Skip to main content
NCBI home page
mSphere logoLink to mSphere
. 2022 Nov 15;7(6):e00518-22. doi: 10.1128/msphere.00518-22

Interruption of Capsular Polysaccharide Biosynthesis Gene wbaZ by Insertion Sequence IS903B Mediates Resistance to a Lytic Phage against ST11 K64 Carbapenem-Resistant Klebsiella pneumoniae

Xin Yin a,c, Qingqing Fang a,d, Zhiyong Zong a,b,c,✉
Editor: Paul D Feye
PMCID: PMC9769513  PMID: 36377881

ABSTRACT

Carbapenem-resistant Klebsiella pneumoniae (CRKP) is a major challenge for clinical management worldwide with limited antimicrobial options. Phages are considered an alternative option. Here, we isolated and identified a phage able to lyse ST11-K64 CRKP, the major type in China. This phage has a narrow host range, only lysing ST11-K64 CRKP, and inhibits the growth of host strains for 3 h forming large clear plaques (3.0 to 6.0 mm in diameter) with a surrounding halo. This phage exhibited excellent stability in different temperatures and pH and did not contain any virulence, lysogenic, antimicrobial resistance genes nor tRNA, meeting the criteria for phage therapy. Genomic analysis revealed that it represents a novel species of the Przondovirus genus according to ICTV standards. However, phage-resistant bacterial mutants emerged after 4-h exposure. Compared to the parental strain, phage-resistant mutants showed nonmucoid appearance and exhibited significantly reduced virulence for Galleria mellonella larva. Three randomly selected phage-resistant mutants were genome sequenced. Interruption of capsular polysaccharide biosynthesis-associated gene wcaJ or wbaZ by IS903B alone or an IS903-formed composite transposon was identified. Interruption of wcaJ is a known phage resistant mechanism, while that of wbaZ is not. By complementing the intact wbaZ, the phage susceptibility was restored, confirming the role of wbaZ interruption in phage resistance. This highlights that alteration in the capsular polysaccharide biosynthesis gene cluster, which could be due to transposable elements, is a major mechanism for resistance to Przondovirus phages in CRKP. Noncapsule-targeting phages may be combined for improving phage therapy against CRKP.

IMPORTANCE Phage therapy is an alternative approach against multidrug resistant microorganisms such as carbapenem-resistant Klebsiella pneumoniae (CRKP), which represents a major challenge for treatment due to very limited options of antimicrobial agents. For optimizing phage therapy, more new lytic phages are needed. Here, we isolated and characterized a phage of a novel species able to rapidly lyse a major type of CRKP without carrying any virulence, lysogenic, antimicrobial resistance genes. This phage is therefore suitable for clinical treatment. However, phage-resistant mutants of CRKP strains were observed after exposure. We found a new mechanism, i.e., interruption of a capsular polysaccharide biosynthesis gene wbaZ by an insertion sequence-formed composite transposon. Our study demonstrates the capsular polysaccharide biosynthesis gene cluster as a major source of resistance to certain lytic phages in CRKP. This requires more studies to counter phage resistance. Our studies also highlight the critical role of insertion sequences in phage resistance.

KEYWORDS: phage therapy, Klebsiella pneumoniae, K64, capsule polysaccharide, phage resistance, Klebsiella, bacteriophages

OBSERVATION

Carbapenem-resistant Klebsiella pneumoniae (CRKP) has been labeled as a “Critical” priority pathogen that poses a serious threat to human health by the World Health Organization on the priority list (1). In addition to the development of new antimicrobial agents, phage therapy plays an increasingly important role in treating infections caused by antimicrobial resistant bacteria, including CRKP (2). Successful cases using phages to treat CRKP infections have been increasingly reported worldwide (3, 4), and two clinical trials of phage therapy against CRKP infections are forthcoming (see www.clinicaltrials.gov/). Along with the increasing interest of phages for clinical use, the number of genome sequences of phages in GenBank has increased exponentially. However, very few phages have been reported to meet the requirements of clinical treatment (5) and have been described in detail for their biological characteristics (6). In addition, phage-resistant bacterial mutants are prone to emerge and such resistance has become a major obstacle to the broad application of phages (7–9). Transposable elements such as insertion sequences and transposons are ubiquitous in prokaryotic genomes and could provide the host bacterial strains genetic plasticity to counter various challenges (10). Here, we report a newly recovered phage that is able to lyse K. pneumoniae of sequence type (ST) 11 and capsular type K64, the dominant CRKP type in China, and meet the biological criteria of phage therapy. We also describe a gene involving in phage resistance in CRKP, which has not been reported before.

