyanine labeled low-density lipoprotein (Dil-LDL, red), and are positive for the EC surface marker CD144 (green). Blue: DAPI. Scale bar represents 100 μm (top), 200 μm (middle), and 200 μm (bottom).
(B) EIF2AK4 gene expression quantified by western blot and densitometric quantification of GCN2 protein and real-time qPCR in iPSC-ECs from controls, PVODs, and GCs. ∗p < 0.05 by one-way ANOVA followed by the Bonferroni test.
(C) Representative images of Ki67 immunostaining and quantitative data to compare the proliferation capacity of iPSC-ECs from controls, PVODs, and GCs. Scale bar, 50 μm. ∗p < 0.05 by one-way ANOVA followed by the Bonferroni test.
(D) MTT assay was conducted to evaluate the proliferation capacity of iPSC-ECs from control, PVODs, and GCs during a 4-day time period. ∗p < 0.05 by two-way ANOVA followed by Bonferroni post hoc test.
(E) Representative images of tube formation of iPSC-ECs from control, PVOD, and GC with quantitative analysis, indicating the number of tubes formed 6 h after seeding cells on Matrigel. Scale bar, 100 μm. Three independent experiments were performed in duplicate.
Excessive cell proliferation and angiogenesis in PVOD-iPSC-ECs
In clinic, PVOD patients suffer from abnormal exuberant pulmonary capillary dilatation and proliferation. Therefore, relative functional experiments were performed to determine whether PVOD-iPSC-ECs can recapitulate the disease phenotype in vitro. A significant increase in Ki67 positive immunostaining was observed in PVOD-iPSC-ECs, when compared with control-iPSC-ECs and GC-PVOD-iPSC-ECs (Figure 2C). Furthermore, the MTT assay revealed an increase in cell count of PVOD-iPSC-ECs, when compared with GC-PVOD-iPSC-ECs (Figure 2D). These data clearly indicate that EIF2AK4 compound heterozygous variants regulate EC proliferation. This is consistent with a previous finding, in which mitomycin (MMC)-exposed PVOD rat lungs presented areas of exuberant microvascular endothelial cell proliferation (Fabrice et al., 2015). Tube formation assay is one of the most widely used in vitro assays to model the reorganization of angiogenesis, which plays a critical role in microvascular growth (Fabrice et al., 2015). As shown in Figure 2E, PVOD-iPSC-ECs had a more aggressive tube formation capacity, when compared with the other lines, indicating that the angiogenesis involved in the pathogenesis of PVOD was caused by the EIF2AK4 compound heterozygous variants. Overall, these present findings distinctly demonstrate that the abnormal endothelial cell phenotype in PVOD-iPSC-ECs is featured by excessive cell proliferation and angiogenic variability, and that the correction of EIF2AK4 variants is requisite to fully normalize the EC dysfunction.
EIF2AK4 knockdown results in elevated proliferation and angiogenesis in HUVECs
Next, the EIF2AK4 small interfering RNA (siRNA) was transfected into human umbilical vein endothelial cells (HUVECs) to further confirm whether EIF2AK4 gene defects trigger the EC disease phenotype. The EIF2AK4 mRNA and GCN2 protein levels remarkably decreased in the EIF2AK4 siRNA group, when compared with the scrambled siRNA group (Figures 3A and 3B). Consistent with a previous finding on PVOD-iPSC-ECs, the EIF2AK4 gene silencing led to immoderate proliferation and angiogenesis, when compared with the scrambled siRNA group, as determined by the MTT assay, Ki67-incorporation assay, and tube formation assay (Figures 3C–3E). Indeed, as a kinase that phosphorylates the α-subunit of eukaryotic translation initiation factor 2 (eIF2α), GCN2 is involved in the control of the general translation in response to various cellular stresses by reducing protein synthesis and regulating changes in expression of genes involved in stress responses, which is defined as the “integrated stress response” (Castilho et al., 2014; Donnelly et al., 2013). The decrease in GCN2 expression disequilibrates the homeostasis, which may contribute to the intemperate expression of genes in proliferation and angiogenesis. These results on HUVECs are consistent with that in rat pulmonary artery ECs with GCN2 inhibitor treatment (Manaud et al., 2020). Overall, these findings indicate that the downregulation of the EIF2AK4 expression is correlated with the EC aberrant proliferation and angiogenic phenotype.
Figure 3.
Disrupted proliferation and angiogenesis phenotype in HUVECs with EIF2AK4 siRNA knockdown treatment
(A and B) Western blot and real-time qPCR show EIF2AK4 expression in HUVECs with EIF2AK4 siRNA knockdown.
(C) MTT assay was conducted to evaluate the proliferation capacity of HUVECs between scramble siRNA and EIF2AK4 siRNA groups during a 4-day time period. ∗p < 0.05 by two-way ANOVA followed by Bonferroni post hoc test.
(D) Representative images of Ki67 immunostaining and quantitative data to compare the proliferation capacity of HUVECs between scramble siRNA and EIF2AK4 siRNA groups. Scale bar, 50 μm.
(E) Representative images of tube formation of HUVECs from scramble siRNA and EIF2AK4 siRNA groups with quantitative analysis. Scale bar, 100 μm. Three independent experiments were performed in duplicate.
EIF2AK4 biallelic variants increase cell cycle and angiogenesis genes in PVOD-iPSC-ECs
Next, RNA sequencing (RNA-seq) was carried out to identify the changes in gene expression between the three PVOD-iPSC-EC lines and the three GC-PVOD-iPSC-EC lines. There were 16,742 upregulated genes and 15,485 downregulated genes in GC-PVOD-iPSC-ECs when compared with PVOD-iPSC-ECs (Figure 4A). In accordance with the findings on the PVOD-iPSC-ECs phenotype, the KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis revealed that the regulated genes that were enriched in gene terms were mainly correlated with pathways on cancer, the cell cycle, and the phosphatidylinositol 3-kinase (PI3K)-protein kinase B (AKT) signaling pathway (Figure 4B). These genes were regulated by the EIF2AK4 compound heterozygous variants, and they were correlated with cell proliferation and angiogenesis, as presented in Figure 4C. Proliferating cell nuclear antigen (PCNA) and minichromosome maintenance (MCM) proteins are standard markers of proliferation that are commonly used to assess the growth fraction of a cell population (Juríková et al., 2016). In the present study, the PCNA and MCM proteins were obviously upregulated in PVOD-iPSC-ECs. It was speculated that the PI3K-Akt signaling pathway was the mainly disturbed pathway involved in the abnormal PVOD-iPSC-EC proliferation and angiogenesis (Haque and Morris, 2017; Wang et al., 2013). Therefore, the expressions of downstream genes were detected, and it was found that the components of the PI3K-AKT signaling pathway evidently changed, and that PVOD-iPSC-ECs expressed higher levels of pro-proliferation (PCNA, MCM7, and MCM4) and pro-angiogenesis genes (PDGFD, VEGFA, and TNC), and lower levels of anti-angiogenesis gene ANGPTL1 (Yu et al., 2021) (Figure 4C). Phospho-Akt/Total-Akt expression was upregulated in PVOD-iPSC-ECs, when compared with GC-PVOD-iPSC-ECs, indicating activation of the AKT signaling (Figure 4D). The further real-time qPCR analysis validated the expression of genes correlated with proliferation (PCNA, MCM7, and MCM4) and angiogenic processes (PDGFD, VEGFA, TNC, and ANGPTL1) (Figures 4E and 4F). Overall, PVOD-specific-ECs were generated, and it was observed that EIF2AK4 compound heterozygous variants contribute to the PVOD-iPSC-EC disease phenotype by regulating the transcriptional profiling correlated with cell proliferation and angiogenesis.
