Augmentation of 3β-hydroxysteroid-Δ24 Reductase (DHCR24) Expression Induced by Bovine Viral Diarrhea Virus Infection Facilitates Viral Replication via Promoting Cholesterol Synthesis

ABSTRACT

Bovine viral diarrhea virus (BVDV) is the etiologic agent of bovine viral diarrhea-mucosal disease, one of the most important viral diseases of cattle, leading to numerous losses to the cattle rearing industry worldwide. The pathogenicity of BVDV is extremely complex, and many underlying mechanisms involved in BVDV-host interactions are poorly understood, especially how BVDV utilizes host metabolism pathway for efficient viral replication and spread. In our previous study, using an integrative analysis of transcriptomics and proteomics, we found that DHCR24 (3β-hydroxysteroid-Δ24 reductase), a key enzyme in regulating cholesterol synthesis, was significantly upregulated at both gene and protein levels in the BVDV-infected bovine cells, indicating that cholesterol is important for BVDV replication. In the present study, the effects of DHCR24-mediated cholesterol synthesis on BVDV replication was explored. Our results showed that overexpression of the DHCR24 effectively promoted cholesterol synthesis, as well as BVDV replication, while acute cholesterol depletion in the bovine cells by treating cells with methyl-β-cyclodextrin (MβCD) obviously inhibited BVDV replication. In addition, knockdown of DHCR24 (gene silencing with siRNA targeting DHCR24, siDHCR24) or chemical inhibition (treating bovine cells with U18666A, an inhibitor of DHCR24 activity and cholesterol synthesis) significantly suppressed BVDV replication, whereas supplementation with exogenous cholesterol to the siDHCR24-transfected or U18666A-treated bovine cells remarkably restored viral replication. We further confirmed that BVDV nonstructural protein NS5A contributed to the augmentation of DHCR24 expression. Conclusively, augmentation of the DHCR24 induced by BVDV infection plays an important role in BVDV replication via promoting cholesterol production.

IMPORTANCE Bovine viral diarrhea virus (BVDV), an important pathogen of cattle, is the causative agent of bovine viral diarrhea-mucosal disease, which causes extensive economic losses in both cow- and beef-rearing industry worldwide. The molecular interactions between BVDV and its host are extremely complex. In our previous study, we found that an essential host factor 3β-hydroxysteroid-δ24 reductase (DHCR24), a key enzyme involved in cholesterol synthesis, was significantly upregulated at both gene and protein levels in BVDV-infected bovine cells. Here, we experimentally explored the function of the DHCR24-mediated cholesterol synthesis in regulating BVDV replication. We elucidated that the augmentation of the DHCR24 induced by BVDV infection played a significant role in viral replication via promoting cholesterol synthesis. Our data provide evidence that BVDV utilizes a host metabolism pathway to facilitate its replication and spread.

INTRODUCTION

Bovine viral diarrhea virus (BVDV), one of the most important viral pathogens of cattle, belongs to the genus of Pestivirus within the family Flaviviridae, similar to the classical swine fever virus (CSFV) and border disease virus (BDV), and possesses a positive-sense single-stranded RNA genome of ~12.9 kb in length (1, 2). BVDV infection in cattle can cause inflammations (such as diarrhea, enteritis, mucosa necrosis, and pneumonia) and reproductive disturbance, as well as persistent infection and immunosuppression (3, 4). Among them, persistent infection of cattle caused by BVDV is the biggest hidden danger, because cattle excrete large amounts of viruses in their life continuously, resulting in the spread of BVDV among the herd. Currently, BVDV is distributed among the cattle population worldwide, causing huge economic losses to the livestock industry (5). To date, the combination of vaccination and elimination of persistently infected cattle is still the major strategy for the control and prevention of BVDV infection. Therefore, deep exploration of potential mechanisms of BVDV-host interactions is of great importance for the development of effective vaccines and therapeutic agents against BVDV (6–9).

Commonly, virus mainly utilizes host cell components to facilitate its replication and assembly after virus enters its host cells. Previous studies have elucidated that BVDV nonstructural proteins NS3 and NS5B play crucial roles in BVDV replication process (10, 11). So far, how BVDV utilizes host metabolism pathway for efficient viral replication is poorly understood. Increasing evidence shows that cholesterol metabolism pathway plays an important role in viral invasion and replication (12–16). Recently, studies have also elucidated that cellular cholesterol plays an essential role in the life cycle of many viruses, such as CSFV (17), avian reovirus (18), caprine parainfluenza virus (19), hepatitis C virus (HCV) (20, 21), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (22). It is noteworthy that BVDV belongs to the family Flaviviridae together with CSFV and HCV, indicating that cholesterol is important for BVDV replication. Meanwhile, some studies have also reported that interferon (IFN)-inducible cholesterol 25-hydroxylase (CH25H) participates in host antiviral responses via catalyzing the oxidation of cholesterol to 25-hydroxycholesterol in the cholesterol metabolism pathway (23, 24). In addition, researchers have reported that type I IFN-induced antiviral protein viperin can inhibit the replication of viruses by destroying the formation of cholesterol-rich lipid raft (25, 26). To date, it has been elucidated that the transportation, storage, and release of cholesterol can be regulated by the innate immune signals, suggesting a close relationship between cholesterol and host innate immunity (27, 28). However, the understanding of how the key metabolic products or enzymes related to cholesterol metabolism participate in viral replication is still limited.

