Neuromasts and Olfactory Organs of Zebrafish Larvae Represent Possible Sites of SARS-CoV-2 Pseudovirus Host Cell Entry

ABSTRACT

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the causative agent of the acute respiratory disease coronavirus disease 2019 (COVID-19), which has resulted in millions of deaths globally. Here, we explored the mechanism of host cell entry of a luciferase-ZsGreen spike (SARS-CoV-2)-pseudotyped lentivirus using zebrafish embryos/larvae as an in vivo model. Successful pseudovirus entry was demonstrated via the expression of the luciferase (luc) gene, which was validated by reverse transcription-PCR (RT-PCR). Treatment of larvae with chloroquine (a broad-spectrum viral inhibitor that blocks membrane fusion) or bafilomycin A1 (a specific inhibitor of vacuolar proton ATPases, which blocks endolysosomal trafficking) significantly reduced luc expression, indicating the possible involvement of the endolysosomal system in the viral entry mechanism. The pharmacological inhibition of two-pore channel (TPC) activity or use of the tpcn2^dhkz1a mutant zebrafish line also led to diminished luc expression. The localized expression of ACE2 and TPC2 in the anterior neuromasts and the forming olfactory organs was demonstrated, and the occurrence of endocytosis in both locations was confirmed. Together, our data indicate that zebrafish embryos/larvae are a viable and tractable model to explore the mechanism of SARS-CoV-2 host cell entry, that the peripheral sense organs are a likely site for viral host cell entry, and that TPC2 plays a key role in the translocation of the virus through the endolysosomal system.

IMPORTANCE Despite the development of effective vaccines to combat the COVID-19 pandemic, which help prevent the most life-threatening symptoms, full protection cannot be guaranteed, especially with the emergence of new viral variants. Moreover, some resistance to vaccination remains in certain age groups and cultures. As such, there is an urgent need for the development of new strategies and therapies to help combat this deadly disease. Here, we provide compelling evidence that the peripheral sensory organs of zebrafish possess several key components required for SARS-CoV-2 host cell entry. The nearly transparent larvae provide a most amenable complementary platform to investigate the key steps of viral entry into host cells, as well as its spread through the tissues and organs. This will help in the identification of key viral entry steps for therapeutic intervention, provide an inexpensive model for screening novel antiviral compounds, and assist in the development of new and more effective vaccines.

INTRODUCTION

The coronavirus disease 2019 (COVID-19) pandemic has so far claimed the lives of over 6.2 million people worldwide (1). It is therefore imperative that we gain a better understanding of the host cell entry mechanisms of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the virus that causes COVID-19. Identifying the sites and components of the infection mechanisms and pathways has the potential to facilitate the development of new therapeutic intervention strategies to limit future waves of infection, illness, and death, as well as the resulting socioeconomic disruption. SARS-CoV-2 entry into host cells is initiated when the spike glycoprotein (S protein) of the virus binds to the angiotensin-converting enzyme 2 (ACE2) receptor on the surface of a host cell (2, 3). To mediate entry of SARS-CoV-2 into a cell, the S protein needs to be cleaved in two places; it is cleaved by furin (or a furin-like proprotein convertase) into S1 and S2 subunits, and then it is cleaved at the S2′ site, which is internal to S2 (4). Two mechanisms of viral entry have been identified, direct cell surface entry, which relies on transmembrane protease, serine 2 (TMPRSS2), to cleave the S2′ site, and clathrin-mediated endocytosis, which occurs in the absence (or low expression levels) of TMPRSS2 (4, 5). In this case, S2′ cleavage is performed by cathepsins (which require an acidic environment), before the virus is trafficked through the endolysosomal system prior to replication and infection (2, 4, 6, 7). Investigating viral entry via the endosomal pathway is the focus of this report.

Two-pore channels (TPCs) are pleiotropic cation-permeable channels found in endolysosomal membranes, which are integral to intracellular Ca²⁺ signaling (8–10). TPCs have been implicated in multiple cellular processes, such as cell growth, differentiation, and development (11), cardiac dysfunction (12), autophagy (13), and viral infection (14, 15). TPC2 is one of the three TPC isoforms present in most vertebrates, and it is expressed primarily in the membranes of late endosomes and lysosomes (16). Numerous recent reports suggest that the genetic ablation or pharmacological inhibition of TPC2 inhibits the entry of SARS-CoV-2, SARS-CoV, and Middle East respiratory syndrome CoV (MERS-CoV) into cells (2, 15, 17–19). This suggests that TPC2 function might play an essential role in the endocytosis-based SARS-CoV-2 viral entry mechanism and in vesicle-mediated trafficking of the virus through the endosomal pathway (6).

The zebrafish (Danio rerio) is frequently used as an animal model for human diseases owing to its inexpensive maintenance, transparent body during the larval stages, genetic manipulability, and the significant orthology between zebrafish and human disease-related genes (20–25). In addition, the early development of an intact innate immune system during the embryo (i.e., fertilization to 3 days postfertilization [dpf]) and larval (>3 dpf) stages (26–28) makes the zebrafish a good disease model for isolating the innate immune responses from the adaptive immune responses during viral infections (29). Recent reports on the use of zebrafish for modeling influenza A, herpes simplex, and chikungunya virus infections (30–33) further support the use of this animal model as a suitable complementary in vivo system to study human viral infections.

While viruses that most commonly infect fish include members of the aquabirnaviruses and betanodaviruses (34), there are also several reports of coronaviruses and viruses with high similarity to coronaviruses naturally infecting fish (35). Regarding the latter, a novel nidovirus, called Pacific salmon nidovirus (PsNV) found in populations of wild sockeye (Oncorhynchus nerka) and Chinook (Oncorhynchus tshawytscha) salmon, was shown to be more like a coronavirus than like other fish nidoviruses. Furthermore, as PsNV was found in the gill tissue, it was suggested that this virus might display a tissue tropism and infection process similar to those of other respiratory coronaviruses (36, 37). More recently, Coronaviridae sequences similar to PsNV have been found in species such as the tiger barb (Puntigrus tetrazona), broad-nosed pipefish (Syngnathus typhle), and fugu fish (Takifugu pardalis) (38). Furthermore, novel coronaviruses have been found in the pouched lamprey (Geotria australis), an ancient lineage of jawless fish, and bony fish species such as the blue spotted mudhopper (Boleophthalmus pectinirostris) and broad-nosed pipefish (Syngnathus typhle) (39). Moreover, SARs-like virus sequences with high homology to SARS-CoV-2 were identified in cells from a crucian carp (Carassius auratus) and the head kidney (analogous to the mammalian adrenal gland) of the grass carp (Ctenopharyngodon idella) (40). Thus, in recent years, coronaviruses and corona-like viruses have been found naturally in a far wider range of fish hosts, including ancient lineages, than originally thought.

Here, we used the zebrafish (both embryos and larvae) as an in vivo model to explore SARS-CoV-2 pseudovirus entry into the cells that form the peripheral anterior organs, specifically the anterior neuromasts (41, 42), and olfactory organs (43, 44). These peripheral sense organs present a direct host cell entry site and thus a possible pathway for SARS-CoV-2 to enter sensory neurons that project from the anterior neuromasts to the anterior lateral line ganglion (45) and from the olfactory epithelia to the olfactory bulbs (46, 47), thus providing a possible direct route to the brain and spinal cord (48–51). In humans, elevated levels of ACE2 expression in the olfactory neuroepithelium have been reported (52), and the nasal tract has been reported as a common site of exposure and entry of SARS-CoV-2 (53).