Figure 4.
Differential mRNA-level expression of proliferation and angiogenesis in PVOD induced pluripotent stem cell-derived endothelial cells (iPSC-ECs)
(A) Volcano plots of genes in RNA sequencing between PVOD-iPSC-ECs and GC-PVOD-iPSC-ECs. Blue plots indicate the downregulated genes, and red plots indicate the upregulated genes.
(B) KEGG pathways analysis of genes regulated by EIF2AK4 compound heterozygous variants.
(C) Heatmap comparative analysis of genes related to proliferation and angiogenesis biological processes between PVOD-iPSC-ECs and GC-PVOD-iPSC-ECs.
(D) Phospho-AKT/total-AKT expression quantified by western blot and densitometric quantification in PVOD-iPSC-ECs and GC-PVOD-iPSC-ECs. ∗p < 0.05 by one-way ANOVA followed by the Bonferroni test. Three independent experiments were performed in duplicate.
(E and F) Real-time qPCR of representative genes related to proliferation and angiogenesis biological processes between PVOD-iPSC-ECs and GC-PVOD-iPSC-ECs. Including PCNA, MCM7, MCM4, PDGFD, VEGFA, TNC, and ANGPTL1. Data are presented as the mean ± SEM. ∗p < 0.05 vs. GC-PVOD-iPSC-ECs by Student’s t test. Three independent experiments were performed in duplicate.
The inactivation of the PI3K/AKT signaling pathway is beneficial for PVOD-iPSC-ECs
We attempted to identify novel and effective targeted treatments based on the changes in the molecular biology in PVOD-iPSC-ECs and evaluated the therapeutic efficacy of AKT inhibitors AZD5363 and MK2206 on PVOD-iPSC-ECs. AZD5363, which is also known as capivasertib, is an Akt signaling inhibitor that binds to and inhibits all Akt isoforms (Mroweh et al., 2021). MK2206, which is another allosteric Akt isoform small molecule inhibitor that has been studied in vitro and in vivo in various cancers, has exhibited interesting in vitro activity, resulting in cell-cycle arrest, the inhibition of cancer cell proliferation, and the promotion of apoptosis (Wilson et al., 2014). Remarkably, the Ki67 immunostaining indicated that both AZD5363 (8 nM) and MK2206 (10 μM) have inhibitory effect on PVOD-iPSC-EC proliferation through both microscopic observation and quantitative analysis, when compared with the control group (Figures 5A and 5B). A similar trend was also confirmed in MTT assay that both AZD5363 and MK2206 have a significant dose-dependent inhibitory effect on PVOD-iPSC-EC proliferation, in a dose-dependent manner, during the 4-day time period (Figures 5C and 5D). After 24 h of 8 nM of AZD5363 treatment or 10 μM of MK2206 treatment, the tube formation assay revealed a significant restrained effect on PVOD-iPSC-ECs, when compared with DMSO-treated cells, when observed under a microscope (Figure 5E). Furthermore, the AZD5363 and MK2206 treatment markedly attenuated the abnormal phenotype of PVOD-iPSC-ECs, accompanied by the decreased mRNA levels of proliferation markers (PCNA and MCM7) and angiogenesis markers (PDGFD and VEGFA) (Figures S4A and S4B). These data establish the AKT signaling as a novel therapeutic target for PVOD, indicating that AKT inhibitors may hold promise for the treatment of PVOD patients.
Figure 5.
AZD5363 and MK2206 are beneficial to PVOD-iPSC-ECs disease phenotype with EIF2AK4 compound heterozygous variants
(A and B) Representative images of Ki67 immunostaining of PVOD-iPSC-ECs with DMSO, 8 nM AZD5363, or 10 μM MK2206 treatment and quantitative analysis. Red: Ki67; blue: DAPI. Scale bar, 100 μm. Data are presented as the mean ± SEM. ∗p < 0.05 vs. DMSO group by Student’s t test.
(C) MTT assay to assess the inhibitory effect of AZD5363 on PVOD-iPSC-ECs at dose-dependent concentration during a 4-day time period. ∗p < 0.05 vs. DMSO group. Two-way ANOVA followed by the Bonferroni post hoc test.
(D) MTT assay to assess the inhibitory effect of MK2206 on PVOD-iPSC-ECs at dose-dependent concentration during a 4-day time period. ∗p < 0.05 vs. DMSO group. Two-way ANOVA followed by the Bonferroni post hoc test.
(E) Representative images of tube formation of PVOD-iPSC-ECs with DMSO, 8 nM AZD5363, or 10 μM MK2206 treatment and quantitative analysis. Scale bar, 100 μm.