DHCR24, also called 3β-hydroxysteroid-Δ24 reductase or desmosterol reductase, is a key cholesterol biosynthetic enzyme that can catalyze desmosterol to cholesterol (29, 30). Studies by researchers demonstrate that DHCR24 plays an important role in endoplasmic reticulum stress and apoptosis, which can regulate apoptosis by inhibiting caspase-3 activation to promote cell survival during apoptosis induced by oxidative stress (31, 32). Moreover, previous studies have reported that DHCR24 can promote viral replication, such as HCV. DHCR24 was highly expressed after HCV infection in vivo and in vitro, which may impair p53 (33) or promote cholesterol synthesis (34) to facilitate HCV replication. In addition, HCV RNA replicates on lipid rafts (35), and DHCR24 is an essential host factor regulating lipid raft formation (36), suggesting an underlying mechanism of DHCR24 promoting HCV replication. However, the DHCR24 is not important for the replication of other hepatitis viruses (33).

In our previous study, in order to gain a deep insight into the interactions of BVDV and its host, particularly the effect of cholesterol metabolism on BVDV replication, an integrative analysis of transcriptomics and proteomics for the BVDV-infected bovine cells was performed. We found that host factor DHCR24, a key cholesterol biosynthetic enzyme involved in cholesterol metabolism pathway, was significantly upregulated at both gene and protein levels in the BVDV-infected bovine cells (37), indicating that the host factor DHCR24 participates in BVDV replication. In the present study, the effect of DHCR24-mediated cholesterol synthesis on BVDV replication was explored experimentally.

RESULTS

Identification of differentially expressed genes/proteins involved in cholesterol metabolism in BVDV-infected bovine cells.

In our previous study, to obtain a deep insight into BVDV-host interactions, an integrative analysis of transcriptomics and proteomics for BVDV-infected bovine cells was performed (37). In this study, to explore the effects of BVDV infection on host cholesterol metabolism (Fig. 1A), we further analyzed the transcriptomic and proteomic data targeting the key genes/proteins involved in cholesterol metabolism pathway and found that the mRNA and protein levels of HMGCS1, HMGCR, MVK, PMVK, MVD, FDPS, DHCR7, DHCR24, LSS, and SQLE involved in cholesterol synthesis were significantly upregulated in the BVDV-infected bovine cells; in addition, SCD1, FASN, and ACACA were involved in fatty acid synthesis (Fig. 1B). Of these, FASN, HMGCR, DHCR7, and DHCR24 were selected to confirm by quantitative reverse transcription-PCR (qRT-PCR) (Fig. 1C) and Western blotting (Fig. 1D). Our data indicate that BVDV infection promotes the expression of the key factors involved in cholesterol synthesis.

FIG 1.

(A) Cholesterol synthesis pathway. (B) Heat map of the key genes (transcriptomic data) and corresponding proteins (proteomic data) involved in lipid metabolism in bovine viral diarrhea virus (BVDV)-infected bovine cells. (C, D) Identification of differentially expressed genes by quantitative reverse transcription-PCR (qRT-PCR) (C) and corresponding proteins by Western blotting (D). HMGCS1, 3- hydroxy-3-methylglutaryl-coenzyme A synthase 1; HMGCR, 3-hydroxy-3-methylglutaryl-coenzyme A reductase; MVK, mevalonate kinase; PMVK, phosphomevalonate kinase; MVD, diphosphomevalonate decarboxylase; FDPS, farnesyl diphosphate synthase; FDFT1, farnesyl diphosphate farnesyltransferase 1; SQLE, squalene epoxidase; GGPS, geranylgeranyl pyrophosphate synthase; LSS, lanosterol synthase; D8D7I, 3β-hydroxysterol-Δ8,7-isomerase; C5SD, 3β-hydroxysterol-C5 desaturase; DHCR7, 7-dehydrocholesterol reductase; DHCR24, 3β-hydroxysteroid-Δ24 reductase; SCD1, stearoyl-CoA desaturase; FASN, fatty acid synthase; ACACA, acetyl coenzyme A carboxylase alpha.

Cholesterol removal inhibits BVDV replication in bovine cells.

Bovine cells were treated with different concentration of methyl-β-cyclodextrin (MβCD), which can acutely deplete cells of cholesterol, and cell viability was shown in Fig. 2A. We found that the cholesterol content decreased significantly in the MβCD-treated bovine cells (P < 0.05, P < 0.01, or P < 0.001) (Fig. 2B), while the protein level of the DHCR24 increased significantly (P < 0.05, P < 0.01, or P < 0.001) in a dose-dependent manner (Fig. 2C). The MβCD-treated bovine cells were infected with BVDV, followed by the determination of viral replication level using qRT-PCR. As shown in Fig. 2D, the BVDV replication level in the MβCD-treated Madin-Darby bovine kidney (MDBK) and bovine testicular (BT) cells decreased significantly in a dose-dependent manner (P < 0.01 or P < 0.001), as well as the levels of viral proteins determined by Western blotting (Fig. 2E). Our data indicate that cholesterol is crucial to BVDV replication.

FIG 2.

Treatment of bovine cells with MβCD. (A) Cell viability of the methyl-β-cyclodextrin (MβCD)-treated bovine cells. (B) Cholesterol levels in the bovine cells treated with different concentration of MβCD. (C) Expression levels of DHCR24 in the bovine cells treated with different concentration of MβCD identified by Western blotting, using β-actin as an internal reference. (D) BVDV replication in the MβCD-treated Madin-Darby bovine kidney (MDBK) cells and bovine testicular (BT) cells. (E) Expression levels of viral proteins in MβCD-treated bovine cells identified by Western blotting. *, P < 0.05; **, P < 0.01; ***, P < 0.001. DMSO, dimethyl sulfoxide.