The lateral line in zebrafish is a peripheral mechanosensory organ system that senses water motion and pressure. It plays a key role in prey and predator detection, object avoidance, and various social behaviors, including schooling and sexual courtship (41, 54, 55). It has also been suggested to have olfactory functions associated with detecting ions in the aquatic environment (56). Two major lateral line systems (anterior and posterior) appear within the first 2 days of development (Fig. 1). Both comprise several pairs of neuromasts, small sensory organs containing sensory hair cells, which are innervated by afferent and efferent neurons, and surrounded by nonsensory support cells (41). The lateral line sensory hair cells share structural, functional, and molecular similarities with hair cells in the inner ear of zebrafish and other vertebrates (57). Zebrafish embryos develop 14 pairs of anterior peripheral neuromasts. Neuromast placodes, which develop into neuromast anlagen, are visible as early as ~16 to 18 h postfertilization (hpf) (43, 58, 59), and they become innervated by sensory neurons as early as ~48 hpf (41). Differentiated neuromast hair cells can be seen by ~20 hpf (60) and have been observed beating between ~48 to 49 hpf (61). All the anterior neuromasts have formed by ~96 hpf (41).

FIG 1.

Schematic to show the timing of development of the zebrafish neuroblasts, olfactory organ, stomodeum, digestive tract, swim bladder, and gills from ~10⅓ to ~144 hpf, encompassing the segmentation, pharyngula, hatching, and larval stages. Schematics of zebrafish embryos/larvae at 1, 3, and 5 dpf are shown. Bars, 500 μm.

Zebrafish embryos also develop a pair of peripheral olfactory organs on the anterior dorsal region of the head (43, 62). These first appear as a pair of olfactory placodes (thickenings of the anterior ectoderm), at ~17 to 18 hpf (62, 63), which develop into the nascent olfactory epithelium. By ~32 hpf, the maturing olfactory placodes invaginate to form the naris, the initial indentations of the periderm that form the pair of nasal cavities (62, 64). Around this time, each naris begins to differentiate into what will form the olfactory organ (65, 66), which in turn differentiates into distinct sensory and nonsensory domains, comprising sensory neurons and ciliated, mucus-producing cells, respectively (46, 67). The maturing olfactory epithelia in turn develop into a pair of highly structured olfactory rosettes, the olfactory organs found in adult zebrafish (43, 67, 68).

Thus, the anterior neuromasts and olfactory epithelia develop prior to the formation of the mouth, which initially appears as an indentation of the periderm, forming the stomodeum, at ~48 hpf (64). Continuity between the stomodeum and the pharynx is not observed until ~72 hpf (61, 64), and further connectivity between the mouth/pharynx and the esophagus, intestinal bulb, midgut, hindgut, and anal opening is not observed until ~120 hpf (69). As a result of this developmental timeline (Fig. 1), only the neuromasts and olfactory epithelia are exposed to the surrounding aquatic environment prior to ~72 hpf, and thus, they represent possible cell entry sites for a variety of waterborne pathogens, including viruses. Other known sites of pathogen entry, such as the forming gills, digestive tract, kidney, and liver, become available as possible infection routes only later in development, when direct access from the surrounding environment is possible.

Here, we demonstrate that a SARS-CoV-2-pseudotyped virus can model SARS-CoV-2 viral entry in zebrafish embryos/larvae early in development via the detection of luciferase gene (luc) expression. We compared the levels of pseudoviral entry in untreated embryos and larvae with those in embryos treated with chloroquine (a broad-spectrum viral inhibitor, which blocks viral entry by increasing the pH of acidic intracellular organelles, such as endosomes and lysosomes) (70–72), bafilomycin A1 (a specific inhibitor of vacuolar proton ATPases, which blocks endolysosomal trafficking) (8, 73), or naringenin (an endolysosomal two-pore channel inhibitor) (19) and in wild-type and tpcn2 mutant lines. We also demonstrate the localization of ACE2 and TPC2, as well as the sites of endocytosis in the neuromasts and olfactory organs of larvae. This suggests that these regions are a likely location for SARS-CoV-2 host cell entry and translocation of the virus through the endolysosomal system (5, 6, 74). Our findings suggest that zebrafish are a viable and tractable model to explore SARS-CoV-2 entry into peripheral sense organs (75, 76). In addition, our new data support the suggestion that endolysosomes in general, and TPCs in particular, might represent possible targets for future SARS-CoV-2-related therapeutic intervention (6, 7, 10, 17).

RESULTS

Validating use of the SARS-CoV-2 spike pseudotyped lentivirus (Luc-ZsGreen dual reporter) to model live viral entry into HEK293T cells.

In vitro studies were conducted initially to determine the suitability of the SARS-CoV-2 spike-pseudotyped lentivirus (Luc-ZsGreen dual reporter) to model live viral entry into host cells (see Fig. S1 in the supplemental material). By measuring the level of luciferase-dependent luminescence generated, we compared the amount of luc-expressing pseudovirus entry in parental HEK293T cells and in ACE2-overexpressing HEK293T cells (here called 293T-ACE2 cells) (Fig. S1A). We found that pseudovirus entry occurred only in the 293T-ACE2 cells (Fig. S1Ba) and that luminescence was generated only when these cells were treated with the pseudovirus (Fig. S1Bb). We also showed that treatment of 293T-ACE2 cells with naringenin, tetrandrine, bafilomycin A1, fangchinoline, or cepharanthine (i.e., previously reported in vitro inhibitors of SARS-CoV-2 infection [2, 19, 77, 78]) led to a significant inhibition of pseudoviral entry compared with the dimethyl sulfoxide (DMSO) control (Fig. S1C).

Pseudovirus entry into intact wild-type zebrafish larvae at 3 dpf following a 72-h incubation.

Upon validation of the pseudovirus in vitro in 293T-ACE2 cells, the pseudovirus was then used in an in vivo model, the larvae of the zebrafish (Fig. 2). Larvae were incubated with polyethylene glycol-purified pseudovirus (here called PEG-pseudovirus). Initially, this incubation was initiated at 3 dpf, when there was continuity between the mouth and pharynx (64), and it continued for 72 h (i.e., until 6 dpf), by which time the pharyngoesophageal region had fused to the more caudal regions of the digestive tract (69) (Fig. 1 and 2A). Pseudoviral entry was then determined by reverse transcription-PCR (RT-PCR) detection of the luc gene. First, ABTU strain wild-type larvae were exposed to the live or heat-inactivated PEG-pseudovirus; a distinct band of 515 bp was observed in the live-pseudovirus group, whereas no band was observed in the heat-inactivated-pseudovirus group (Fig. 2B). To validate successful pseudoviral entry, the 515-bp RT-PCR product was confirmed to be luc by Sanger sequencing (Fig. S2). Cotreatment of ABTU larvae with the PEG-pseudovirus and either chloroquine or bafilomycin A1 showed a decrease in luc expression compared with the respective controls (Fig. 2C).

FIG 2.

Effect of incubating ABTU wild-type embryos with PEG-pseudovirus at ~3 dpf for 72 h. (A) Schematic to show when embryos were incubated with PEG-pseudovirus. (B) Representative (n = 4) gel electrophoresis image showing RT-PCR results from cDNA extracted from whole ABTU larvae exposed to live or heat-inactivated PEG-pseudovirus. (C) (a and b) Representative gel electrophoresis images and (c and d) bar charts of the RT-PCR results from cDNA extracted from whole ABTU larvae exposed to live PEG-pseudovirus and treated with (a and c) 50 μM chloroquine or (b and d) 50 nM bafilomycin A1 (n = 4 for each). The level of expression of luciferase (luc) mRNA was determined against that of glucose-6-phosphate dehydrogenase (g6pd) mRNA, and the gene expression level following treatment with chloroquine or bafilomycin A1 was measured relative to the respective untreated or DMSO-treated controls. Values are means and standard errors of the means (SEM) from 4 experiments. A 2-sample t test was used to calculate statistical significance. **, P < 0.01.

Expression of ace2 mRNA and ACE2 protein in zebrafish larvae.

As ACE2 is the main receptor of SARS-CoV-2 entry into host cells, the expression of ace2 mRNA and localization of ACE2 protein in intact zebrafish were determined by quantitative RT-PCR (qRT-PCR) and immunohistochemistry, respectively (Fig. 3).

FIG 3.