We used a ST11 K64 CRKP clinical strain, 135077, which was isolated from urine of a hospitalized patient in 2006, as the host strain for isolating phages. CRKP 135077 was resistant to meropenem (MIC, 4 mg/L). The draft genome sequence of 135077 was obtained using the HiSeq-10X platform (Illumina; San Diego, CA, USA) with a paired-end layout of 150 bp followed by assembly using SPAdes v3.15.3 (11). 135077 belonged to ST11 and K64 type but did not contain a known carbapenemase gene. Instead, this strain had mutations of its OmpK35 porin (Fig. S1), which could result in reduced permeability of carbapenems (12) and carried blaCTX-M-65 gene encoding an extended-spectrum β-lactamase (ESBL). It has been well reported that the combination of production of ESBLs and porin alterations is able to lead to carbapenem resistance in K. pneumoniae (13–15).

FIG S1

The frameshift mutation of ompK35 in strain 135077. The ompK35 gene of strain 135077 was identified using Kleborate v2.0.0 (https://github.com/katholt/Kleborate). The complete ompK35 of the reference WP_151502934.1 contains AA at position 85 and 86. In contrast, 135077 contains only one A at the positions with missing another A (shown by *). The frameshift mutation due to the deletion results in translating new amino acids of OmpK35 afterward. Download FIG S1, PDF file, 0.4 MB (416.7KB, pdf) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

We collected water from a pond in Chengdu, China, in December 2020. We therefore isolated a phage, named 150004 here, from the water sample using methods as described previously (16). This phage is able to lyse strain 135077 with forming bull’s eye-shaped clear plaques (3.0 to 6.0 mm in diameter) that were surrounded by a large opaque halo zone (2.0 to 3.0 mm in diameter) (Fig. 1A). We determined the relative host range of this phage using a limited set of 19 CRKP clinical strains belonging to six STs and 10 capsular types, including five capsular types of ST11 (Table S1). Phage 150004 was able to lyse all ST11 K64 strains but could not lyse strains of any other sequence or capsular types. This suggests that phage 150004 was likely to be specific to ST11 K64 CRKP.

FIG 1.

FIG 1

Open in a new tab

Biological characteristics of phage 150004. Values represent the mean ± standard deviations (n = 3). (A) Plaque morphology of phage 150004. Scale bar, 1 cm. (B) The bacteriolytic activity of phage 150004 against strain 135077 at MOI of 0.01 in vitro. Negative control is LB broth. (C) One-step growth curve of phage 150004. (D) Annotated gene map of phage 150004. Blocks in various colors represent predicted CDSs encoding products of different functions.

TABLE S1

The host range of phage 150004. Download Table S1, DOCX file, 0.02 MB (19KB, docx) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

We next characterized phage 150004 for its major biological features to demonstrate its potential for clinical applications using a set of experiments performed as described previously (16, 17). In the phage adsorption assay, more than 92% of phage 150004 were rapidly adsorbed to the host strain 135077 in 3 min (Fig. S2). Phage 150004 could grow at temperatures between 0 to 50°C (Fig. S2) and at pH between 5 and 11 (Fig. S2). When the multiplicity of infection (MOI) was 0.01, the titers of phage 150004 reached maximum values after propagation with a titer of approximately 6.22 ± 2.59 × 1010 PFU/mL. To assess lytic activity, phage 150004 was added to the log-phase culture of CRKP strain 135077 at MOI 0.01. Strain 135077 was completely lysed by the phage within 1 h and the lysis lasted for approximately 3 h before regrowth (Fig. 1B). The latent period of phage 150004 was 40 min and the burst size was 58 ± 7 progeny phages per infected bacterial cell (Fig. 1C). In the transmission electron microscopy (TEM; Hitachi, Tokyo, Japan) images, phage 150004 exhibited about 10 nm short tails attached to an about 60 nm icosahedral head (Fig. S3). This appearance is consistent with those of phages belonging to the family Autographiviridae.