Imatinib and amifostine attenuate the disease phenotype of PVOD-iPSC-ECs
To date, despite the rapid advances in understanding the mechanisms and genetic basis of PVOD, much less is known on the treatments for PVOD patients. Imatinib is a tyrosine kinase inhibitor specific for platelet-derived growth factor receptor (PDGFR) (Demetri et al., 2002). Since PDGFR is highly expressed in smooth muscle cells of the pulmonary artery in patients with PAH (Montani et al., 2013), imatinib has been suggested as a treatment option for PAH patients (Galiè et al., 2005). Recently, a clinical trial reported that treatment with imatinib can prolong the lifetime and improve the functional capacity of clinically diagnosed PVOD patients (Ogawa et al., 2017; Overbeek et al., 2008; Sato et al., 2019). However, the biological functions of imatinib have not been elucidated at present. In the present study, PVOD-iPSC-ECs were stimulated with imatinib, and MTT assay, Ki67 immunostaining, and tube formation assay were performed. As shown in Figure 6, imatinib significantly attenuated the disease phenotype of PVOD-iPSC-ECs. Accordingly, the mRNA levels of PCNA, MCM7, PDGFD, and VEGFA were obviously inhibited by imatinib (Figure S4C). Imatinib mainly signals through two receptors, PDGFRA and c-Kit (Belloc et al., 2009; Joensuu et al., 2017). The investigators further explored whether imatinib suppresses the PVOD-iPSC-EC proliferation and angiogenic capacity through PDGFRA and c-Kit, or both. Real-time qPCR showed mRNA levels of PDGFRA and c-Kit were significantly upregulated in PVOD-ECs (Figure S5A). As an important member of tyrosine kinase family, c-kit receptor causes specific expression of certain genes, regulates cell differentiation and proliferation, and resists cell apoptosis through activating the downstream signaling molecules fold-lowing interaction with stem cell factor (SCF). SCF/c-kit downstream signal transduction pathways are very complex, and currently known signal transduction pathways include Ras/Erk, PI3K, PLC-γ, and JAK/STAT (Liang et al., 2013), which have overlap with PDGFRA downstream signaling pathways. Therefore, it is indistinct to distinguish SCF/c-kit from PDGFRA. Whereas, nearly no change of SCF expression between PVOD-ECs and GC-PVOD-ECs (Figure S5A) implied no activation of c-Kit signaling. Additionally, AKT signaling is a downstream pathway of PDGFRA, and AKT activation was inhibited by imatinib (Figure S5B). Hence, we concluded imatinib may inhibit ECs proliferation by PDGFRA pathway.
Figure 6.
Relative PAH-drugs testing on PVOD-iPSC-ECs
(A and B) Representative images of Ki67 immunostaining of PVOD-iPSC-ECs with DMSO, 10 μM imatinib, 2 mM amifostine, 10 μM bosentan, and 10 μM slidenafil treatment and quantitative analysis. Scale bar, 100 μm.
(C–F) MTT assay to assess the inhibitory effect of imatinib, amifostine, bosentan, and slidenafil on PVOD-iPSC-ECs at dose-dependent concentration during a 4-day time period.
(G and H) Representative images of tube formation of PVOD-iPSC-ECs with DMSO, amifostine, bosentan, and slidenafil treatment and quantitative analysis. Scale bar, 100 μm. Data are presented as the mean ± SEM. ∗p < 0.05 vs. DMSO group by Student’s t test. Three independent experiments were performed in duplicate.
Over the last 6 decades, amifostine has been pursued as the radioprotective agent of choice by diverse institutions, investigators, and government/funding agencies (Capizzi, 1999; Capizzi and Oster, 2000). A research reported that amifostine ameliorated the mitomycin-induced rat PVOD model with notable improvement in survival, right ventricle hypertrophy, and pulmonary hemodynamics (Perros et al., 2015). However, there are nearly no reports pertaining to the pharmacodynamic study of amifostine on PVOD patients. The present study assessed the effect of amifostine on PVOD-iPSC-ECs, and surprisingly, it was found that at 48 h, the 2 mM of amifostine markedly attenuated the proliferation and angiogenic capacity. As shown in Figure 6, the image suggests the preventive effect of amifostine. Therefore, the cytoprotective agent may be an appropriate candidate drug for PVOD patients. Meanwhile, representative marker genes PCNA, MCM7, PDGFD, and VEGFA were suppressed with the amifostine treatment (Figure S4D).
The present results provide evidence that imatinib and amifostine can be alternative potential drugs for PVOD patients, since these can apparently rescue the disease phenotype of ECs correlated with PVOD at the single-cell level, which are mainly involved in the PVOD pathological process.
The nonprotective effect of bosentan and sildenafil on PVOD-iPSC-ECs
Due to the similar clinical picture of dyspnea on exertion and signs of right heart failure, PVOD is difficult to distinguish from idiopathic PAH (Daraban et al., 2015). However, the administration of PAH-specific therapy (such as endothelin receptor antagonists and type 5 phosphodiesterase inhibitors) can precipitate severe acute pulmonary edema (Bhogal et al., 2019; McLaughlin et al., 2015a). As a synthesized dual endothelin receptor antagonist, bosentan acts as a vasodilator and an anti-proliferative agent, and it is the first oral agent available in China for the treatment of PAH (McLaughlin et al., 2015b; You et al., 2018). However, the clinical outcomes of PVOD patients were worse than those of PAH patients (Palmer et al., 1998; Resten et al., 2004). Although the underlying molecular mechanism remains unclear, the specific vascular endothelial cells obtained from the PVOD patient iPSC line in the present study made it possible to explore the impact of bosentan on ECs. Bosentan has a significant dose-dependent inhibitory effect on PVOD-iPSC-EC proliferation (Figures 6A and 6E). After 48 h of 10 μM of bosentan treatment, the tube formation assay revealed the significant intensive effect of bosentan on PVOD-iPSC-ECs, when compared with DMSO-treated cells (Figures 6G and 6H), and this was accompanied by decreased levels of both PCNA and MCM7, while PDGFD and VEGFA were upregulated after the bosentan treatment (Figure S4E).
Another frequently used drug for PAH patients is sildenafil, which is a type 5 phosphodiesterase inhibitor that reduces pulmonary arterial pressure by increasing the levels of cGMP and nitric oxide in the pulmonary vasculature (Dhariwal and Bavdekar, 2015; Galiè et al., 2005). In a previous study, the patient developed acute pulmonary edema after the introduction of sildenafil (Duarte et al., 2020; Kuroda et al., 2006). We treated the PVOD-iPSC-ECs at 5, 10, and 20 μM concentrations, and the results revealed that sildenafil exhibited a slight upregulation on PVOD-iPSC-EC proliferation capacity (Figures 6A and 6F). Furthermore, the tube formation assay indicated that the tube formation capacity of the different groups was similar (Figures 6G and 6H). Moreover, the mRNA expression levels of PCNA, MCM7, PDGFD, and VEGFA exhibited nearly no differences between the control and sildenafil groups (Figure S4F). Overall, the results demonstrate that although bosentan and sildenafil are available for PAH patients, these may not be the optimal drugs for PVOD, since both could not completely reverse the malfunctional phenotype of PVOD-iPSC-ECs.