Effects of DHCR24 upregulation on cholesterol synthesis and BVDV replication.

DHCR24 is a key enzyme involved in the cholesterol synthesis. We detected the mRNA level of the DHCR24 in the BVDV-infected bovine cells at 24 and 48 h after viral infection by qRT-PCR, and the results showed that the mRNA level of the DHCR24 in the BVDV-infected MDBK cells (Fig. 3A) and BT cells (Fig. 3B) significantly increased (P < 0.05 or P < 0.01), as well as the protein level of the DHCR24 in the BVDV-infected MDBK cells (Fig. 3C) and BT cells (Fig. 3D) determined by Western blotting. We further evaluated the effects of DHCR24 overexpression on cholesterol synthesis and BVDV replication. DHCR24 expression in pCMV-DHCR24-transfected bovine cells was identified by immunofluorescence assay (IFA) (Fig. 4A) and Western blotting (Fig. 4B), followed by the determination of cholesterol level. The results showed that the cholesterol level in the DHCR24-expressing bovine cells significantly increased (P < 0.01) compared to the pCMV-transfected cell group (Fig. 4C), indicating that DHCR24 can promote cholesterol production. Significantly, we found that DHCR24 overexpression effectively increased viral titer (P < 0.01) (Fig. 4D) and promoted viral replication (P < 0.001) (Fig. 4E), as well as the expression levels of viral proteins (P < 0.01) (Fig. 4F), compared to the mock group and pCMV-transfected cell group. Conclusively, our data indicated that BVDV infection induces DHCR24 expression; in turn, DHCR24 overexpression promotes cholesterol production and further facilitates BVDV replication.

FIG 3.

(A, B) mRNA levels of the DHCR24 in the BVDV-infected MDBK cells (A) and BT cells (B) identified by qRT-PCR. (C, D) Protein levels of the DHCR24 in the BVDV-infected MDBK cells (C) and BT cells (D) identified by Western blotting at 24 and 48 h after viral infection. *, P < 0.05; **, P < 0.01. h.p.i., hours postinfection.

FIG 4.

(A, B) DHCR24 overexpression promotes BVDV replication. Identification of the DHCR24 expression in the pCMV-DHCR24-transfected bovine cells by immunofluorescence assay (IFA) (A) and Western blotting (B). (C to E) Cholesterol level (C), viral titer (D), and BVDV replication level (E) in the DHCR24-expressing bovine cells. (F) Expression levels of viral proteins in the DHCR24-expressing bovine cells identified by Western blotting. NS, not significant; **, P < 0.01; ***, P < 0.001.

Effects of DHCR24 knockdown on cholesterol synthesis and BVDV replication.

Small interfering RNA (siRNA)-mediated gene knockdown of DHCR24 was performed to explore its effects on cholesterol production and BVDV replication. Cell viability of bovine cells transfected with different concentrations of siControl and siDHCR24 is shown in Fig. 5A. The siDHCR24-transfected bovine cells were infected with BVDV (multiplicity of infection [MOI] = 1.0), followed by the determination of viral replication level by qRT-PCR and expression levels of viral proteins (E2 and NS5B) by Western blotting at 24 h after BVDV infection. The results showed that viral replication in the siDHCR24-transfected MDBK cells (Fig. 5B) and BT cells (Fig. 5C) was significantly inhibited (P < 0.05, P < 0.01, or P < 0.001) in a dose-dependent manner, compared to siControl group. Moreover, the expression of viral proteins decreased significantly (P < 0.05 or P < 0.01) in the siDHCR24-transfected MDBK cells (Fig. 5D) and BT cells (Fig. 5E), compared to BVDV-infected cell group. We also determined the mRNA and protein levels of the DHCR24 in the siDHCR24-transfected bovine cells by qRT-PCR and Western blotting, and the results showed that the mRNA level of the DHCR24 in the siDHCR24-transfected MDBK cells and BT cells (Fig. 6A) decreased significantly (P < 0.01), as well the protein level of the DHCR24 (Fig. 6B), compared to the siControl cell group. We further used the siDHCR24-transfected bovine cells to propagate BVDV and found that viral titer (TCID₅₀) was significantly lower (P < 0.001) than that in BVDV-infected normal bovine cells and siControl-transfected bovine cells (Fig. 6C). In addition, we also found that the cholesterol level decreased significantly (P < 0.01) with the DHCR24 knockdown, compared to the siControl cell group (Fig. 6D), while supplementation of exogenous cholesterol to the siDHCR24-transfected bovine cells greatly rescued the replication capacity of BVDV (Fig. 6E). Our data indicate that DHCR24 can regulate the cholesterol production to further affect BVDV replication. Interestingly, augmentation of exogenous cholesterol can inhibit the expression of the DHCR24 in a dose-dependent manner (Fig. 6F).

FIG 5.

(A) Cell viability of the siDHCR24-transfected bovine cells. (B, C) Gene levels of BVDV in the siDHCR24-transfected MDBK cells (B) and BT cells (C) identified by qRT-PCR at 24 h after viral infection. (D, E) Levels of viral proteins in the siDHCR24-transfected MDBK cells (D) and BT cells (E) identified by Western blotting at 24 h after viral infection. *, P < 0.05; **, P < 0.01; ***, P < 0.001. UTR, untranslated region.

FIG 6.