FIG S2

Characteristics of phage 150004. (A) Absorption rate of phage 150004. (B) Thermal stability of phage 150004. (C) pH stability of phage 150004. Download FIG S2, TIF file, 2.9 MB (2.9MB, tif) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S3

TEM morphology of phage 150004. Scale bar, 100 nm. Download FIG S3, TIF file, 2.0 MB (2MB, tif) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

We further performed genome sequencing for this phage to investigate its taxonomy and to identify whether it carried genes making it not suitable for phage therapy. Phage DNA was extracted using a phage DNA isolation kit (Norgen Biotek; Thorold, Canada) and was sequenced with HiSeq X10 (Illumina; San Diego, CA, USA). Phage 150004 has a linear double-stranded genome of 41,643 bp with a 52.7% GC content. There are 54 predicted CDSs encoding proteins involved in DNA replication (helicase, endonuclease, exonuclease, DNA polymerase, and RNA polymerase), DNA packaging (terminase large/small subunit), structural proteins (capsid and tail fiber), and host lysis (holin, endolysin, and Rz protein) as annotated by Prokka (18) and Rapid Annotations Subsystems Technology (RAST, http://rast.nmpdr.org/). The gene map of 150004 was constructed using Proksee (https://proksee.ca/) and is shown in Fig. 1D. By BLAST, phage 150004 was closest to phage kpssk3 (GenBank accession no. NC_048114.1) of the genus Przondovirus within the family Autographiviridae with 95.82% identity and 87% coverage. Phylogenetic tree of 150004 and phages of the genus Przondovirus was generated using the one‐click mode of Phylogeny (www.phylogeny.fr) containing a sequence alignment using the MUSCLE and Gblocks programs (19). This phylogenetic analysis revealed phage 150004 belongs to the genus Przondovirus (Fig. S4). Phage 150004 had the highest, 91.04%, overall DNA sequence similarity (identity × coverage) with Klebsiella phage 066056 (GenBank accession no MW042808.1), lower than the 95% cutoff for species demarcation defined by the International Committee on Taxonomy of Viruses (ICTV) (20). This suggests that phage 150004 represents a novel species of the genus Przondovirus within the family Autographiviridae. In addition, phage 150004 had no genes of antimicrobial resistance, virulence factors, lysogen or tRNA.

FIG S4

Phylogenetic tree of phage 150004 and those of the Przondovirus genus. The tree was inferred using the one‐click mode of Phylogeny (www.phylogeny.fr). Phage 150004 is highlighted in blue. Download FIG S4, PDF file, 0.2 MB (172.1KB, pdf) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

As mentioned above, phage 150004 lysed its host strain within 1 h but regrowth of the bacteria strain was observed after 4 h, indicating the presence of phage-resistant mutants. We therefore investigated the mechanisms for resistance to phage 150004. Three phage-resistant mutants, assigned PR1, PR2, and PR3 here, were randomly picked from the LB agar plate containing the mixture of phage 150004 and strain 135077 after overnight incubation at 37°C. The three mutants were further purified by streaking onto LB agar plates without the phage for consecutive three times and their resistance to phage 150004 was further confirmed by spot testing (16). The three mutants were genome sequenced as described above. SNP calling was performed using Snippy v4.6.0 (https://github.com/tseemann/snippy). Comparing to the parental strain, there were no SNPs in PR1, while four SNPs were found in PR2 and PR3, none of which were present in coding sequences. Gene presence/absence was determined using Roary v3.11.2 (21). In PR2 and PR3 the glycosyltransferase-encoding wcaJ gene, which involves in capsular polysaccharide (CPS) biosynthesis, was interrupted by insertion sequence IS903B. By PCR with self-designed primers wcaJ-IF (CTGTCGTTCCTCTTTTCG) and wcaJ-IR (CCGTTTCACCTCTCCATC) and subsequent Sanger sequencing, the interruption was found to be due to a single copy of IS903B (Fig. 2). We and others have previously reported that interruption of the wcaJ gene can mediate phage resistance (16, 22, 23). This could explain the phage resistance in PR2 and PR3.

FIG 2.