Discussion
In the present study, an iPSC-based disease model was utilized, and iPSCs were generated from three PVOD patients who carried two compound heterozygous variants of the EIF2AK4 gene and two healthy control subjects. Then, the p.Arg989Trp variant (c.2965C>T) in PVOD#1, p.Lys1154Ter variant (c.3460A>T) in PVOD#2 p.Pro1611fs variant (c.4832_4833insAAAG) in PVOD#3 were corrected by CRISPR-Cas9 technology in order to generate the GC-PVOD-iPSC lines. The PVOD-iPSC-ECs exhibited a decrease in EIF2AK4 expression, both at the protein and mRNA levels. Furthermore, PVOD-iPSC-ECs exhibited a disease phenotype featured by excessive proliferation and increased tube formation capacity, when compared with control-iPSC-ECs and GC-PVOD-iPSC-ECs. This is consistent with the morphological observation obtained from PVOD human lung tissues or MMC-exposed rat lung tissues (Fabrice et al., 2015). Furthermore, the gene transcriptional profiling of iPSC-ECs exhibited changes correlated with cell proliferation and angiogenic capacity. The elucidation of the PVOD pathophysiology allows for the better understanding of the disease process and, consequently, the development of potential new therapies. Critically, the present results revealed that the disrupted proliferation and angiogenic phenotype of PVOD-iPSC-ECs were normalized by AKT inhibitor AZD5363 or MK2206, as shown in Figure 7. In addition, imatinib and amifostine both could alleviate the cellular disease phenotype, while bosentan and sildenafil could not. Even though they may be beneficial for PAH patients, they would frequently induce pneumonedema when applied to PVOD patients.
Figure 7.
Mechanistic overview of the study
Normal iPSCs and patient-specific iPSCs are generated from two healthy subjects and three PVOD patients. CRISPR-Cas9 genome editing is used to correct the EIF2AK4 variants. The normal iPSCs, PVOD-iPSCs, and GC-PVOD-iPSCs are differentiated into ECs. PVOD-iPSC-ECs exhibited disease phenotype featured by excessive proliferation and increased tube formation capacity when compared with those in control-iPSC-ECs and GC-PVOD-iPSC-ECs. Drug testing reveals that AZD5363, MK2206, imatinib, and amifostine, but not bosentan and sildenafil, normalize the disease phenotype of PVOD-iPSC-EC.
As reported in a previous research, merely the biallelic variants of EIF2AK4 can cause heritable PVOD, while the heterozygous variant is insufficient. In order to provide more evidence for this presumption, the present study generated the GC-PVOD-iPSC lines as isogenic controls by erasing the specific variant sites. On one hand, the GC-PVOD-iPSC-ECs made it possible to eliminate the discrepancy caused by different genetic backgrounds, when compared with unrelated healthy individuals with a heterogeneously genetic background as the control. On the other hand, the phenotype of GC-PVOD-iPSC-ECs regressed to normal and strengthened the hypothesis that the biallelic variant of the EIF2AK4 gene is the initiator for PVOD at the cellular level, further elucidating the cellular disease mechanism and effects of the tested drugs.
GCN2(EIF2AK4) belongs to a family of four kinases and phosphorylates the α-subunit of eukaryotic translation initiation factor 2 (eIF2α). Phosphorylation of eIF2α protects cells by reducing protein synthesis to maintain the homeostasis. We speculated the decreased expression of GCN2 caused by EIF2AK4 mutations breaks the equilibrium and leads to excessive proliferation of ECs. Recently, Li et al.’s study indicated that GCN2 deletion led to activation of the AKT/mTOR pathway (Li et al., 2022), which is consistent with our conclusion in this study. Additionally, they showed GCN2 maintained proteostasis and inhibited Src-mediated AKT activation. Src is a tyrosine kinase that interacts with and facilitates AKT phosphorylation. We assumed that EIF2AK4 mutations activated the AKT signaling by upregulating Scr in endothelial cells, and PVOD-ECs were treated with Scr inhibitor PP2. As shown in Figure S5C, PP2 efficiently inhibited the phosphorylation of Akt.
A defining pathological feature of PVOD is the diffuse involvement of venules and septal veins in a vasculopathy characterized by intimal fibrosis resulting in luminal narrowing or obliteration (Pietra et al., 2004; Wagenvoort and Wagenvoort, 1974). To observe endothelial to mesenchymal transition (EMT) in PVOD-iPSC-ECs, we performed real-time PCR of EMT target genes and immunofluorescence of α-SMA. As shown in Figure S6, mRNA levels of Twist1 and ID1 had nearly no change between control and three PVOD-iPSC-ECs lines (Figure S6A), and α-SMA had negative staining in PVOD-iPSC-ECs (Figure S6B). Therefore, to date, there has been no significant evidence illustrating EMT in this study.
Actually, we also corrected EIF2AK4 c.4724 T>C variant in PVOD#1, c.4736T>C variant in PVOD#2, and c.1942 T>C variant in PVOD#3 and obtained double-mutation corrected iPSC-ECs as control. When compared with double-mutation corrected iPSC-ECs, PVOD-iPSC-ECs still showed a decreased in EIF2AK4 expression and exhibited a typical disease phenotype featured by excessive proliferation and increased tube formation capacity (Figure S7).
In clinic, there are nearly no drugs available for the accurate treatment of PVOD. Another finding in the present study was the identification of AKT inhibitors. Both AZD5363 and MK2206 were effective for reversing the disease phenotype of PVOD-iPSC-ECs. The PI3K/Akt signaling is crucial to various aspects of cell growth and survival, and it is one of the most frequently hyperactivated signaling pathways in cancer cells. Therefore, Akt inhibitors have been extensively considered as therapeutic agents for cancers (Alzahrani, 2019; Porta et al., 2014). Present evidence supports the concept that PVOD and pulmonary capillary hemangiomatosis have indeed a varied expression of the same disorder, and that biallelic mutations in the EIF2AK4 gene are responsible for both (Alzahrani, 2019). Apparently, the changed behaviors of pulmonary endothelial cell caused by the EIF2AK4 biallelic variants are similar to those in cancer cells. However, further detailed investigations are needed to determine whether other therapeutic drugs for cancer patients are appropriate for PVOD patients.
iPSCs potentially provide an opportunity to generate a human cell-based model of PVOD to test the effects of PAH-relative drugs. Even at the cellular level, both imatinib and amifostine can obviously inhibit the effect on cell proliferation and angiogenic capacity at appropriate concentrations. However, it remains difficult to extrapolate this from in vitro studies, due to the complete organism where the intricate factors are involved, such as the hemodynamics status, lung vasculature, and vascular remodeling. Therefore, it remains to be determined whether imatinib and amifostine toxins may be used as therapeutic drugs for the treatment of PVOD in clinic in the future. Indeed, further investigations on safety and efficacy on humans are also needed, especially for amifostine, which has never been used in humans. To date, there has been a paucity of data on the therapeutic schedule of this rare disease. These present findings provide evidence that illustrates the different responses of PVOD-iPSC-ECs to the aforementioned medicines, suggesting a theoretical basis for clinical medication on PVOD patients.