Expression of ace2 mRNA and ACE2 protein in zebrafish embryos and larvae. (A) Localization of ACE2 in the head (viewed from a dorsal orientation) at 3 dpf, 5 dpf and 8 dpf (n = 4 to 7) showing distinct expression in the olfactory organ (black arrowheads), neuromasts (white arrowheads) and epiphysis (brown arrowheads). (B) Schematic showing a dorsal view of the head of a zebrafish larva at 5 dpf indicating the position of the olfactory organs (OO), the nasal (N), supraorbital (SO1 to SO3) and otic (O1) neuromasts, and the epiphysis. (C) Lateral view of the head showing the localization of ACE2 at 5 dpf. Expression in the olfactory organ, neuromasts, and otic vesicle is indicated by black, white, and pink arrowheads, respectively. (D) Expression of ace2 mRNA at 2 dpf, 3 dpf, 5 dpf, and 8 dpf was determined by qRT-PCR. The gene expression levels were quantified using the ΔΔC_T method and are presented as fold change (2^−ΔΔCT), with β-actin as the internal control, and normalized to the values for the 2-dpf group. (E) Representative (a and b) confocal and (c) bright-field images showing the expression of (a) ACE2 and (b) the nuclei (labeled with Hoechst 33258) in the head of a larva (dorsal view) at 5 dpf. The black, white, and red arrowheads indicate distinct ACE2 labeling in the olfactory organ, neuromasts, and epiphysis, respectively. The region bounded by the yellow square in panel a is shown at higher magnification in panel g1. (d to f) Surface plots showing the fluorescence intensity in neuromast SO2, the olfactory organ, and epiphysis, respectively. (g to i) Line scans were conducted across neuromast SO2 to compare the pattern of expression of ACE2 with respect to the localization of nuclei. The colored image (g1) was converted to greyscale (g2) before a line scan analysis was conducted. (i) Line graphs showing the change in gray value for the expression of ACE2 and localization of nuclei. Bars, 100 μm (A, C, and E [panel a]) and 20 μm (E [g1]).

As the entry of SARS-CoV-2 in humans is primarily through the nasal and oral route (53), the localization of ACE2 was assessed in the heads of zebrafish at ~3 dpf to ~8 dpf (Fig. 3A). Immunohistochemistry revealed that ACE2 is localized in the olfactory organs, neuromasts, and epiphysis (Fig. 3A and C). Figure 3B shows a schematic illustration of the head of a 5-dpf larva indicating the location of the olfactory organs (OO), nasal (N), supraorbital (SO), and otic (O) neuromasts, and the epiphysis. The expression of the ace2 mRNA in intact embryos and larvae from 2 dpf to 8 dpf was confirmed by RT-PCR (Fig. 3D).

A comparison of ACE2 expression compared to different regions of the head, indicated by Hoechst staining of the nuclei and in a bright-field view (Fig. 3E), confirmed the localization of ACE2 in the olfactory, neuromast and epiphysis regions mentioned above. Three-dimensional (3D) surface scans of the neuromast (Fig. 3E, panel d), olfactory organ (Fig. 3E, panel e), and epiphysis (Fig. 3E, panel f), indicated in Fig. 3E (panel a), show the distribution of ACE2-dependent fluorescence of each structure. Furthermore, line scans taken across the ACE2-dependent (Fig. 3E, panels g1 and g2) and Hoechst-dependent (Fig. 3E, panel h) fluorescence in the neuromast (bounded by the yellow square in Fig. 3E, panel a) indicate that ACE2 was localized throughout the neuromast structure (Fig. 3E, panel i).

Localization of HuC/D in the head at 5 dpf.

Larvae at 5 dpf were immunolabeled with an antibody to HuC/D, a pan-neuronal nuclear marker, and costained with fluorescent phalloidin to label F-actin. The anti-HuC/D antibody clearly revealed the distribution of neurons in the periphery of the olfactory organ at this time of development (Fig. 4).

FIG 4.

Localization of neurons in the olfactory organ of larvae at 5 dpf. Representative (n = 7) dorsal views of a larva (A) immunolabeled with anti-HuC/D, to label neuronal nuclei, and then stained with (B) Hoechst 33258 and (C) fluorescent phalloidin, to label the nuclei and F-actin, respectively. (D) Merged HuC/D and phalloidin images. The regions bounded by the yellow squares in panels a are shown at higher magnification in panels b. Bars, 100 μm (panels a) and 50 μm (panels b).

PEG-pseudovirus entry into intact wild-type zebrafish larvae at 2 dpf following a 48-h incubation.

To limit the time of pseudoviral entry to after the onset of ACE2 expression but prior to the connectivity of all the components of the primitive digestive tract, larvae were incubated with the PEG-pseudovirus at 2 dpf for 48 h (Fig. 5A). To validate this modified protocol, ABTU larvae were exposed to live or heat-inactivated PEG-pseudovirus, and pseudoviral entry was confirmed via RT-PCR detection of luc expression (Fig. 5B). Consistent with the results in Fig. 2B, a distinct band of 515 bp was observed for the live pseudovirus group and no band was observed for the heat-inactivated pseudovirus group. Similarly, treatment with bafilomycin A1, using the modified incubation protocol, showed a significant decrease in pseudoviral entry upon RT-PCR analysis of luc expression compared with that of the DMSO solvent control (Fig. 5C).

FIG 5.

Effect of incubating ABTU wild-type embryos with PEG-pseudovirus at ~2 dpf for 48 h. (A) Schematic to show when embryos were incubated with PEG-pseudovirus. (B) Representative (n = 4) gel electrophoresis image of luc expression from RT-PCR analysis of cDNA extracted from whole embryos exposed to live or heat-inactivated PEG-pseudovirus. (C) (a) Representative (n = 4) gel electrophoresis images showing an RT-PCR analysis of cDNA obtained from whole embryos pretreated with bafilomycin A1 or DMSO (control) prior to exposure to live PEG-pseudovirus. (b) Quantification of the relative expression of luc mRNA in the bafilomycin A1 group, compared to the DMSO group. In both treatment groups, the level of expression of luc was determined against that of g6pd mRNA. (D to F) Immune and inflammatory responses of intact zebrafish larvae upon exposure to live PEG-pseudovirus. RT-qPCR analysis of cDNA obtained from zebrafish larvae exposed to PBS containing PEG-pseudovirus or PBS and PEG alone (solvent control) showing changes in the expression of (D) ifnphi1, (E) ccl20a.3, and (F) il1b. The gene expression levels were quantified using the ΔΔC_T method and are presented as fold change (2^−ΔΔCT), with β-actin as the internal control and relative to the PBS-PEG solvent control group. For panels Cb and D to F, 2-sample t tests were used to calculate statistical significance. *, P < 0.05; ***, P < 0.001.

The innate immune and inflammatory responses to pseudoviral entry were also assessed through RT-qPCR analysis of intact larvae exposed to live PEG-pseudovirus or a solvent control (Fig. 5D to F). The data show an upregulation of the ifnphi1, cc120a.3, and il1b genes, compared with the solvent control (Fig. 5D to F). Taken together, these results show that pseudoviral entry coincides with the onset of ACE2 expression, which is prior to the formation of a continuous gastrointestinal tract in zebrafish larvae. Furthermore, it stimulates an innate immune and inflammatory reaction, which somewhat resembles the response during SARS-CoV-2 infection in humans.

Exploring the role of TPC2 in pseudoviral entry in larvae.

Larvae at 3 dpf and 5 dpf were immunolabeled with an anti-TPC2 antibody (Fig. 6A), the specificity of which has been previously demonstrated in zebrafish slow muscle cells (see Figure 3 in reference 79). The data indicate that TPC2 is expressed in the supraorbital neuromasts, olfactory organs, and epiphysis in the head (Fig. 6A, panels a and b), as shown schematically in Fig. 6A, panel c. 3D surface scans of neuromast SO2 (Fig. 6A, panel d) and one of the olfactory organs (Fig. 6A, panel e) in the 5-dpf larva (indicated by the white square and white circle, respectively, in Fig. 6A, panel b), show the localization of TPC2 in each structure.

FIG 6.