FIG 2

Open in a new tab

Interruption of the capsular polysaccharide (CPS) gene cluster and its impact on the susceptibility to phage and virulence. (A) The CPS gene cluster in parental strain 135077 and phage-resistant mutants PR1 and PR2. In the CPS gene cluster, conserved genes, variable regions, and insertion sequences are shown in blue, red, and yellow, respectively. The CPS gene cluster contains galF (encoding a UDP-glucose pyrophosphorylase), cpsACP (encoding an acid phosphatase), wzi (related to capsule surface assembly), wza (encoding a capsule polysaccharide export protein), wzb (encoding a tyrosine phosphatase), wzc (encoding a tyrosine-protein kinase), wzx (encoding a flippase), wcoV (encoding a polysaccharide pyruvyl transferase), wzy (encoding an O-antigen and lipid-linked capsular repeat unit polymerase), wcoU (encoding a UDP-Glc:α-d-GlcNAc-diphosphoundecaprenol β-1,3-glucosyltransferase), wcoT (encoding a glycosyltransferase), wcsF (also called mshA, encoding a glycosyltransferase), wcuK (encoding a glycosyl hydrolase), wbaZ (encoding a glycosyltransferase), wcaJ (encoding a UDP-phosphate glucose phosphotransferase), gnd (encoding a gluconate-6-phosphate dehydrogenase), manC (encoding a mannose-1-phosphate guanylyltransferase), manB (encoding a phosphomannomutase/phosphoglucomutase), rmlB (encoding a dTDP-d-glucose-4,6-dehydratase), rmlA (encoding a glucose-1-phosphate thymidylyltransferase), rmlD (encoding a dTDP-6-deoxy-l-mannose dehydrogenase), rmlC (encoding a UDP-glucose 6-dehydrogenase), and ugd (encoding a UDP-glucose 6-dehydrogenase). The functions of CDSs were determined using BLASTp (https://blast.ncbi.nlm.nih.gov/Blast.cgi). wbaZ was interrupted by a composite transposon formed by IS903B at the 528th nucleotide position in PR1. wcaJ was interrupted by IS903B of the IS5 family at the 1206th nucleotide position with the 9-bp direct target repeats (ATGCTGAGG) in PR2. Direct target repeats (DR) are shown by flags. The left and right inverted repeats (IRL and IRR) of IS903B are also shown. (B) Efficiency of plating (EOP) for phage 150004 against PR1, host strain 135077 and the transformant of PR1 containing pwbaZ. pwbaZ carries an intact of wbaZ from strain 135077. (C) Survival curves of Galleria mellonella larva infected with the parental strain 135077 and phage-resistant mutants PR1 and PR2.