The present study has some limitations. First, the low yield and significant heterogeneity of the observed ECs were the notable defects of the differentiation technique. In addition, when compared with adult pulmonary vein endothelial cells in vivo, the maturity of iPSC-ECs still needs to be improved through further studies in order to allow these to accurately respond to different stimulates. Second, we attempted to utilize a credible and reasonable animal model capable of imitating the pathologic mechanism of human PVOD caused by EIF2AK4 biallelic mutations in order to decipher the previous observations from iPSC-derived ECs. Regrettably, merely the PVOD animal model developed by Frédéric Perros was induced by mitomycin, which involved a totally different pathogenic mechanism, in which even the GCN2 expression decreased. Hence, this was not suitable for in vitro studies in the present research. Meanwhile, we collected information that the EIF2AK4−/− mouse does not display PVOD phenotype and shows no defects in cardiovascular system and respiratory system from The Mouse Genome Informatics Database (MGD; http://www.informatics.jax.org) which is a community model organism knowledgebase for the laboratory mouse (Blake et al., 2021). Furthermore, the discrepancy between multi-species and environmental impact for mutation penetrance may explain for that. Third, the iPSC-ECs or HUVECs used in the present study were not lung specific. Hence, it was not fully convincing to explain why pulmonary vessels were more susceptible to EIF2AK4 mutations. GCN2 is an eIF2α kinase responsible for entirely rewiring the metabolism of cells in response to amino acid starvation stress, and it has been demonstrated that >10% of cancer cell lines appear to be dependent on GCN2 (Saavedra-García et al., 2021) (Gold and Masson, 2022). The factors in the lung environment that trigger the disease require further longitudinal studies.
Collectively, these present findings demonstrate that patient-specific PVOD-iPSC-ECs and GC-PVOD-iPSC-ECs are able to recapitulate the single-cell phenotype of PVOD caused by EIF2AK4 loss-of-function variants. These latest insights into the pathology of PVOD may help elucidate the underlying mechanism and discover suitable therapeutic drugs for treating this disease.
Experimental procedures
Resource availability
Corresponding author
Further information and requests for resources and reagents should be directed to and will be fulfilled by the corresponding author, Zhou Zhou (fwcomd@126.com).
Materials availability
This study did not generate new unique reagents.
Data and code availability
RNA-seq data have been deposited in the NCBI Gene Expression Omnibus. The accession number for the RNA-seq data reported in this paper is GEO: GSE215978.
Materials
The following antibodies were used: goat antibody against human VE-cadherin (1:1,000, AF938; R&D systems); rabbit antibody against human GCN2 (1:1,000; ab134053; Abcam); rabbit antibody against human NANOG (1:500; ab109250; Abcam); rabbit antibody against human OCT4 (1:500; ab200834; Abcam); mouse antibody against human SSEA-1 (1:500; ab16285; Abcam); mouse antibody against human TRA-1 (1:500; ab16288; Abcam); rabbit antibody against phospho-Akt (Ser473) (1:1,000; 31957; Cell Signaling); rabbit antibody against Akt (pan) (1:2,000; 4691; Cell Signaling); Ki67 rabbit monoclonal antibody (1:200; AF1738, Beyotime); Alexa Fluor 488-conjugated donkey anti-rabbit IgG (1:1,000; R37118; Life Technologies); Ficoll-Paque PREMIUM sterile solution (17544202; GE Healthcare); CytoTune-iPS 2.0 Sendai Reprogramming Kit (A16517; Thermo Fisher Scientific); Matrigel (354277; BD); mTeSR medium (05850; STEMCELL Technologies); Y-27632 (STEMCELL Technologies); Accutase (07920; STEMCELL Technologies); MTT for cell proliferation detection (C0009S; Beyotime).
Patient recruitment
Human samples were collected after written informed consent according to the declaration of Helsinki and local ethics board approval (Approval No. 2017-877). PBMCs were obtained from three PVOD patients and two healthy control subjects, and they all signed the informed consent. This study was approved by the Ethics Committees of Fuwai Hospital, National Center for Cardiovascular Diseases, China.
Gene correction of EIF2AK4 variant site by CRISPR-Cas9
Isogenic gene-corrected control was generated using CRISPR-Cas9 mediated homology-directed repair with single-stranded oligo DNA nucleotide (ssODN), which provided the wild-type template for gene correction. To correct the heterozygous c.2965C>T (p. Arg989Trp) mutation in exon 21, the c.3460A>T mutation (p. Lys1154Ter) in exon 25, and the c.4832_4833insAAAG (p. Pro1611fs) in exon 38 of EIF2AK4 gene, three mutation-specific sgRNA, termed sgEIF2AK4 (target site: GTGGCTGTGGGCCATTTTGC, ATTTCATCCCTAAGAACTTC, TGAGGTATCTTTGCTTTCTT), were designed using CRISPOR in http://crispor.tefor.net/. SgEIF2AK4 were generated by in vitro transcription using GeneArt Precision gRNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. ssODN was designed to contain 125 nt in total. The sequences of ssODNs are listed in Table S2. PVOD-iPSCs at 70%–80% confluence were harvested with 0.5 mM EDTA. 1.0 × 105 cells were co-electroporated with 400 ng sgEIF2AK4, 2 μg recombinant Cas9 protein (Thermo Fisher Scientific), and 10 pmol ssODN using 10 μL Neon Tip with 1,100 V, 20 ms, and two pulses by Neon transfection system (Thermo Fisher Scientific). Immediately after electroporation, cells were transferred into one well of Matrigel-coated 24-well plate and cultured in 500 μL mTeSR1 medium containing 5 μM Y-27632 (Selleck Chemicals). Medium was changed daily and Y-27632 was removed 24 h later. 3 days after electroporation, cells were dispersed at low density into Matrigel-coated 60-mm dish in mTeSR1 medium with 10 μM Y-27632, which was removed 24 h later. About 14 days later, large colonies were picked and expanded, which were analyzed for the desired base correction by sanger sequencing of amplicon spanning the target site of EIF2AK4 gene. A positive clone was selected for further analysis.
Endothelial cell differentiation
iPSC-ECs were generated using a 2D monolayer differentiation protocol based on a modification of a previous protocol by Gu’s group (Gu, 2018). Briefly, iPSCs (over passage 25) were grown to 80% confluence and placed in differentiation medium (RPMI and B-27 supplement minus insulin, Life Technologies) toward the mesodermal lineage with 6 mM CHIR-99021 (Selleck Chemicals) for 2 days, followed by 3 mM CHIR-99021 for 2 days. The medium was then changed to a differentiation medium composed of RPMI-B27 without insulin and endothelial medium EGM2 (Lonza Group) supplemented with 20 ng/mL bone morphogenetic protein-4 (PeproTech), 50 ng/mL vascular endothelial growth factor (PeproTech), and 20 ng/mL basic fibroblast growth factor (BD Biosciences). Cells were subjected to medium change every 2 days. On day 12, iPSC-ECs were sorted for CD144+ using antibody-coated beads and a magnetic-activated cell sorter (Miltenyi Biotec) and expanded on 0.2% gelatin coated plates and maintained in EGM-2 BulletKit (Lonza Group) with 10 μM SB431542 (Selleck Chemicals), a TGF-β inhibitor at 37°C, 21% O2, and 5% CO2 in a humidified incubator with medium changes every 48 h. Cells were passaged once they reached 80%–90% confluence. iPSC-ECs used for experiments were between passages 3 and 10.