Effect of pharmacologically mediated inhibition of TPC2 activity or CRISPR/Cas9-mediated tpcn2 knockout on PEG-pseudovirus entry in zebrafish larvae. (A) (a and b) Immunolabeling analysis of TPC2 localization in the head at 3 dpf and 5 dpf (viewed from a dorsal orientation) showing distinct expression in the olfactory organ (black arrowheads), neuromasts (white arrowheads), and epiphysis (brown arrowheads). (c) Schematic showing a dorsal view of the head of a zebrafish larva at 5 dpf indicating the position of the olfactory organs (OO), nasal (N) and supraorbital (SO1 to SO3) neuromasts, and epiphysis. (d and e) Surface plots showing the fluorescence intensity in neuromast SO2 and the olfactory organ, respectively. Bar, 100 μm. (B) RT-PCR analysis of cDNA obtained at 2 dpf from intact wild-type embryos that were pretreated with naringenin or DMSO (control) prior to exposure to live PEG-pseudovirus for 48 h. (a) Representative electrophoresis gel showing luc expression and (b) quantification of the relative expression of luc in the naringenin group compared to the DMSO group. (C) RT-PCR analysis of cDNA obtained from intact wild-type and tpcn2^dhkz1a embryos, which were exposed to live PEG-pseudovirus at 2 dpf for 48 h. (a) Representative electrophoresis gel showing luc expression and (b) quantification of the relative expression of luc in the tpcn2 mutant compared to the wild-type control. (D) Representative electrophoresis gel of luc expression from RT-PCR analysis of cDNA extracted from the excised heads alone of wild-type and tpcn2^dhkz1a embryos that had been exposed to live PEG-pseudovirus at 2 dpf for 48 h.

The effect of the pharmacological inhibition of TPC2 function or the genetic knockout of tpcn2 expression was analyzed in intact larvae incubated with the PEG-pseudovirus at 2 dpf for 48 h (Fig. 6B and C). Larvae pretreated with naringenin and then cotreated with this drug and the pseudovirus showed a significant decrease in luc expression compared with the DMSO-treated control (Fig. 6B). Similar results were obtained when larvae were pretreated and cotreated with tetrandrine (Fig. S3). Furthermore, our tpcn2-knockout mutant line (tpcn2^dhkz1a), containing an ~8-bp deletion in the tpcn2 gene (previously established in reference 80), was used to determine the effect of an attenuation of tpcn2 expression on the entry of the PEG-pseudovirus into zebrafish larvae. RT-PCR analysis showed that luc expression was significantly reduced in the mutants compared with the ABTU wild-type larvae (Fig. 6C). To assess the amount of pseudovirus entry into the head of larvae, tpcn2^dhkz1a or ABTU larvae were incubated with the PEG-pseudovirus at 2 dpf for 48 h, after which RT-PCR was conducted on the heads alone (Fig. 6D). Our data show that entry of the pseudovirus was markedly decreased in the tpcn2^dhkz1a heads compared to the ABTU controls. These results indicate that the inhibition of TPC2, via either pharmacological or CRISPR-mediated gene editing approaches, inhibited PEG-pseudovirus entry in whole larvae and heads, which supports the suggestion that TPC2 is involved in the endosomal host cell entry and vesicle trafficking pathway associated with SARS-CoV-2 infection.

Visualizing endocytosis in the heads of larvae at 5 dpf.

Endocytosis was visualized via the uptake of Alexa Fluor 488 in the heads of larvae at ~5 dpf (Fig. 7). In the dorsal views of the head, uptake of the fluorescent dextran was most obvious in SO1 to SO3 and O1 neuromasts (Fig. 7A, panels a and b), as indicated in the schematic illustration (Fig. 7A, panel c).

FIG 7.

Visualization of endocytosis via the uptake of Alexa Fluor 488-dextran (AF488), in the head of zebrafish larvae at 5 dpf. (A) Representative (n = 7) dorsal views of the head showing (a) fluorescence and (b) fluorescence and bright-field merged images to show the uptake of AF488 in the supraorbital and otic neuromasts (white arrowheads). (c) Schematic showing a dorsal view of the head of a zebrafish larva at 5 dpf indicating the main regions of AF488 uptake (green). (B) Higher-magnification views (n = 3) of AF488 uptake (green) in (a to g) a neuromast, where the F-actin was labeled with Alexa Fluor 568 phalloidin (red), and (h) a neuromast (white arrowhead) and olfactory organ (yellow arrowheads). (C) Effect of bafilomycin A1 on AF488 uptake into the head neuromasts. Embryos were incubated with (a and c) bafilomycin A1 or (b and d) DMSO (controls). Images are representative (n = 6 for each treatment group) (a and b) fluorescence images and (c and d) fluorescence images merged with bright-field images. The regions bounded by the yellow squares in panels a and b are shown at higher magnification in panels a1 to b2. (e and f) Higher-magnification view of an O1 neuromast. All images are stacks of optical sections projected as single images except panels Bb to g and Ce and f, which show single optical sections. Bars, 100 μm (A, Cc, and Ca2), 50 μm (Bh), and 20 μm (Ba and Ce).

In some experiments, embryos were incubated with Alexa Fluor 488 and then fixed and incubated with Alexa Fluor 568 phalloidin to label F-actin (Fig. 7B, panels a to g), to show the regions of endocytosis in more detail. Figure 7B, panel a, shows a projected view of ~12 optical sections, whereas panels b to g show single optical sections through the neuromast and indicate the amount of endocytosis that has occurred. Compared to the neuromasts, relatively little Alexa Fluor 488 uptake occurred in the immature olfactory organ (Fig. 7B, panel h).

In another series of experiments, the uptake of Alexa Fluor 488 was compared in larvae treated with bafilomycin A1 and DMSO (control) (Fig. 7C). The regions bounded by the yellow squares in Fig. 7C, panels a and b, are shown at higher magnification in Fig. 7C, panels a1 and b2, and these indicate that following bafilomycin A1 treatment, the neuromasts in the head had increased levels of fluorescence, especially in the cupula region of the sensory hair cells, compared with the DMSO controls. Higher-magnification single optical sections through a representative O1 neuromast from a bafilomycin A1 treated embryo are shown in Fig. 7C, panels e and f. These clearly show the uptake of Alexa Fluor 488 in the membrane-bound kinocilia contained in the cupula. These structures are shown schematically in Fig. 8A.

FIG 8.

Schematic illustrations to show the suggested mechanism of PEG-pseudovirus entry into the anterior neuromasts of zebrafish larvae. (A) Structure of a neuromast. The regions bounded by the black and red rectangles are shown at higher magnification in panels B and C, respectively. (B) Proposed endocytic pathway illustrating the localization of TPCs (both TPC1 and TPC2) on different endolysosomal compartments and the location of bafilomycin A1 inhibition. (C) Proposed endocytic mechanism in the anterior neuromasts of (a) DMSO-treated (control) and (b) bafilomycin A1-treated larvae, after incubation with Alexa Fluor 488-dextran (green). Panel A was modified from reference 155 with permission of Elsevier, and panel B was modified from reference 156 with permission of the Federation of European Biochemical Societies.

DISCUSSION

Validating pseudoviral host cell entry.

Before beginning our in vivo experiments with zebrafish, we undertook a series of experiments to determine the suitability of the SARS-CoV-2 spike-pseudotyped lentivirus (Luc-ZsGreen dual reporter) to model live viral entry into HEK293T-ACE2 cells (Fig. S1). We were then able to recapitulate our in vitro data by incubating 3-dpf larvae with a PEG-pseudovirus for 3 days and showing host cell entry. In contrast, PEG-pseudovirus entry was attenuated on heat inactivation (Fig. 2B) or when larvae were treated with chloroquine (Fig. 2C, panel a) or bafilomycin A1 (Fig. 2C, panel b). The latter has previously been reported to decrease entry of SARS-CoV-2 pseudovirus into HEK293/hAEC2 cells by >99% (2). We also validated luc expression by RT-PCR product identification via Sanger sequencing. Our data showed a significant overlap between the expected luc product and the sequenced RT-PCR luc product (Fig. S2). Finally, via RT-qPCR we assessed the innate immune and inflammatory responses as a readout to indicate PEG-pseudovirus entry into intact larvae compared to the solvent control (Fig. 5D to F). Our data show a significant upregulation of three zebrafish immune or inflammatory response genes, ifnphi1, cc120a.3, and il1b (81, 82) (Fig. 5D to F). The innate immune system develops early during the embryonic and larval stages (26–28) (Fig. 1), possibly in response to pathogen entry via the peripheral sensory organ sites. Zebrafish have been shown to be a useful system in which to model viral infections via their innate immune response, and this has helped advance antiviral research (83).