In PR1, wcaJ remained intact but another CPS-associated glycosyltransferase gene wbaZ, which is located downstream of wcaJ, was also interrupted by IS903B. However, PCR failed to link the two disrupted fragments of wbaZ. We therefore sequenced PR1 using long-read MinION Sequencer (Nanopore; Oxford, UK) and obtained its complete genome by hybrid assembly of short and long reads with Unicycler v0.4.8 (24). We also obtained the complete genome sequence of the parental strain 135077 for comparison. We then identified that wbaZ was actually interrupted by a 6,653-bp composite transposon formed by two copies of IS903B. This composite transposon also contained two copies of IS26 and two copies of blaCTX-M-65 (Fig. 2) and was carried by an 149,214-bp plasmid containing two replicons (IncFII and IncR) in the parental strain 135077 but had mobilized to interrupt wbaZ in the chromosome of PR1 from this plasmid using a copy-and-paste model (Table S2). The presence of the composite transposon was verified by two overlapped PCR with self-designed primers binding the two interreupted parts of wbaZ and the region between the two copies IS26 (Fig. S5), respectively, and subsequent Sanger sequencing. As interruption of wbaZ has not been reported as a phage resistance mechanism, we performed complementing experiments to verify the role of wbaZ in resistance to phage 150004. We obtained the complete wbaZ gene sequence from of the parental strain 135077 by PCR using self-designed primers wbaZ-F-BamHI (CGGGATCCGGTTTGGTATTTATAAG) and wbaZ-R-SacI (AACGAGCTCTCTTTGAACCATTGATA; the restriction sites are underlined). We then cloned PCR amplicons into vector pBC SK (Stratagene; La Jolla, CA, USA), which were transformed into PR1. We obtained a transformant from a LB agar plate containing 40 mg/L chloramphenicol, on which PR1 could not grow. We confirmed the presence of the intact wbaZ gene in the transformant by PCR and subsequent Sanger sequencing. We found that the recombined transformant, named PR1::pwbaZ, fully restored its susceptibility to phage 150004 using the spot assay (Fig. 2B). We performed CPS quantification assay in triplicate as described previously (16) and used one-way ANOVA for statistical analysis. We found CPS production of phage-resistant mutant PR1 significantly decreased (mean ± standard deviation [SD], 24.44 ± 1.23 versus 40.47 ± 0.65 mg/L; P = 0.005) compared with that of the parental strain 135077. In contrast, CPS production of PR1::pwbaZ (mean ± SD, 37.55 ± 0.73 mg/L) was restored to the level comparable to that of 135077. The above findings confirmed that the interruption of wbaZ could medicate resistance to phage 150004. In addition to interruption of wbaZ and wcaJ, alterations of several other genes within the capsule gene cluster, including mshA (16), wcaI (25), wbaP (25–27), wza (28), and wzc (25, 26, 29) have also been reported to be able to confer resistance to phages in K. pneumoniae. These findings together with previous reports (8, 30, 31) underscore that alterations in capsule genes, especially glycosyltransferases, are important mechanisms to confer phage resistance in bacterial species (7, 32). Transposable elements, in particular insertion sequences, appear to be play a vital role to alter capsule genes by interruption or truncation (16, 33), highlighting that the plasticity offered by these elements is an important mechanism for bacteria to enhance the chance of survival in response to the selection pressure imposed by phages (7).

TABLE S2

The complete genome and antimicrobial resistance genes of strains 135077 and PR1. Download Table S2, DOCX file, 0.02 MB (19.7KB, docx) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S5

Self-designed primers for the two overlapped PCR. The locations of the primers are shown. The two PCR are using 1-IF (TGGAATTGTTGCAGATTGGC)/1-IR (CCTGAAGCTGGGCAAAGTA) and 2-IF (GTCCGGATCATTTCGTCC)/2-IR (CACTGCCATCACCTATAACAATC), respectively. wbaZ was interrupted by the IS903-formed composite transposon. Download FIG S5, PDF file, 0.07 MB (68.6KB, pdf) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

There were two extra copies of blaCTX-M-65 in PR1, we therefore determined MICs of ceftazidime, cefotaxime and piperacillin-tazobactam using the broth microdilution method according to the Clinical and Laboratory Standards Institute (CLSI) guidelines (34). However, MICs of the tested agents appeared to be the same, ceftazidime (128 mg/L), cefotaxime (>256 mg/L), piperacillin-tazobactam (>256/4 mg/L), for the two strains, suggesting that the two extra copies of blaCTX-M-65 did not significantly increase the level of resistance to these agents. As CPS is a key virulence factor in K. pneumoniae (35), we also tested PR1 and PR2 (also representing PR3 with the same phage resistance mechanism) for growth, serum resistance, and virulence as described previously (16, 36). Unlike the mucoid appearance of the parental strain 135077, both PR1 and PR2 exhibited the nonmucoid appearance. The virulence experiments were performed using Galleria mellonella larva. For each group, 16 larvae were injected with 10 μL suspension containing 108 CFU/mL of bacterial strain (PR1, PR2, or 135077) or 10 μL PBS as a negative control and the virulence experiments were performed in duplicate, which were pooled (i.e., 32 larvae per group) for statistical analysis using Log-rank test. As expected, the survival rate of larvae (96.88%) infected by PR1 or PR2 was significantly higher than that (25%, P < 0.001) by parental strain 135077 (Fig. 2C). However, we did not find differences between the two phage resistant mutants and the parental strain 135077 in growth nor in serum resistance, which performed in triplicate (Fig. S6).