(A, B) Identification of the mRNA levels (A) and the protein levels (B) of the DHCR24 in the siDHCR24-transfected MDBK cells and BT cells by qRT-PCR and Western blotting. (C) Viral titer in the siDHCR24-transfected bovine cells determined at 24 h after BVDV infection. (D) Cholesterol level in the siDHCR24-transfected bovine cells. (E) Effect of supplementation of exogenous cholesterol to the siDHCR24-transfected cells on BVDV replication. (F) Cholesterol accumulation negatively regulates the expression of DHCR24. **, P < 0.01; ***, P < 0.001.

Effects of the DHCR24 activity on cholesterol synthesis and BVDV replication.

U18666A is an inhibitor of DHCR24 activity and cholesterol synthesis, which can inhibit DHCR24 enzyme activity and cholesterol biosynthesis. Cell viability of bovine cells treated with different concentration of U18666A was shown in Fig. 7A (BT cells) and Fig. 7B (MDBK cells). The U18666A-treated bovine cells were infected with BVDV (MOI = 1.0), followed by the determination of viral replication capacity at 24 h after viral infection. The results showed that the viral replication level in the U18666A-treated BT cells (Fig. 7C) and MDBK cells (Fig. 7E) decreased significantly in a dose-dependent manner (P < 0.05, P < 0.01, or P < 0.001), as well as the levels of viral proteins in U18666A-treated BT cells (Fig. 7D) and MDBK cells (Fig. 7F), indicating that U18666A inhibits BVDV replication. We further found the U18666A, as an inhibitor of DHCR24 enzyme activity, resulted in the accumulation of DHCR24 (Fig. 8A) and inhibited cholesterol synthesis (Fig. 8B) in a dose-dependent manner (P < 0.05, P < 0.01, or P < 0.001). Significantly, BVDV replication was greatly rescued by adding exogenous cholesterol into U18666A-treated bovine cells in a dose-dependent manner (P < 0.01 or P < 0.001) (Fig. 8C). Our data indicate that U18666A can inhibit DHCR24 enzyme activity and cholesterol synthesis to further inhibit BVDV replication.

FIG 7.

(A, B) Cell viability of BT cells (A) and MDBK cells (B) treated with different concentration of U18666A. (C, D) Levels of viral replication (C) and viral proteins expression (D) in the U18666A-treated BT cells at 24 h after BVDV infection. (E, F) Levels of viral replication (E) and viral proteins expression (F) in the U18666A-treated MDBK cells at 24 h after BVDV infection. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

FIG 8.

(A) DHCR24 accumulation in the U18666A-treated bovine cells in a dose-dependent manner determined by Western blotting. (B) Cholesterol level in the U18666A-treated bovine cells. (C) Effect of supplementation of exogenous cholesterol to the U18666A-treated bovine cells on BVDV replication. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

BVDV NS5A protein promotes the expression of DHCR24, contributing to the cholesterol synthesis.

Viral NS5A protein localizes on the endoplasmic reticulum in the cytoplasm of BVDV-infected cells (38), so we speculate that viral NS5A protein may be involved in lipid (cholesterol) synthesis and metabolism. Thus, to confirm the speculation experimentally, a eukaryotic plasmid pCMV^HA-NS5A expressing the NS5A protein was constructed, followed by transfection and identification by IFA (Fig. 9A) and Western blotting (Fig. 9B). The transfected bovine cells with different concentration of pCMV^HA-NS5A were infected with BVDV (MOI = 1.0), followed by determining viral replication level and viral titer at 24 h after infection, and the results showed that viral replication greatly enhanced in the NS5A-expressing bovine cells in a dose-dependent manner (P < 0.05 or P < 0.01) (Fig. 9C), as well as the viral titer (Fig. 9D) and the expression levels of viral proteins (Fig. 9E). We further found the viral NS5A protein effectively activated the NF-κB signaling pathway (Fig. 9F) and promoted the mRNA (Fig. 9G) and protein expression levels (Fig. 9H) of DHCR24 in a dose-dependent manner. We also found that viral NS5A protein significantly promoted the cholesterol production in a dose-dependent manner (P < 0.05, P < 0.01, or P < 0.001) (Fig. 9I). Using the inhibitor of NF-κB activity (QNZ) to treat bovine cells, we found that the mRNA level (Fig. 9J) and protein expression level (Fig. 9K) of the DHCR24 decreased obviously in the NS5A-expressing bovine cells (P < 0.01 or P < 0.001), as well as the cholesterol level (Fig. 9L), indicating that the NS5A-induced upregulation of the DHCR24 depends upon the NF-κB-mediated transcription. In addition, the interaction of viral NS5A protein and host DHCR24 protein was detected by IFA (Fig. 9M) and coimmunoprecipitation (co-IP) (Fig. 9N). Our data indicate that the NS5A protein plays an important role in BVDV replication via upregulating the DHCR24 expression to further promote the cholesterol synthesis.

FIG 9.

Viral NS5A protein facilitates BVDV replication via upregulating the expression of DHCR24 to further promote cholesterol synthesis. (A, B) Identification of the NS5A expression in pCMV-NS5A-transfected bovine cells by IFA (A) and Western blotting (B). (C to E) Determination of viral replication levels (C), viral titers (D), and expression levels of viral proteins (E) in the NS5A-expressing bovine cells at 24 h after infection. (F) Identification of NS5A activating NF-κB by IFA. (G, H) Identification of the NS5A promoting mRNA and protein expression levels of the DHCR24 in the NS5A-expressing bovine cells by qRT-PCR (G) and Western blotting (H). (I) Determination of the NS5A promoting cholesterol synthesis. (J to L) Inhibitor of NF-κB activity (4-N-[2-(4-phenoxyphenyl)ethyl]quinazoline-4,6-diamine [QNZ]) inhibited the mRNA and protein expression of the DHCR24 in the NS5A-expressing bovine cells by qRT-PCR (J) and Western blotting (K), as well as the cholesterol level (L). (M, N) The interaction relationship between viral NS5A protein and host DHCR24 protein was identified by IFA (M) and co-IP assay (N). DAPI, 4′,6-diamidino-2-phenylindole; IP, immunoprecipitation; ns, not significant.