We then proceeded to identify possible sites of PEG-pseudovirus entry in zebrafish larvae, starting with incubation for 72 h beginning at 3 dpf (Fig. 2A), then focusing more on earlier host cell entry by incubating embryos for 48 h, starting at 2 dpf. Our decision to concentrate on the anterior regions of developing embryos/larvae was due to the early appearance of the anterior peripheral sense organs (41, 62) and their associated brain regions at these early stages (84), thus limiting the possible sites of viral entry. Our approach was to identify tissues/organs that express the ACE2 receptor (2, 3, 74) and then link this with the expression of TPC2, reported to be required for vesicle trafficking during SARS-CoV-2 infection (17–19), and associated endocytic activity, a proposed mechanism and pathway of host cell entry (4, 5).

Identifying possible sites of pseudovirus entry in zebrafish larvae.

(i) Neuromasts. In our study, we focused on the 14 pairs of anterior neuromasts, as they are relatively static during their formation, unlike the more motile neuromasts of the posterior lateral line (85, 86). When formed, each neuromast consists of several centrally located sensory hair cells. These are supported by sustentacular cells, which in turn are surrounded by mantle supporting cells, resulting in discrete circular mechanosensory organs (60) (Fig. 8A). Both anterior and posterior neuromasts project neurons to and receive neurons from anterior and posterior lateral line ganglia, respectively, which in turn connect to specific cellular domains in the rhombencephalon (41, 45, 87). Thus, both lateral line systems present possible direct routes for viral entry from the aquatic environment into the central nervous system (CNS) via the neuromast hair cells. Our data showed that the anterior neuromasts express ACE2 (Fig. 2) and TPC2 (Fig. 6) and they also display endocytic activity (Fig. 7), supporting this suggested route of entry into neurons (48–51).

To investigate whether the anterior lateral line neuromasts might represent a TPC2-mediated site of host cell entry, rather than those of the forming posterior lateral line, we excised the heads of larvae (just caudal to the otic vesicle) that had been exposed to live PEG-pseudovirus for 48 h starting at 2 dpf and compared ABTU controls with our tpcn2^dhk2la mutants. Our results (Fig. 6D) support our suggestion that the PEG-pseudovirus can enter head tissues of zebrafish larvae in a window between 2 dpf and 4 dpf. Our ACE2 and TPC2 expression data, and especially our Alexa Fluor 488-dextran endocytosis results, suggest that in this 2-day window, the anterior neuromasts (rather than the olfactory organs; compare panel a of Fig. 7B with panel h and see the next section) might be the main site of PEG-pseudovirus entry. We suggest that this might be due to the neuromasts reaching their mature and functional form earlier in development than the more complex olfactory organs, which continue to develop and mature up to the adult stage at ~90 dpf (88). In their mature form, the olfactory organs might equal or surpass the neuromasts as being a major site of viral entry, and thus, adult zebrafish, rather than larvae, might be a more suitable complementary model to explore the SARS-CoV-2 anosmia-related symptoms common to COVID-19 infection (89). Our new data suggest that different stages of zebrafish development might prove helpful for uncovering the molecular mechanisms and sites of host cell entry, as well as serving as an inexpensive platform for screening novel antiviral drugs (32, 33, 90).

The hair cells of neuromasts are similar (regarding both structure and function) to those found in the inner ear, as they both sense movement by the deflection of stereocilia (41, 87, 91, 92). Indeed, the lateral line and its composite neuromasts are suggested to have been present in ancestral vertebrates but subsequently lost in most terrestrial linages (41, 93). It has been recently reported that SARS-CoV-2 infection of the human inner ear, possibly via the labyrinthine artery or through the round and oval window membranes (which the virus can reach via the Eustachian tube), might underlie COVID-19-associated audiovestibular dysfunction (94). We suggest, therefore, that zebrafish neuromast hair cells (and those of the larval inner ear) might be an amenable and tractable model system to study this possible alternative infection pathway in humans. Furthermore, unlike the inner ear hair cells of mammals, which do not regenerate, leading to deafness resulting from disease, damage, and aging (95–97), the neuromast hair cells of zebrafish can regenerate throughout their lifetime (98–100). This presents an opportunity to further explore the genetic and molecular mechanisms involved in zebrafish neuromast hair regeneration to develop possible treatments/interventions for SARS-CoV-2-or other virus-induced audiovestibular dysfunction (94).

Although the sensory hair cells of the anterior lateral line neuromasts and nascent olfactory organs (see the next section) were the main focus of our study, and we therefore imaged zebrafish heads mainly from a dorsal perspective, we also imaged larvae (at 5 dpf) from a lateral view and recorded localized ACE2 labeling in the developing otic vesicle in a region similar in size and location to the inner ear kinocilia (101). Moreover, ACE2 has also been reported to be expressed in adult human inner ear tissues (94).

It has been reported that in zebrafish larvae, the sensory hair cells of the lateral line neuromasts and otic vesicle display zones densely populated with small vesicles, suggesting that the apical surface of these cells has a high turnover rate (102). These cells also exhibit rapid Ca²⁺- and calmodulin-dependent apical endocytosis and vesicle trafficking (103). This suggests that highly localized endogenous endocytosis and vesicle trafficking likely also occur in the sensory hair cells of the anterior neuromasts. Indeed, our ACE2 and TPC2 immunolabeling data support this suggestion. We propose that in zebrafish, the SARS-CoV-2 pseudovirus might make use of these features to mediate entry into the sensory hair cells, such that the virus binds to ACE2 on the hair cell surface, and then is endocytosed and trafficked through the endolysosomal system via localized TPC2-mediated Ca²⁺ signals that regulate interendolysosomal membrane contact events (8, 10, 104). The endogenous ligands that bind to the zebrafish neuromast ACE2 receptor are currently unknown. However, these sensory organs have been reported to have olfactory as well as mechanosensory functions associated with detecting ions and molecules in the aquatic environment (56). We suggest that as zebrafish do not reach sexual maturity (considered a sign of attaining adulthood) until 90 dpf (88), it is unlikely that the ACE2 receptors in the neuromasts (and olfactory organs) of the larvae detect secreted molecules related to mating behavior (105). It is more likely that their early expression in these peripheral organs is related to sensing chemicals involved in survival behaviors associated with prey capture, predator avoidance, and social activities once the larvae hatch out of their chorions (55).

We also report a somewhat puzzling result concerning neuromast endocytic activity, where an increased level of Alexa Fluor 488-dextran labeling in the neuromast cupula was observed following treatment with bafilomycin A1, compared to the DMSO controls (Fig. 7C, panels a, a2, and e). It is known that endocytosis occurs in the sensory hair cells in zebrafish embryos and that small vesicles accumulate where the kinocilium extends into the main body of the hair cell (102). Therefore, we suggest that the increased level of fluorescence observed following bafilomycin A1 treatment might be due to a buildup of Alexa Fluor 488-dextran in the kinocilia of these cells, which extend into the cupula, rather than in the extracellular matrix of the cupula itself. Bafilomycin A1 blocks endolysosomal vesicle trafficking by inhibiting the H⁺-ATPase in the endolysosomal membrane, which is required to refill and thus maintain the intraendolysosomal Ca²⁺ store essential for regulating Ca²⁺-mediated interendolysosomal membrane contact events as vesicles traffic through the system, i.e., from early to late endosomes, and on to either lysosomes or other organellar compartments (6, 8, 104) (Fig. 8B). We propose, therefore, that in the bafilomycin A1-treated larvae, Alexa Fluor 488-dextran endocytosis still occurred in the neuromast hair cells, but trafficking through the system was inhibited, resulting in the accumulation of the fluorescent dextran observed (Fig. 8C). Furthermore, although the anterior neuromasts in 5-dpf zebrafish larvae vary in size, we used a measured mean diameter of 25 μm and estimated that the total area exposed to the surrounding aquatic medium by the 14 anterior neuromast pairs is around 1,400 μm². This on its own (not accounting for the olfactory organs) represents a substantial area of ACE2-expressing tissue in the head for possible PEG-pseudovirus (and thus SARS-CoV-2) host cell entry.