FIG S6

Some biological differences between the parental strain and phage-resistant mutants. (A) Growth curve of parental strain 135077 and phage-resistant mutants PR1 and PR2. (B) Bacterial serum resistance assay of parental strain 135077 and phage-resistant mutants PR1 and PR2. Download FIG S6, TIF file, 1.9 MB (1.9MB, tif) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

In conclusion, we isolated and characterized a lytic phage against ST11 K64 CRKP, the major type of CRKP in China, meeting the biological criteria of phage therapy. This adds new options to treat CRKP infections. We also found that resistance to phages of the genus Przondovirus could be due to interruption of various genes (wbaZ and wcaJ here as well as mshA, wcaI, wbaP, wza, and wzc in literature) rather than a specific gene in the CPS biosynthesis cluster. This identifies a target, the CPS biosynthesis gene cluster, for further studies to overcome phage resistance and therefore to improve the potential effect of phage therapy. Alternative, phages targeting the capsule may be combined with those acting on targets for improving phage therapy against multidrug-resistant organisms such as CRKP.

The complete sequence of phage 150004, the complete genome of 135077, the complete genome of PR1, and the draft genome sequences of PR2 and PR3 have been deposited in GenBank under accession numbers OP045496, CP073290-CP073296, CP101726-CP101730, JANHBX000000000, and JANHBY000000000, respectively.

ACKNOWLEDGMENTS

The work was supported by a joint grant from the National Natural Science Foundation of China (81861138055) and grants from West China Hospital of Sichuan University (ZYYC08006 and ZYGD22001).

Contributor Information

Zhiyong Zong, Email: zongzhiy@scu.edu.cn.