DISCUSSION

Studies have demonstrated that the members of the genus Flavivirus, such as Dengue virus, Zika virus, HCV, and West Nile virus depend on host cellular factors and organelles to complete their replication cycle. Among these host factors, cholesterol is one of the major cellular components required for viral infection, which facilitates viral entry, replicative complexes formation, assembly, and egress (38–40). Moreover, cholesterol is an essential constituent of lipid rafts, which is necessary for normal physiological functions of cells, and participates in receptor-mediated signal transduction (41), endocytosis, penetration, and release of viruses (39, 40). Studies by researchers have also reported that the cholesterol is involved in innate immunity responses (42–44). Therefore, deep exploration of cholesterol metabolism pathway contributes to understanding the mechanism of virus-host interactions. Based on our transcriptomic and proteomic data of BVDV-infected bovine cells (37), we found that the key genes/proteins involved in the cholesterol synthesis, such as HMGCS1, HMGCR, MVK, PMVK, MVD, FDPS, LSS, DHCR7, SQLE, and DHCR24, were significantly upregulated after BVDV infection. In addition, we utilized MβCD, a cholesterol lowering drug (45), to deplete the cellular cholesterol of bovine cells, followed by infection with BVDV, and found viral replication was greatly inhibited, as well as the expression levels of viral proteins. Therefore, our data indicate that the cholesterol plays an important role in the process of BVDV invasion and replication, while the underling mechanisms should be further explored experimentally.

As an important component in cell membranes, fetal development, and a precursor for steroid hormones, cholesterol is necessary for mammalian life cycles. It is well known that 3-hydroxy-3-methyl-glutaryl coenzyme A (HMG-CoA) reductase is involved in the early step in cholesterol synthesis, and DHCR24 is involved in the last step of cholesterol synthesis (34, 46). DHCR24 is a key cholesterol biosynthetic enzyme, which also modulates lipid raft formation (47). Moreover, DHCR24 is also related to a variety of diseases caused by lipid metabolism disorders (48, 49). Currently, the mevalonate pathway in cholesterol synthesis pathway and cholesterol synthesis enzymes have been proven to be related to virus replication (34, 50). From our transcriptomic and proteomic data, we found that the mRNA and protein levels of the DHCR24 in the BVDV-infected bovine cells were upregulated significantly, which was further confirmed by qRT-PCR and Western blotting, indicating that BVDV infection promotes the expression of host DHCR24 protein. Remarkably, the overexpression of DHCR24 effectively promoted the cholesterol production and facilitated BVDV replication. However, siRNA-mediated knockdown of the DHCR24 significantly inhibited BVDV replication, and the viral titer in the siDHCR24-transfected bovine cells decreased obviously, as well as the expression levels of viral proteins. In addition, we also found the cellular cholesterol level in the siDHCR24-transfected bovine cells remarkably reduced. Significantly, the supplementation of exogenous cholesterol effectively rescued BVDV replication in the DHCR24-enervated cells. Taken together, our data suggest that host DHCR24 protein is involved in BVDV replication via promoting cholesterol synthesis, similar to the previous report on HCV (belonging to the family Flaviviridae same as BVDV) showing that HCV infection-induced DHCR24 expression facilitates viral replication (34).

Lipid-metabolizing enzyme inhibitors targeting lipid metabolism pathway are often used to explore the effects on viral replication. In this study, we utilized U18666A (which can destroy the biosynthesis and transport of cholesterol and inhibit the function of membrane-bound enzymes, such as DHCR24) to analyze the effect of inhibited DHCR24 activity on BVDV replication. Our results showed that BVDV replication was inhibited significantly in the U18666A-treated bovine cells, as well as the expression levels of viral proteins in a U18666A-dependent manner. We also found that the cellular cholesterol level in the U18666A-treated bovine cells remarkably reduced in a dose-dependent manner. However, the addition of exogenous cholesterol into the DHCR24 enzyme activity-inhibited bovine cells effectively rescued BVDV replication in a cholesterol-dependent manner. Moreover, we found that DHCR24 was accumulated in the U18666A-treated bovine cells, as DHCR24 enzyme activity was inhibited by the U18666A. Taken together, our data suggest that U18666A may inhibit BVDV replication via inactivating DHCR24 enzyme to further inhibit cholesterol synthesis, similar to the previous report on CSFV (belonging to the genus Pestivirus, the same as BVDV) that U18666A inhibits CSFV replication through interference with intracellular cholesterol (51). Notably, DHCR7 is another key enzyme involved in the final step of the cholesterol synthesis, which can catalyze 7-dehydrocholesterol to cholesterol (52). Although we did not perform a necessary functional verification for the DHCR7 in this work, the mRNA and protein expression levels of the DHCR7 in BVDV-infected bovine cells were determined, and results showed that the mRNA and protein levels in bovine cells were significantly upregulated after BVDV infection. A study by researchers reported that the DHCR7 inhibitors promoted the clearance of virus by inhibiting cholesterol synthesis and promoting type I interferon production (53). Therefore, our study is underway to explore whether BVDV-induced DHCR7 upregulation can facilitate viral replication by promoting the cholesterol synthesis and inhibiting type I interferon production.