(ii) Olfactory organs. The forming olfactory organs are composed of regionalized populations of cells, determined via lineage tracing and fate mapping experiments. This reflects not only their various embryonic origins but also their fates as the olfactory organ differentiates and develops (65, 66, 106, 107). These cells include ciliated and microvillar types of sensory neurons, with axons extending into the telencephalon via the olfactory bulbs, which can be visualized as early as ~28 hpf (59, 62, 63, 68, 108). Through immunolabeling with a HuC/D antibody, we showed that at 5 dpf, sensory neurons are located mainly around the periphery of the invaginating naris (Fig. 4), suggesting the early differentiation of distinct cell types in specific regions of the nascent olfactory organ. A similar regionalization of neurosensory cells at 7 dpf was reported previously (28). Such a distinction between neurosensory and nonneurosensory cells is fully established by the time the olfactory organ matures into the olfactory rosette seen in adult zebrafish (43, 46). At 5 dpf, the central region of the forming olfactory organ does not show a high level of HuC/D labeling compared to the periphery (Fig. 4), suggesting that at this early stage, it is composed mainly of nonneurosensory cells, or proliferating neurosensory cells, which are not labeled with the HuC/D antibody (109). The pattern of peripheral HuC/D labeling closely resembles that of the expression of ACE2 (Fig. 2C) and TPC2 (Fig. 6A), as well as being a region displaying a lower level (compared to the anterior neuromasts) of endocytic activity (Fig. 7B, panel h). We suggest that this difference might be because the more complex olfactory organs are functional (displaying neuronal innervation and expressing odorant receptor genes) but still relatively immature at 5 dpf (108, 110), whereas the neuromasts reach their mature form by ~2 dpf (41, 61). Thus, although differentiation of the olfactory placode is accomplished rapidly before hatching (i.e., prior to 3 dpf) (106), its subsequent development is a far slower process (62), and the olfactory organs are considered fully developed only in the adult fish (i.e., at ~90 dpf) (88). Although the initial formation of the olfactory placodes and their neuronal innervation has been described in some detail (66, 106, 107), and the highly differentiated structure of the mature zebrafish olfactory rosette has been widely reported (43, 44, 46, 68), less is known about the developmental and morphogenic processes between these two stages. This involves the transformation of a relatively simple nearly planar but functional ectoderm-derived olfactory epithelium (which already displays cell type heterogeneity at 5 dpf) into a complex three-dimensional organ (56). The latter consists of a median raphe on which the olfactory epithelia are arranged as paired lamellae, which greatly increases their surface area (67). However, considering the nascent status of the olfactory organs at ~5 dpf, we propose that due to a similar combination of factors (i.e., expression of ACE2 and TPC2 and endocytic activity), the sensory cells of the early olfactory epithelium might (like the anterior neuromasts) also be a site of SARS-CoV-2 pseudovirus host cell entry. Other ACE2-expressing tissues and organs have been reported in zebrafish, including the vascular system and the lining of the digestive tract, kidney, liver, gills, and heart (3, 111, 112). However, as the open mouth connects with the pharyngoesophageal region only at 3 dpf (64), and these link with the rest of digestive tract (and associated organs) to form a continuous structure only at 5 dpf (69), we suggest that initially, the anterior sensory organs represent the major sites of ACE2-mediated host cell entry.

A high level of molecular conservation has been reported between zebrafish and mice, with orthologs of mouse olfactory cell-specific markers and all but one of their chemosensory receptor classes expressed in the single pair of zebrafish olfactory organs (113). As a result, it has been proposed that zebrafish might make a good complementary translational model to study the mechanisms involved in anosmia and both the long- and short-term neurodegenerative aspects of SARS-CoV-2 infection (25, 114–116). Furthermore, although altered olfactory function is a common symptom of COVID-19 infection in humans, its etiology is not well understood. For example, ACE2 is reported to be expressed in the olfactory bulb epithelium of both humans and mice but not in the olfactory sensory neurons or olfactory bulb neurons (117). The use of larval and adult zebrafish might prove to be a suitable system to model the onset and progression of these symptoms.

(iii) Mouth and pharynx. The cellular lining of the larval mouth and pharynx, and the structures derived from the latter (e.g., gill pouches, arches, and the gills themselves), are eventually also exposed to the external environment and thus offer possible entry sites for pathogens, including viruses. Although the stomodeum (the nascent mouth) is starting to develop from ~48 hpf to ~72 hpf (61, 64), we observed no notable ACE2 or TPC2 labeling of this structure up to ~120 hpf (Fig. 3 and 6). Furthermore, although lumen formation of the pharyngeal gill pouches starts at ~36 hpf and the first open gill slits are seen at ~56 hpf to ~60 hpf, at which time the inner pouch surfaces are exposed to the surrounding medium (118), we again observed no marked labeling of ACE2 or TPC2 in these structures. This supports our suggestion that the major sites of PEG-pseudovirus host cell entry associated with the head region are the anterior neuromasts and olfactory organs. However, as ACE2 expression has been reported in the gill tissue of zebrafish (111), we suggest that this expression might be associated with more mature gill structures, such as the secondary lamellae, which develop only around 12 to 14 dpf (119), when the gills are reported to become fully functional (120).

(iv) Epiphysis. The epiphysis (pineal gland) was another site in the anterior peripheral region that was shown to express ACE2, and so this is another possible secondary viral host cell entry site (Fig. 3C). In zebrafish, this endocrine organ develops early. Indeed, the epiphysis primordium can be distinguished as a distinct peripheral region of the diencephalon at ~22 hpf (121–123) (Fig. 1), and it is innervated by neurons by ~48 hpf (124). In zebrafish larvae, there are two main types of neurons in this organ, photoreceptors, and projection neurons (125). Thus, it might represent another (secondary) route of viral entry into the CNS (75). There is currently a growing interest in the long-term effects of SARS-CoV-2 infection on the endocrine system in humans (126–128). We propose, therefore, that zebrafish larvae might serve as a complementary platform to explore possible SARS-CoV-2 infection of the epiphysis as an easily accessible, relatively simple endocrine organ, especially from an imaging perspective. The use of zebrafish as a tractable model to investigate neurodevelopmental disorders and diseases, as well as a platform for drug discovery, has already been recognized (76, 129, 130).

Conclusions.

For a number of advantageous reasons, including genetic tractability, the conserved genetic homology with humans, rapid ex utero development, optical transparency during early development, fecundity, small size, and relatively low husbandry costs, the zebrafish is emerging as a most amenable complementary, nonmammalian vertebrate system to model human diseases, including viral infections (22, 24, 129, 131–134). Regarding the latter, zebrafish have already been used to study Ebola (135), chikungunya (30), herpes simplex (31), dengue (136), and influenza A (32, 33) virus infections. It is therefore not surprising that they are also emerging as a model to better understand the mechanisms involved in SARS-CoV-2 host cell entry and infection (25, 76, 89, 112) and as an alternate system for human and animal vaccination research (137). Indeed, it was recently shown that bath exposure of zebrafish larvae to SARS-CoV-2 at 4 dpf resulted in viral RNA being readily detected after 6 h, indicating successful viral entry at this time (112). A more recent report describes the intranasal delivery of the SARS-CoV-2 spike protein into zebrafish adults, which resulted in olfactory damage and dysfunction as well as an inflammation response (89). Zebrafish are also being adopted as an inexpensive in vivo platform for screening novel compounds (138–140), including phytochemicals derived from traditional Chinese medicines (90, 130, 141, 142).