Statistical analysis
All data are presented as the mean ± standard error of the mean (SEM). The statistical analyses were performed using GraphPad Prism 8.0 software (San Diego). For statistical comparisons, we first used a normality test to evaluate whether the data were normally distributed. For two-group comparisons of normally distributed data, we applied Student’s t test with Welch’s correction if equal standard deviations were not assumed through an F test. In addition, the Brown-Forsythe test was used to assess equal variances among data from more than two groups; we applied ordinary ANOVA or Welch ANOVA for equal variances assumed or not, respectively. Nonparametric tests were used when the data were not normally distributed. In all cases, a statistically significant difference was present when the two-tailed probability was less than 0.05. The details of the statistical analysis applied to each experiment are presented in the corresponding figure legends.
Author contributions
Z.Z., C.X., and B.M. conceived the idea and designed the experiments. T.L. and W.L. performed the data analysis. B.M. prepared the manuscript. Q.Z. and C.X. are responsible for obtaining the PBMCs from the PVOD patients. Cell culture experiments were done by Z.P., H.Y., and K.W. The collection and assembly of the data were done by T.L., W.L. B.M. and Q.C. performed the iPSC differentiation and functional assays of the iPSC-ECs. T.L. and H.Y. contributed to the molecular experiments. Z.P. and K.W. helped with the revisions. All of the authors read and approved the final manuscript.
Acknowledgments
We thank the PVOD patients for kindly providing fresh blood for obtaining PBMCs. This study was supported by the grant National Natural Science Foundation of China (no. 82000342).
Conflict of interests
The authors declare no competing interests.
Published: November 17, 2022
Footnotes
Supplemental information can be found online at https://doi.org/10.1016/j.stemcr.2022.10.014.
Contributor Information
Changming Xiong, Email: xiongcmfw@163.com.
Zhou Zhou, Email: zhouzhou@fuwaihospital.org.
Supplemental information
References
- Alzahrani A.S. PI3K/Akt/mTOR inhibitors in cancer: at the bench and bedside. Semin. Cancer Biol. 2019;59:125–132. doi: 10.1016/j.semcancer.2019.07.009. [DOI] [PubMed] [Google Scholar]
- Belloc F., Airiau K., Jeanneteau M., Garcia M., Guérin E., Lippert E., Moreau-Gaudry F., Mahon F.X. The stem cell factor-c-KIT pathway must be inhibited to enable apoptosis induced by BCR-ABL inhibitors in chronic myelogenous leukemia cells. Leukemia. 2009;23:679–685. doi: 10.1038/leu.2008.364. [DOI] [PubMed] [Google Scholar]
- Bhogal S., Khraisha O., Al Madani M., Treece J., Baumrucker S.J., Paul T.K. Sildenafil for pulmonary arterial hypertension. Am. J. Ther. 2019;26:e520–e526. doi: 10.1097/MJT.0000000000000766. [DOI] [PubMed] [Google Scholar]
- Blake J.A., Baldarelli R., Kadin J.A., Richardson J.E., Smith C.L., Bult C.J., Mouse Genome Database Group Mouse genome Database (MGD): knowledgebase for mouse-human comparative biology. Nucleic Acids Res. 2021;49:D981–D987. doi: 10.1093/nar/gkaa1083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Capizzi R.L. The preclinical basis for broad-spectrum selective cytoprotection of normal tissues from cytotoxic therapies by amifostine. Semin. Oncol. 1999;26:3–21. [PubMed] [Google Scholar]
- Capizzi R.L., Oster W. Chemoprotective and radioprotective effects of amifostine: an update of clinical trials. Int. J. Hematol. 2000;72:425–435. [PubMed] [Google Scholar]
- Castilho B.A., Shanmugam R., Silva R.C., Ramesh R., Himme B.M., Sattlegger E. Keeping the eIF2 alpha kinase Gcn2 in check. Biochim. Biophys. Acta. 2014;1843:1948–1968. doi: 10.1016/j.bbamcr.2014.04.006. [DOI] [PubMed] [Google Scholar]
- Daraban A.M., Enache R., Predescu L., Platon P., Constantinescu T., Mihai C., Coman I.M., Ginghina C., Jurcuţ R. Pulmonary veno-occlusive disease: a rare cause of pulmonary hypertension in systemic sclerosis. Case presentation and review of the literature. Rom. J. Intern. Med. 2015;53:175–183. doi: 10.1515/rjim-2015-0024. [DOI] [PubMed] [Google Scholar]
- Demetri G.D., von Mehren M., Blanke C.D., Van den Abbeele A.D., Eisenberg B., Roberts P.J., Heinrich M.C., Tuveson D.A., Singer S., Janicek M., et al. Efficacy and safety of imatinib mesylate in advanced gastrointestinal stromal tumors. N. Engl. J. Med. 2002;347:472–480. doi: 10.1056/NEJMoa020461. [DOI] [PubMed] [Google Scholar]
- Dhariwal A.K., Bavdekar S.B. Sildenafil in pediatric pulmonary arterial hypertension. J. Postgrad. Med. 2015;61:181–192. doi: 10.4103/0022-3859.159421. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Donnelly N., Gorman A.M., Gupta S., Samali A. The eIF2α kinases: their structures and functions. Cell. Mol. Life Sci. 2013;70:3493–3511. doi: 10.1007/s00018-012-1252-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Duarte A.C., Cordeiro A., Loureiro M.J., Ferreira F. Pulmonary veno-occlusive disease: a probably underdiagnosed cause of pulmonary hypertension in systemic sclerosis. Clin. Rheumatol. 2020;39:1687–1691. doi: 10.1007/s10067-020-04953-4. [DOI] [PubMed] [Google Scholar]
- Eyries M., Montani D., Girerd B., Perret C., Leroy A., Lonjou C., Chelghoum N., Coulet F., Bonnet D., Dorfmüller P., et al. EIF2AK4 mutations cause pulmonary veno-occlusive disease, a recessive form of pulmonary hypertension. Nat. Genet. 2014;46:65–69. doi: 10.1038/ng.2844. [DOI] [PubMed] [Google Scholar]