Previous studies have suggested that nonstructural protein 5A (NS5A) from HCV and BVDV plays a similar role during virus infection. BVDV NS5A protein contains an essential zinc-binding site similar to that of the HCV NS5A protein, which is well conserved in BVDV NS5A (54). In addition, the NS5A protein form HCV and BVDV are phosphorylated by the same or similar cellular kinases (55). A 2010 study reported that BVDV NS5A protein mainly localizes on the endoplasmic reticulum in the BVDV-infected cells (56), and treatment with NS5A inhibitors leads to a significant reduction in cholesterol levels within the endomembrane structures of HCV-replicating cells (57). Therefore, we speculate that BVDV NS5A protein may be involved in lipid (cholesterol) synthesis and metabolism, which was confirmed experimentally in this study. We also found that there was an interaction relationship between viral NS5A protein and host DHCR24 protein. Our data elucidate that the viral NS5A protein can facilitate BVDV replication via promoting the expression of the DHCR24 for the cholesterol synthesis.

In conclusion, we explored the function of host DHCR24 protein in BVDV replication in this study. We found that BVDV infection significantly induced the expression of DHCR24 in bovine cells. Further, through silencing via siDHCR24 and targeting DHCR24 activity via an inhibitor approach, we found that DHCR24 inhibition effectively impaired BVDV replication, while this inhibition can be resurrected by supplementation of exogenous cholesterol. Conclusively, our data elucidate that BVDV facilitates its replication via promoting the expression of host DHCR24 for cholesterol synthesis (a schematic diagram was given in Fig. 10), indicating a potential drug target for anti-BVDV intervention.

FIG 10.

Schematic diagram for BVDV infection-induced upregulation of the DHCR24 regulating the cholesterol synthesis, which facilitates viral replication.

MATERIALS AND METHODS

Cells, virus, and plasmids.

MDBK cells and primary BT cells were grown in high-glucose Dulbecco’s modified Eagle’s medium (DMEM; Gibco, USA) supplemented with 10% fetal bovine serum (FBS; Tianhang, China) at 37°C in a 5% CO₂ incubator. The BVDV strain AV69 kept in our laboratory was used in this study. BVDV was propagated in MDBK cells and BT cells. The cells (over 80% confluent) were infected with BVDV at a MOI of 1.0 for all experiments. The eukaryotic expression plasmid pCMV-DHCR24 containing the DHCR24 gene was constructed as follows: total RNA of BVDV-infected bovine cells was extracted by FastPure cell/tissue total RNA isolation kit (Vazyme, RC101-01, China) and was reverse-transcribed into cDNA. Then, the DHCR24 gene was amplified by PCR with primers listed in Table 1, using the cDNA as the template. After that, the DHCR24 gene was subcloned into expression plasmid pCMV-HA, generating the recombinant plasmid pCMV-DHCR24.

TABLE 1.

Primers used in this study^a

Genes	Primer sequences (5′ to 3′)	Product size (bp)	Purpose
DHCR24	F: TAACGCCATGGAGGCCATGGAGCCCGCTGTG	1,551	Overexpression
	R: CCGCTCGAGTTATCAGTGCCTGGCAGCC
DHCR24	F: GCTGGACTCTGCCTGTGTTGC	82	qRT-PCR
	R: GACGAAGACTCGATGCCTGTGC
NS5A	F: TCGGGCCATGGAGGCCTCTGGGAATTATATCTT	1,488	Overexpression
	R: CGCCTCGAGTTACAGCTTCATTGTGTAGGTCC
5′-UTR	F: GGTAGCAACAGTGGTGAG	220	qRT-PCR
	R: GTAGCAATACAGTGGGCC
E2	F: ACGAGAGCCCTGCCGACATC	114	qRT-PCR
	R: AGCATCACACGGGCAAAGACC
NS5B	F: AGACACAAGTGCAGGCAACAGC	132	qRT-PCR
	R: AGGAAGCCGTCATCCCCACAG
β-Actin	F: GCCAACCGTGAGAAGATGAC	94	qRT-PCR
	R: AGGCATACAGGGACAGCACA

^aF forward; qRT-PCR, quantitative reverse transcription-PCR; R, reverse, UTR, untranslated region. DHCR24, 3β-hydroxysteroid-Δ24 reductase; NS5A, non-structural protein 5A; 5’UTR, 5’untranslated region.

Overexpression of DHCR24.

Bovine cells cultured as monolayers (about >90% confluent) in a 6-well plate were transfected with the eukaryotic expression plasmid pCMV-DHCR24 (5 μg/μL) using the Lipofectamine 3000 reagent (Invitrogen, USA) and incubated at 37°C in 5% CO₂ for 24 h, followed by the identification of the DHCR24 expression by indirect IFA and Western blotting. Subsequently, the bovine cells transfected with the plasmid pCMV-DHCR24 were infected with BVDV strain AV69 (MOI = 1.0) and cultured at 37°C in 5% CO₂ for 24 h, using empty pCMV-transfected bovine cells as control, followed by the determination of viral titer (TCID₅₀), viral replication level, and expression levels of viral proteins using the Reed-Muench method, qRT-PCR, and Western blotting, respectively.

Small interfering RNA (siRNA).