Here, we report that zebrafish neuromasts and olfactory organs represent possible sites for SARS-CoV-2 pseudovirus host cell entry. Our conclusion is based on six supportive findings: (i) the expression of ACE2, (ii) the expression of TPC2, (iii) our observation of endocytosis, (iv) evidence of PEG-pseudovirus uptake, (v) stimulation of innate immune response genes following PEG-pseudovirus exposure, and (vi) the significant attenuation of PEG-pseudovirus uptake in a tpcn2 mutant fish line or following the pharmacological inhibition of TPC2 function. This route of viral entry through the olfactory organs is not unique, as the nasal delivery of a rhabdovirus called infectious hematopoietic necrosis virus (IHNV) into rainbow trout (Oncorhynchus mykiss) resulted in it being internalized into endosomes, after which it elicited distinct rapid immune responses in the olfactory organ and bulb (143). Moreover, we are not the first to describe the olfactory route of SARS-CoV-2 delivery into zebrafish, as it was recently shown that the intranasal delivery of the SARS-CoV-2 spike receptor binding domain (RBD) resulted in severe olfactory damage in adult fish (89). Furthermore, it was recently reported that human nasal ciliated cells are one of the primary targets for SARS-CoV-2 replication during the early stages of COVID-19 (144). As the genes involved in the development, morphology, and function of sensory hair cells are evolutionarily conserved from zebrafish to mammals (145, 146), this supports our proposal that zebrafish represent an attractive translational model to explore hair cells as a possible site of SARS-CoV-2 host cell entry. In addition to viruses, other pathogens (such as bacteria) and chemical toxins are also reported to affect normal olfactory function in zebrafish larvae (46, 147, 148). Moreover, environmental toxicants such as metals and pharmaceutical agents have been shown to affect the development and function of neuromasts in zebrafish (149).

Due to the neurosensory nature of the peripheral organs, we also suggest that zebrafish larvae might represent a highly amenable complementary model to explore direct infection pathways into the CNS (75). It was suggested previously that the lateral line system in zebrafish might provide a model system to screen for chemical effects on neurosecretory function of fish and vertebrates in general (149), as well as for drug ototoxicity (91). Here, we propose that this screening platform could be extended to infection by pathogens, including SARS-CoV-2, and the identification of novel antiviral compounds. In summary, we suggest that our results might contribute to a better understanding of SARS-CoV-2 entry in the upper respiratory tract and its subsequent infection of neurons in humans (53, 144). It has been proposed that such entry pathways might contribute to the long-term effects of COVID-19 (long-COVID) infection (75, 115, 116, 150), which at present are not well understood and might have the potential to be targeted by antiviral agents (53, 114, 151).

MATERIALS AND METHODS

Zebrafish husbandry.

Wild-type ABTU zebrafish were a kind gift from Han Wang (Soochow University, Suzhou, China), and the tpcn2^dhkz1a mutant line of fish was generated previously by us (80). All the fish were kept in aquatic habitats (AHAB) systems (Pentair Aquatic Eco-Systems, Apopka, FL, USA), and their fertilized eggs were obtained and maintained at ~28°C in Danieau’s solution [17.4 mM NaCl, 0.21 mM KCl, 0.12 mM MgSO₄ · 7H₂O, 0.18 mM Ca(NO₃)₂ · 4H₂O, and 1.5 mM HEPES (pH 7.2)], using well-established protocols (152). All the procedures used in this study were conducted in accordance with the guidelines and regulations outlined by the Animal Ethics Committee of HKUST and the Department of Health, Hong Kong.

Cell culture and SARS-CoV-2 pseudotyped virus production.

HEK293T cells (a kind gift from Maria Lung, The University of Hong Kong, Hong Kong, SAR) were seeded in T75 culture flasks (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and maintained in Dulbecco’s modified Eagle medium (DMEM) (12100; Invitrogen, Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS) (10270; Invitrogen) and 1% penicillin-streptomycin (15070; Invitrogen), referred to here as complete DMEM, at 37°C and 5% CO₂. Upon reaching 80% confluence, the cells were transfected with components of the SARS-CoV-2, Wuhan-Hu-1 spike-pseudotyped lentivirus kit (NR-52948; BEI Resources, National Institute of Allergy and Infectious Diseases [NIAID]) using the Lipofectamine 3000 transfection reagent (L3000001; Invitrogen), according to the manufacturer’s instructions. The BEI Resources kit contained the SARS-CoV-2 spike glycoprotein (NR-52514), a lentiviral backbone expressing luciferase and ZsGreen (NR-52516), and three helper plasmids (NR-52517, NR-52518, and NR-52519). After 72 h, the SARS-CoV-2-pseudotyped-virus particles (referred to here as the pseudovirus) were collected and passed through a 0.45-μm filter (16537K; Sartorius AG, Göttingen, Germany) to remove any cell debris. The pseudovirus was then stored at −80°C and was used for all the in vitro experiments. For the in vivo zebrafish-based experiments, the pseudovirus was prepared as described above. However, after the cell debris was removed by filtration, the pseudovirus was then purified using polyethylene glycol (PEG), as described previously (153), and the cell culture medium was replaced with phosphate-buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 1.8 mM KH₂PO₄ [pH 7.4]) before storage at −80°C. To differentiate between the pseudovirus used in the in vitro and in vivo experiments, the latter is referred to as the PEG-pseudovirus.

In vivo PEG-pseudovirus entry.

ABTU wild-type or tpcn2^dhkz1a mutant zebrafish larvae at 2 days postfertilization (dpf) or 3 dpf were transferred to the individual wells of white 96-well plates (SPL Life Sciences, Gyeonggi-do, South Korea) containing 100 μL Danieau’s solution. PEG-pseudovirus (8 μL) was added to each well, and the larvae were incubated at 28°C for 48 h or 72 h, respectively (i.e., until they were at ~4 dpf or ~6 dpf, respectively). At this time, the larvae from each group were pooled and washed with Milli-Q water with gentle agitation for ~1.5 h, with water changes every 10 min, prior to RNA extraction. Each experiment was conducted using 10 embryos per treatment group and repeated 4 times.

In vivo inhibition of pseudovirus entry.

Zebrafish larvae at 2 dpf or 3 dpf either were kept untreated or were pretreated for 6 h with Danieau’s solution containing chloroquine (50 μM; tlrl-chq; InvivoGen, Hong Kong, SAR), bafilomycin A1 (50 nM; tlrl-baf1; InvivoGen), naringenin (10 μM; provided by the Testing Laboratory for Chinese Medicine [TLCM], HKUST, Hong Kong, SAR), tetrandrine (5 to 20 μM; TLCM), or DMSO (0.1%; Sigma-Aldrich; used as the solvent control) in individual wells of a 24-well plate (SPL Life Sciences). Immediately after pretreatment (i.e., at ~2.25 dpf or ~3.25 dpf, respectively), the larvae were treated with PEG-pseudovirus (as described above) until ~4.25 dpf or ~6.25 dpf, respectively. At this time, the larvae from each group were pooled and washed with Milli-Q water with gentle agitation for ~1.5 h with water changes every 10 min, prior to RNA extraction. Each experiment was conducted using 10 embryos per treatment group and repeated at least 3 times.

Head excision.

Zebrafish larvae at 4.25 dpf were anaesthetized with 120 μg/mL MS-222 (Sigma-Aldrich), until a loss of the tail fin pinch reflex was observed (154), and immediately transferred to a Petri dish and visualized under an EMT-3 Turret Stereo Body microscope with MA502 SWF10X eyepieces (Meiji Techno Co., Saitama, Japan). Each larva was decapitated just caudal to the otic vesicle using a pair of 27-gauge needles attached to two 1-mL syringes (Terumo [Philippines] Corporation, Laguna, Philippines). The heads were placed in TRIzol reagent (Invitrogen) immediately after removal in preparation for RNA extraction.