- Fabrice A., Benoît R., Valérie N., Lau E., Sébastien B., Frédéric P. A simple method to assess in vivo proliferation in lung vasculature with EdU: the case of MMC-induced PVOD in rat. Anal. Cell Pathol. 2015;2015:326385. doi: 10.1155/2015/326385. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Galiè N., Ghofrani H.A., Torbicki A., Barst R.J., Rubin L.J., Badesch D., Fleming T., Parpia T., Burgess G., Branzi A., et al. Sildenafil citrate therapy for pulmonary arterial hypertension. N. Engl. J. Med. 2005;353:2148–2157. doi: 10.1056/NEJMoa050010. [DOI] [PubMed] [Google Scholar]
- Galiè N., Humbert M., Vachiery J.L., Gibbs S., Lang I., Torbicki A., Simonneau G., Peacock A., Vonk Noordegraaf A., Beghetti M., et al. 2015 ESC/ERS guidelines for the diagnosis and treatment of pulmonary hypertension: the joint task force for the diagnosis and treatment of pulmonary hypertension of the European society of cardiology (ESC) and the European respiratory society (ERS): endorsed by: association for European paediatric and congenital cardiology (AEPC), international society for heart and lung transplantation (ISHLT) Eur. Heart J. 2016;37:67–119. doi: 10.1093/eurheartj/ehv317. [DOI] [PubMed] [Google Scholar]
- Gold L.T., Masson G.R. GCN2: roles in tumour development and progression. Biochem. Soc. Trans. 2022;50:737–745. doi: 10.1042/BST20211252. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gu M. Efficient differentiation of human pluripotent stem cells to endothelial cells. Curr. Protoc. Hum. Genet. 2018:e64. doi: 10.1002/cphg.64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gu M., Shao N.Y., Sa S., Li D., Termglinchan V., Ameen M., Karakikes I., Sosa G., Grubert F., Lee J., et al. Patient-specific iPSC-derived endothelial cells uncover pathways that protect against pulmonary hypertension in BMPR2 mutation carriers. Cell Stem Cell. 2017;20:490–504.e5. doi: 10.1016/j.stem.2016.08.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guo F., Sun Y., Wang X., Wang H., Wang J., Gong T., Chen X., Zhang P., Su L., Fu G., et al. Patient-specific and gene-corrected induced pluripotent stem cell-derived cardiomyocytes elucidate single-cell phenotype of short QT syndrome. Circ. Res. 2019;124:66–78. doi: 10.1161/CIRCRESAHA.118.313518. [DOI] [PubMed] [Google Scholar]
- Haque S., Morris J.C. Transforming growth factor-β: a therapeutic target for cancer. Hum. Vaccines Immunother. 2017;13:1741–1750. doi: 10.1080/21645515.2017.1327107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Joensuu H., Wardelmann E., Sihto H., Eriksson M., Sundby Hall K., Reichardt A., Hartmann J.T., Pink D., Cameron S., Hohenberger P., et al. Effect of KIT and PDGFRA mutations on survival in patients with gastrointestinal stromal tumors treated with adjuvant imatinib: an exploratory analysis of a randomized clinical trial. JAMA Oncol. 2017;3:602–609. doi: 10.1001/jamaoncol.2016.5751. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Juríková M., Danihel Ľ., Polák Š., Varga I. Ki67, PCNA, and MCM proteins: markers of proliferation in the diagnosis of breast cancer. Acta Histochem. 2016;118:544–552. doi: 10.1016/j.acthis.2016.05.002. [DOI] [PubMed] [Google Scholar]
- Kuroda T., Hirota H., Masaki M., Sugiyama S., Oshima Y., Terai K., Ito A., Yamauchi-Takihara K. Sildenafil as adjunct therapy to high-dose epoprostenol in a patient with pulmonary veno-occlusive disease. Heart Lung Circ. 2006;15:139–142. doi: 10.1016/j.hlc.2005.07.002. [DOI] [PubMed] [Google Scholar]
- Li C., Wu B., Li Y., Chen J., Ye Z., Tian X., Wang J., Xu X., Pan S., Zheng Y., et al. Amino acid catabolism regulates hematopoietic stem cell proteostasis via a GCN2-eIF2α axis. Cell Stem Cell. 2022;29:1119–1134.e7. doi: 10.1016/j.stem.2022.06.004. [DOI] [PubMed] [Google Scholar]
- Liang J., Wu Y.L., Chen B.J., Zhang W., Tanaka Y., Sugiyama H. The C-kit receptor-mediated signal transduction and tumor-related diseases. Int. J. Biol. Sci. 2013;9:435–443. doi: 10.7150/ijbs.6087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Manaud G., Nossent E.J., Lambert M., Ghigna M.R., Boët A., Vinhas M.C., Ranchoux B., Dumas S.J., Courboulin A., Girerd B., et al. Comparison of human and experimental pulmonary veno-occlusive disease. Am. J. Respir. Cell Mol. Biol. 2020;63:118–131. doi: 10.1165/rcmb.2019-0015OC. [DOI] [PubMed] [Google Scholar]
- Mandel J., Mark E.J., Hales C.A. Pulmonary veno-occlusive disease. Am. J. Respir. Crit. Care Med. 2000;162:1964–1973. doi: 10.1164/ajrccm.162.5.9912045. [DOI] [PubMed] [Google Scholar]
- Matsa E., Burridge P.W., Wu J.C. Human stem cells for modeling heart disease and for drug discovery. Sci. Transl. Med. 2014;6:239ps236. doi: 10.1126/scitranslmed.3008921. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McLaughlin V., Channick R.N., Ghofrani H.A., Lemarié J.C., Naeije R., Packer M., Souza R., Tapson V.F., Tolson J., Al Hiti H., et al. Bosentan added to sildenafil therapy in patients with pulmonary arterial hypertension. Eur. Respir. J. 2015;46:405–413. doi: 10.1183/13993003.02044-2014. [DOI] [PubMed] [Google Scholar]
- McLaughlin V.V., Shah S.J., Souza R., Humbert M. Management of pulmonary arterial hypertension. J. Am. Coll. Cardiol. 2015;65:1976–1997. doi: 10.1016/j.jacc.2015.03.540. [DOI] [PubMed] [Google Scholar]
- Montani D., Günther S., Dorfmüller P., Perros F., Girerd B., Garcia G., Jaïs X., Savale L., Artaud-Macari E., Price L.C., et al. Pulmonary arterial hypertension. Orphanet J. Rare Dis. 2013;8:97. doi: 10.1186/1750-1172-8-97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Montani D., Lau E.M., Dorfmüller P., Girerd B., Jaïs X., Savale L., Perros F., Nossent E., Garcia G., Parent F., et al. Pulmonary veno-occlusive disease. Eur. Respir. J. 2016;47:1518–1534. doi: 10.1183/13993003.00026-2016. [DOI] [PubMed] [Google Scholar]