MDBK cells and BT cells were cultured in 6-well plates until 80% to 90% confluent and then were transiently transfected with a specific siRNA targeting DHCR24 (siDHCR24) designed by Ribobio Co., Ltd. (Guangzhou, China), using Lipofectamine 3000 reagent (Invitrogen, USA) and Opti-MEM (Thermo Fisher Scientific, USA). In parallel, the siControl nontargeting siRNA (Ribobio, China) was used as a negative-control siRNA. At 24 h after transfection, the mRNA and protein levels of the DHCR24 in siDHCR24-transfected and siControl-transfected bovine cells were determined, as well as the cholesterol level measured by a total cholesterol assay kit (Mlbio, China). Then, the transfected bovine cells were infected with BVDV (MOI = 1.0), followed by the determination of viral replication level and viral titer.

MβCD and U18666A treatment.

MβCD (also called methyl-β-cyclodextrin, cholesterol-depleting drug; Biosharp, China) and U18666A (also called 3β-(2-diethylaminoethoxy)-androst-5-en-17-one, an inhibitor of DHCR24 activity and cholesterol synthesis; Biosharp, China) was used to treat bovine cells. Briefly, MDBK cells and BT cells were cultured until 80% to 90% confluent; after washing with sterile phosphate-buffered saline (PBS), the cells were infected with BVDV (MOI = 1.0) and cultured at 37°C in 5% CO₂ for 2 h; after removing the liquid, the cells were supplemented with complete medium containing different concentrations of U18666A (0.1, 0.5, 1.0, and 1.5 ng/mL) or MβCD (5, 10, 15, and 20 mM) for a further 24 h; then, the cells were collected, and cholesterol level, viral replication and viral proteins levels, and DHCR24 expression level were determined, respectively.

Cholesterol supplementation experiment.

To explore whether exogenous cholesterol supplementation can rescue viral replication in the siDHCR24-transfected or U18666A-treated bovine cells, the bovine cells transfected with the siDHCR24 or treated with the U18666A were infected with BVDV (MOI = 1.0) and cultured in DMEM (Gibco, USA) containing 2% FBS (Tianhang, China) plus different concentrations of cholesterol (Solarbio, China) at 37°C in 5% CO₂ for 24 h. Then, the cells were harvested, and the level of BVDV replication was determined.

Cholesterol concentration assay.

Cellular cholesterol concentration was determined by the total cholesterol assay kit (Mlbio, China) according to the manufacturer’s instructions. Briefly, the cells were washed thrice with PBS and incubated in PBS (pH 7.4) containing 2% Triton X-100 (Sigma, USA) at 37°C for 30 min, followed by treatment with Good’s buffer containing cholesterol esterase, phenol, 4-aminoantipyrene (4-AAP), cholesterol oxidase, and peroxidase at 37°C for 10 min. After that, the absorbance of each cell sample was measured at 510 nm by a SpectraMax ABS absorbance microplate reader (Molecular Devices, USA). Cholesterol content (mmol/mL) was calculated according to the following formula: (OD_Sample − OD_Blank/OD_{Standard sample} − OD_Blank) × standard sample content × (sample volume/total volume of sample homogenate).

qRT-PCR.

Cell (MDBK/BT) samples (also cell supernatants for some experiments) with different treatments were collected, followed by total RNA extraction using a FastPure cell/tissue total RNA isolation kit (RC101-01, Vazyme, China). Next, the total RNA was reverse-transcribed into cDNA with random hexamers (Invitrogen, USA) using SuperScript III reverse transcriptase. The mRNA levels of DHCR24 gene in the cells with different treatments were determined by a SYBR green-based qRT-PCR on an ABI 7500 real-time PCR system (Thermo Fisher Scientific, USA), using β-actin as an internal control. In addition, the expression levels of genes (5′UTR, E2, and NS5B) of BVDV were determined by absolute qRT-PCR, with the standard curve generated by the recombinant plasmid pMD-5′UTR (pMD-E2, pMD-NS5B) containing the 5′UTR (E2, NS5B) gene, which were also used to evaluate the viral replication level. Each reaction was performed in triplicate and repeated independently three times. All primers used for qRT-PCR were listed in Table 1.

Western blotting.

Cell (MDBK cell/BT cell) samples that were subjected to different treatments were collected, lysed in radioimmunoprecipitation assay buffer (Beyotime, China), and homogenized for 2 min using an ultrasonic homogenizer. Next, the cell lysates were centrifuged at 12,000 rpm for 10 min at 4°C, and the total protein concentration in the supernatants was determined using a bicinchoninic acid protein assay kit (Beyotime, China). Next, the levels of host proteins DHCR7, DHCR24, FASN, and HMGCR and viral proteins E2 and NS5B were determined by Western blotting using β-actin as an internal control. Briefly, the cell lysates were mixed with 2 × sodium dodecyl sulfate (SDS) loading buffer and boiled for 10 min, followed by the proteins separation through 12% SDS-polyacrylamide gel electrophoresis. Next, the proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane (Bio-Rad, USA), followed by blocking with 5% skimmed milk; the PVDF membrane was incubated with a rabbit anti-DHCR24 polyclonal antibody (pAb) (LS-C80987, LifeSpan BioSiences, USA; 1:500), rabbit anti-DHCR7 pAb (DF13577, Affinity Biosciences, USA; 1:500), rabbit anti-HMGCR pAb (DF6518, Affinity Biosciences, USA; 1:500), rabbit anti-FASN pAb (DF6106, Affinity Biosciences, USA; 1:500), mouse anti-β-actin monoclonal antibody (MAb) (ab11577, Abcam, USA; 1:500), mouse anti-BVDV E2/NS5B MAb (prepared in our laboratory; 1:500), mouse anti-Myc MAb (BF8036, Affinity Biosciences, USA; 1:500), and mouse anti-hemagglutinin (HA) Mab (T0008, Affinity Biosciences, USA; 1:500) as the primary antibody and horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (ab205718, Abcam, USA; 1:5,000)/anti-mouse IgG antibody (ab205719, Abcam, USA; 1:5,000) as the secondary antibody. Then, visualization was performed using a Western Lightning chemiluminescence reagent plus kit (Applygen, China).