RNA extraction and RT-PCR.

RNA was extracted from the pooled whole larvae or the larval heads in each treatment group using TRIzol reagent, according to the manufacturer’s instructions. The extracted RNA was then reverse transcribed to cDNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Thermo Fisher Scientific, Inc.), according to the manufacturer’s instructions, and amplified by PCR using 2× rapid Taq master mix (Vazyme Biotech Co. Ltd., Nanjing, China). The PCR amplification process consisted of a 30-s predenaturation step at 95°C followed by 35 cycles of 15 s denaturation at 95°C, 15 s annealing at 60°C, and 15 s elongation at 72°C, with a final elongation step of 5 min at 72°C. The PCR products were then separated on a 2% agarose gel, and the band intensities were quantified using ImageJ (National Institutes of Health and the Laboratory for Optical and Computational Instrumentation, Bethesda, MD, USA; https://imagej.nih.gov/ij/download.html). The level of expression of luciferase (luc) mRNA was determined against that of glucose-6-phosphate dehydrogenase (g6pd) mRNA. In addition, the luc gene expression level following treatment with chloroquine or bafilomycin A1 was measured relative to their respective controls. The primers used for the RT-PCR are listed in Table 1.

TABLE 1.

Sequences of the primers used for RT-PCR and RT-qPCR

Gene	Direction	Primer sequence (5′→3′)
g6pd	Forward	TGCTTCCACCAGCTCTGATG
	Reverse	CCCTCAACTCATCACTGCGT
Luc	Forward	AAACGCTTCCACCTACCAGG
	Reverse	TCCACGATCTCCTTCTCGGT
β-actin	Forward	TGGTATTGTGATGGACTCTGG
	Reverse	AGCACTGTGTTGGCATACAGG
ace2	Forward	CTGGCTCCTGCTTTTGGC
	Reverse	TCTTTATCTGCATTTTCCTGGGAG
ifnphi1	Forward	CGCAAAGCCAGCACACAAGGA
	Reverse	CTCCGGATCTGCTCCCATGCT
ccl20a.3	Forward	TGATGGTGCTGACAATCGTG
	Reverse	CTTTGGACGGGTCTGTGCA
il1b	Forward	CGCAGCACAAAATGAAGCAG
	Reverse	ACGTTCACTTCACGCTCTTG

RT-qPCR for gene expression analysis of ace2 and inflammatory or immune response genes.

cDNA was obtained from the zebrafish samples, as described above. The LightCycler 480 SYBR Green I master reaction mix (04707516001; Roche Diagnostics [HK] Ltd., Hong Kong, SAR) was used to determine the mRNA expression levels of ace2 and the immune or inflammatory response genes ifnphi1, ccl20a.3, and il1b. The reactions were performed in a LightCycler 480 II instrument (Roche Diagnostics [HK] Ltd.) using the default SYBR green program, and the gene expression levels were quantified using the cycle threshold (ΔΔC_T) method and presented as fold change (2^−ΔΔCT) with β-actin as the internal control. The expression of ace2 was measured relative to the 2-dpf group, whereas the expression of ifnphi1, ccl20a.3, and il1b was measured relative to the solvent control group. The primers used for the RT-qPCR are listed in Table 1.

Whole-mount immunohistochemistry of zebrafish larvae.

Larvae at 3 dpf, 5 dpf, and 8 dpf were fixed in freshly prepared PBS containing 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA, USA) and 4% sucrose (pH 7.4) overnight at 4°C. After fixation, the larvae were washed with PBS four times for 15 min each, after which they were permeabilized via a 2-step process. First, they were incubated with PBS containing 0.1% Triton X-100 (PBST) three times for 20 min each, followed by a 20-min incubation in PBS containing 0.1% collagenase (Sigma-Aldrich) at room temperature. The larvae were then washed with PBS for 5 min and then with PBST three times for 5 min each. In the second permeabilization step, the larvae were incubated in the dark with PBST containing 1% DMSO (PBSTD) for 1 h at room temperature. Following permeabilization, the larvae were incubated with blocking buffer (PBSTD containing 10% goat serum and 1% bovine serum albumin [BSA]) for 3 h at room temperature. They were then incubated overnight at 4°C with an anti-ACE2 antibody (PA5-86636; Thermo Fisher Scientific) or an anti-TPC2 antibody (A17271; ABclonal Inc., Woburn, MA, USA), both of which were diluted 1:50 with blocking buffer. After this primary antibody incubation step, the larvae were washed with wash buffer (PBSTD containing 1% goat serum and 0.1% BSA) six times for 30 min each. They were then incubated with an Alexa Fluor 488 F(ab′)2 goat anti-rabbit IgG (H+L) secondary antibody (A-11070; Molecular Probes) (diluted 1:200 in blocking buffer) overnight at 4°C. The larvae were then washed first with PBST six times for 20 min each and then with PBS three times for 20 min each, after which they were stored in PBS at 4°C prior to confocal microscopy.

In some experiments, to enhance the clarity of the embryos by preventing the formation of pigmentation, live dechorionated embryos were treated with Danieau’s solution containing 0.003% 1-phenyl 2-thiourea (Sigma-Aldrich) from 24 hpf until they were fixed at 5 dpf. After immunolabeling with the anti-ACE2 antibody, they were then stained with PBST containing 20 μg/mL Hoechst 33258 (Thermo Fisher Scientific) at room temperature for 2 h prior to confocal imaging.

Endocytosis labeling.

Live larvae at 5 dpf were incubated with Danieau’s solution containing 10 μM Alexa Fluor 488-labeled dextran (10 kDa; D22910; Thermo Fisher Scientific) and either bafilomycin A1 (at a final concentration of 100 nM) or DMSO (at 0.1%) for at least 4 h in the dark at 28°C. Immediately after incubation, the larvae were washed with 5 changes of Danieau’s solution, and then they were anesthetized in Danieau’s solution containing 120 μg/mL MS-222 (Sigma-Aldrich). In preparation for embedding, an embedding mixture (1:1 ratio of 240 μg/mL MS-222 and 2% low-gelling-temperature agarose [A4018; Sigma-Aldrich]) was prepared. The anesthetized larvae were then added to the embedding mixture and placed in grooves prepared using 1% agarose gel (Thermo Fisher Scientific) on a glass-bottom 35-mm culture dish (MatTek, Ashland, MA, USA). The immobilized larvae were then visualized via confocal microscopy.

To label F-actin after endocytosis labeling, 5-dpf larvae were incubated with 10 μM Alexa Fluor 488-labeled dextran, as described above. After the incubation, the larvae were fixed and permeabilized, as described above. The permeabilized larvae were then incubated with Alexa Fluor 568-tagged phalloidin (Molecular Probes Inc.; used at 1:50) for 1 h at room temperature in the dark. The labeled larvae were then washed with PBST three times for 20 min each time followed by PBS three times for 20 min each time and then stored at 4°C prior to confocal microscopy. Orthogonal sections were obtained using the LAS X software (Leica Microsystem Ltd., Hong Kong), and fluorescence signal intensities were measured and quantified using ImageJ.

Confocal microscopy.

Images were acquired using a Leica TCS SP8 laser scanning confocal microscope with a HyD hybrid detector and a Leica HC PL APO 20×/0.7 numerical aperture (NA) CS2 dry objective lens. Alexa Fluor 488 and Alexa Fluor 568 fluorescence was detected using excitation/detection wavelengths of 488 nm/493 to 547 nm and 552 nm/594 to 744 nm, respectively. Signal intensities were quantified using ImageJ.

Data analysis and figure preparation.

The unpaired Student's t test was performed for all statistical analyses (unless otherwise stated), using GraphPad Prism version 8.4.3 (GraphPad Software, Inc., San Diego, CA, USA). Data were considered significantly different at a P value of <0.05. Figures were prepared using CorelDraw version X8 (Corel Corp. Ottawa, ON, Canada).