- Montani D., Price L.C., Dorfmuller P., Achouh L., Jaïs X., Yaïci A., Sitbon O., Musset D., Simonneau G., Humbert M. Pulmonary veno-occlusive disease. Eur. Respir. J. 2009;33:189–200. doi: 10.1183/09031936.00090608. [DOI] [PubMed] [Google Scholar]
- Mroweh M., Roth G., Decaens T., Marche P.N., Lerat H., Macek Jílková Z. Targeting Akt in hepatocellular carcinoma and its tumor microenvironment. Int. J. Mol. Sci. 2021;22:1794. doi: 10.3390/ijms22041794. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ogawa A., Miyaji K., Matsubara H. Efficacy and safety of long-term imatinib therapy for patients with pulmonary veno-occlusive disease and pulmonary capillary hemangiomatosis. Respir. Med. 2017;131:215–219. doi: 10.1016/j.rmed.2017.08.032. [DOI] [PubMed] [Google Scholar]
- Overbeek M.J., Groepenhoff H., Voskuyl A.E., Smit E.F., Peeters J.W.L., Vonk-Noordegraaf A., Spreeuwenberg M.D., Dijkmans B.C., Boonstra A. Membrane diffusion- and capillary blood volume measurements are not useful as screening tools for pulmonary arterial hypertension in systemic sclerosis: a case control study. Respir. Res. 2008;9:68. doi: 10.1186/1465-9921-9-68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Paik D.T., Tian L., Lee J., Sayed N., Chen I.Y., Rhee S., Rhee J.W., Kim Y., Wirka R.C., Buikema J.W., et al. Large-scale single-cell RNA-seq reveals molecular signatures of heterogeneous populations of human induced pluripotent stem cell-derived endothelial cells. Circ. Res. 2018;123:443–450. doi: 10.1161/CIRCRESAHA.118.312913. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Palmer S.M., Robinson L.J., Wang A., Gossage J.R., Bashore T., Tapson V.F. Massive pulmonary edema and death after prostacyclin infusion in a patient with pulmonary veno-occlusive disease. Chest. 1998;113:237–240. doi: 10.1378/chest.113.1.237. [DOI] [PubMed] [Google Scholar]
- Perros F., Günther S., Ranchoux B., Godinas L., Antigny F., Chaumais M.C., Dorfmüller P., Hautefort A., Raymond N., Savale L., et al. Mitomycin-induced pulmonary veno-occlusive disease: evidence from human disease and animal models. Circulation. 2015;132:834–847. doi: 10.1161/CIRCULATIONAHA.115.014207. [DOI] [PubMed] [Google Scholar]
- Pietra G.G., Capron F., Stewart S., Leone O., Humbert M., Robbins I.M., Reid L.M., Tuder R.M. Pathologic assessment of vasculopathies in pulmonary hypertension. J. Am. Coll. Cardiol. 2004;43:25s–32s. doi: 10.1016/j.jacc.2004.02.033. [DOI] [PubMed] [Google Scholar]
- Porta C., Paglino C., Mosca A. Targeting PI3K/Akt/mTOR signaling in cancer. Front. Oncol. 2014;4:64. doi: 10.3389/fonc.2014.00064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Resten A., Maitre S., Humbert M., Rabiller A., Sitbon O., Capron F., Simonneau G., Musset D. Pulmonary hypertension: CT of the chest in pulmonary venoocclusive disease. AJR Am. J. Roentgenol. 2004;183:65–70. doi: 10.2214/ajr.183.1.1830065. [DOI] [PubMed] [Google Scholar]
- Saavedra-García P., Roman-Trufero M., Al-Sadah H.A., Blighe K., López-Jiménez E., Christoforou M., Penfold L., Capece D., Xiong X., Miao Y., et al. Systems level profiling of chemotherapy-induced stress resolution in cancer cells reveals druggable trade-offs. Proc. Natl. Acad. Sci. USA. 2021;118 doi: 10.1073/pnas.2018229118. e2018229118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sato H., Sugimura K., Miura M., Konno R., Kozu K., Yaoita N., Shimizu T., Yamamoto S., Aoki T., Tatebe S., et al. Beneficial effects of imatinib in a patient with suspected pulmonary veno-occlusive disease. Tohoku J. Exp. Med. 2019;247:69–73. doi: 10.1620/tjem.247.69. [DOI] [PubMed] [Google Scholar]
- Simonneau G., Gatzoulis M.A., Adatia I., Celermajer D., Denton C., Ghofrani A., Gomez Sanchez M.A., Krishna Kumar R., Landzberg M., Machado R.F., et al. Updated clinical classification of pulmonary hypertension. J. Am. Coll. Cardiol. 2013;62:D34–D41. doi: 10.1016/j.jacc.2013.10.029. [DOI] [PubMed] [Google Scholar]
- Wagenvoort C.A., Wagenvoort N. The pathology of pulmonary veno-occlusive disease. Virchows Arch. A Pathol. Anat. Histol. 1974;364:69–79. doi: 10.1007/BF01230858. [DOI] [PubMed] [Google Scholar]
- Wang X., Abraham S., McKenzie J.A.G., Jeffs N., Swire M., Tripathi V.B., Luhmann U.F.O., Lange C.A.K., Zhai Z., Arthur H.M., et al. LRG1 promotes angiogenesis by modulating endothelial TGF-β signalling. Nature. 2013;499:306–311. doi: 10.1038/nature12345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wilson J.M., Kunnimalaiyaan S., Gamblin T.C., Kunnimalaiyaan M. MK2206 inhibits hepatocellular carcinoma cellular proliferation via induction of apoptosis and cell cycle arrest. J. Surg. Res. 2014;191:280–285. doi: 10.1016/j.jss.2014.05.083. [DOI] [PubMed] [Google Scholar]
- Yang H., Zeng Q., Ma Y., Liu B., Chen Q., Li W., Xiong C., Zhou Z. Genetic analyses in a cohort of 191 pulmonary arterial hypertension patients. Respir. Res. 2018;19:87. doi: 10.1186/s12931-018-0789-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- You R., Qian X., Tang W., Xie T., Zeng F., Chen J., Zhang Y., Liu J. Cost effectiveness of bosentan for pulmonary arterial hypertension: a systematic review. Can. Respir. Res. 2018;2018:1015239. doi: 10.1155/2018/1015239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu S., You X., Liang H., Li Y., Fu Y., Zhang X., Hu X., An J., Xu Y., Li F. First trimester placental mesenchymal stem cells improve cardiac function of rat after myocardial infarction via enhanced neovascularization. Heliyon. 2021;7:e06120. doi: 10.1016/j.heliyon.2021.e06120. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
RNA-seq data have been deposited in the NCBI Gene Expression Omnibus. The accession number for the RNA-seq data reported in this paper is GEO: GSE215978.