Indirect IFA.

Cell samples were collected after transfection, washed twice with PBS, and fixed with 4% of paraformaldehyde at room temperature (RT) for 30 min. After washing twice with PBS, the cells were treated with 0.2% of Triton X-100 (Sigma, USA) for permeabilization at RT for 10 min, followed by blocking with 0.3% of bovine serum albumin at 37°C for 1 h. Next, the cells were incubated with the rabbit anti-DHCR24 pAb (LS-C80987, LifeSpan BioSiences, USA; 1:200) as the primary antibody at 37°C for 1 h, followed by incubation with fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit IgG antibody (ab150077, Abcam, USA; 1:200) at 37°C for 1 h. After washing thrice with PBS, the protein expression was observed through a fluorescence microscope.

50% tissue culture infective dose (TCID₅₀).

The viral titer was determined by TCID₅₀. Briefly, bovine cells were cultured in a 96-well plate until 90% confluent; next, the cells were incubated with 10-flod serial dilutions (from 10¹ to 10¹⁰ dilutions) of BVDV stock at 37°C in 5% CO₂ for 2 h; after washing with sterile PBS, 200 μL DMEM containing 2% FBS was added into each well, and the cells were continually cultured at 37°C in a 5% CO₂ incubator for a further 3 to 5 days, followed by counting the cytopathic effect wells of each dilution of BVDV. The viral titer (TCID₅₀) was calculated by Reed-Muench method. Each determination was repeated three times.

NS5A promotes the augmentation of DHCR24 expression.

Eukaryotic expression plasmid pCMV-NS5A containing the gene encoding BVDV NS5A protein was constructed as follows: total RNA of BVDV-infected bovine cells was extracted by FastPure cell/tissue total RNA isolation kit and then was reverse-transcribed into cDNA. Next, the NS5A gene was amplified by PCR with the primer pair listed in Table 1, using the cDNA as the template; Next, the NS5A gene was subcloned into expression plasmid pCMV-Myc, generating pCMV-NS5A. After that, the expression of the NS5A protein in the pCMV-NS5A-transfected bovine cells was identified by IFA and Western blotting with mouse anti-NS5A MAb (prepared in our laboratory). Subsequently, the transfected bovine cells were infected with BVDV (MOI = 1.0), followed by the determination of viral replication level (qRT-PCR) and viral titer (TCID₅₀) at 24 h after infection, as well the levels of viral proteins (E2 and NS5B) by Western blotting. In addition, the activation of the NF-κB signaling pathway (p65 nuclear translocation) and mRNA and protein levels of the DHCR24 induced by the NS5A protein were determined in the NS5A-expressing bovine cells by IFA, qRT-PCR, and Western blotting, respectively. Moreover, cholesterol levels in the transfected bovine cells with different concentration of the pCMV-NS5A were determined by the total cholesterol assay kit (Mlbio, China) at 24 h after transfection. The localization relationship of the NS5A (anti-NS5A) and the DHCR24 (anti-DHCR24) in the NS5A-expressing bovine cells was detected by IFA. We further used QNZ (also called 4-N-[2-(4-phenoxyphenyl)ethyl]quinazoline-4,6-diamine, an inhibitor of NF-κB activity; Biosharp, China) to treat bovine cells, followed by transfection of the pCMV-NS5A; the mRNA and protein levels of the DHCR24 in the QNZ-treated bovine cells were determined at 24 h after transfection by qRT-PCR and Western blotting, as well as the cholesterol level by the total cholesterol assay kit (Mlbio, China).

Coimmunoprecipitation.

Co-IP assay was used to further analyze the localization relationship between viral protein NS5A and host protein DHCR24. Briefly, the bovine cells were transfected with plasmid pCMV^HA-NS5A and/or pCMV^Myc-DHCR24 and cultured at 37°C in 5% CO₂ for 36 h. Next, the cells were collected and lysed in IP lysis buffer containing protease inhibitor phenylmethylsulfonyl fluoride (PMSF) (Beyotime, China). After centrifugation, the supernatants were collected and incubated with anti-HA-agarose beads (Sigma, USA). Subsequently, the beads were washed thrice with PBS and eluted with 5× SDS sample buffer, followed by boiling for 10 min; Western blotting assay was performed.

Cell viability.

In this study, the viability of bovine cells with different treatments was detected using a Cell Counting kit-8 (CCK8) assay. Briefly, the bovine cells (MDBK/BT) were cultured in a 96-well plate until ~100% confluent and then were treated with 0.5% dimethyl sulfoxide (DMSO) and a working concentration of U18666A, MβCD, and Lipofectamine 3000 reagents, followed by culture for a further 48 h. Next, CCK8 (Biosharp, China) was used to evaluate cell viability according to the manufacturer’s instructions.

Statistical analysis.

In this study, the data are represented as the means ± standard deviation (SD). Tukey’s multiple-comparison tests and one-way analysis of variance (ANOVA) were used to analyze the differences among groups by GraphPad Prism V8.0. Significant differences are indicated with asterisks (*, P < 0.05; **, P < 0.01; ***, P < 0.001).