Paul D. Fey, University of Nebraska Medical Center

REFERENCES

  • 1.Tacconelli E, Carrara E, Savoldi A, Harbarth S, Mendelson M, Monnet DL, Pulcini C, Kahlmeter G, Kluytmans J, Carmeli Y, Ouellette M, Outterson K, Patel J, Cavaleri M, Cox EM, Houchens CR, Grayson ML, Hansen P, Singh N, Theuretzbacher U, Magrini N, Group WHOPPLW. 2018. Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect Dis 18:318–327. doi: 10.1016/S1473-3099(17)30753-3. [DOI] [PubMed] [Google Scholar]
  • 2.Chang RYK, Nang SC, Chan H-K, Li J. 2022. Novel antimicrobial agents for combating antibiotic-resistant bacteria. Adv Drug Deliv Rev 187:114378. doi: 10.1016/j.addr.2022.114378. [DOI] [PubMed] [Google Scholar]
  • 3.Eskenazi A, Lood C, Wubbolts J, Hites M, Balarjishvili N, Leshkasheli L, Askilashvili L, Kvachadze L, van Noort V, Wagemans J, Jayankura M, Chanishvili N, de Boer M, Nibbering P, Kutateladze M, Lavigne R, Merabishvili M, Pirnay JP. 2022. Combination of pre-adapted bacteriophage therapy and antibiotics for treatment of fracture-related infection due to pandrug-resistant Klebsiella pneumoniae. Nat Commun 13:14. doi: 10.1038/s41467-021-27656-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Nir-Paz R, Gelman D, Khouri A, Sisson BM, Fackler J, Alkalay-Oren S, Khalifa L, Rimon A, Yerushalmy O, Bader R, Amit S, Coppenhagen-Glazer S, Henry M, Quinones J, Malagon F, Biswas B, Moses AE, Merril G, Schooley RT, Brownstein MJ, Weil YA, Hazan R. 2019. Successful treatment of antibiotic-resistant, poly-microbial bone infection with bacteriophages and antibiotics combination. Clin Infect Dis 69:2015–2018. doi: 10.1093/cid/ciz222. [DOI] [PubMed] [Google Scholar]
  • 5.Gelman D, Yerushalmy O, Alkalay-Oren S, Rakov C, Ben-Porat S, Khalifa L, Adler K, Abdalrhman M, Coppenhagen-Glazer S, Aslam S, Schooley RT, Nir-Paz R, Hazan R. 2021. Clinical Phage Microbiology: a suggested framework and recommendations for the in-vitro matching steps of phage therapy. Lancet Microbe 2:E555–E563. doi: 10.1016/S2666-5247(21)00127-0. [DOI] [PubMed] [Google Scholar]
  • 6.Leptihn S, Loh B. 2022. Complexity, challenges and costs of implementing phage therapy. Future Microbiol 17:643–646. doi: 10.2217/fmb-2022-0054. [DOI] [PubMed] [Google Scholar]
  • 7.Labrie SJ, Samson JE, Moineau S. 2010. Bacteriophage resistance mechanisms. Nat Rev Microbiol 8:317–327. doi: 10.1038/nrmicro2315. [DOI] [PubMed] [Google Scholar]
  • 8.Wang X, Loh B, Gordillo Altamirano F, Yu Y, Hua X, Leptihn S. 2021. Colistin-phage combinations decrease antibiotic resistance in Acinetobacter baumannii via changes in envelope architecture. Emerg Microbes Infect 10:2205–2219. doi: 10.1080/22221751.2021.2002671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Tkhilaishvili T, Winkler T, Muller M, Perka C, Trampuz A. 2019. Bacteriophages as adjuvant to antibiotics for the treatment of periprosthetic joint infection caused by multidrug-resistant Pseudomonas aeruginosa. Antimicrob Agents Chemother 64:e00924-19. doi: 10.1128/AAC.00924-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Vandecraen J, Chandler M, Aertsen A, Van Houdt R. 2017. The impact of insertion sequences on bacterial genome plasticity and adaptability. Crit Rev Microbiol 43:709–730. doi: 10.1080/1040841X.2017.1303661. [DOI] [PubMed] [Google Scholar]
  • 11.Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, Pyshkin AV, Sirotkin AV, Vyahhi N, Tesler G, Alekseyev MA, Pevzner PA. 2012. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol 19:455–477. doi: 10.1089/cmb.2012.0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fajardo-Lubian A, Ben Zakour NL, Agyekum A, Qi Q, Iredell JR. 2019. Host adaptation and convergent evolution increases antibiotic resistance without loss of virulence in a major human pathogen. PLoS Pathog 15:e1007218. doi: 10.1371/journal.ppat.1007218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Landman D, Bratu S, Quale J. 2009. Contribution of OmpK36 to carbapenem susceptibility in KPC-producing Klebsiella pneumoniae. J Med Microbiol 58:1303–1308. doi: 10.1099/jmm.0.012575-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hamzaoui Z, Ocampo-Sosa A, Fernandez Martinez M, Landolsi S, Ferjani S, Maamar E, Saidani M, Slim A, Martinez-Martinez L, Boutiba-Ben Boubaker I. 2018. Role of association of OmpK35 and OmpK36 alteration and blaESBL and/or blaAmpC genes in conferring carbapenem resistance among non-carbapenemase-producing Klebsiella pneumoniae. Int J Antimicrob Agents 52:898–905. doi: 10.1016/j.ijantimicag.2018.03.020. [DOI] [PubMed] [Google Scholar]
  • 15.Domenech-Sanchez A, Martinez-Martinez L, Hernandez-Alles S, del Carmen Conejo M, Pascual A, Tomas JM, Alberti S, Benedi VJ. 2003. Role of Klebsiella pneumoniae OmpK35 porin in antimicrobial resistance. Antimicrob Agents Chemother 47:3332–3335. doi: 10.1128/AAC.47.10.3332-3335.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Fang Q, Feng Y, McNally A, Zong Z. 2022. Characterization of phage resistance and phages capable of intestinal decolonization of carbapenem-resistant Klebsiella pneumoniae in mice. Commun Biol 5:48. doi: 10.1038/s42003-022-03001-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Abedon ST, Katsaounis TI. 2018. Basic phage mathematics. Methods Mol Biol 1681:3–30. doi: 10.1007/978-1-4939-7343-9_1. [DOI] [PubMed] [Google Scholar]
  • 18.Seemann T. 2014. Prokka: rapid prokaryotic genome annotation. Bioinformatics 30:2068–2069. doi: 10.1093/bioinformatics/btu153. [DOI] [PubMed] [Google Scholar]
  • 19.Dereeper A, Guignon V, Blanc G, Audic S, Buffet S, Chevenet F, Dufayard JF, Guindon S, Lefort V, Lescot M, Claverie JM, Gascuel O. 2008. Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res 36:W465–W469. doi: 10.1093/nar/gkn180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Adriaenssens EM, Sullivan MB, Knezevic P, van Zyl LJ, Sarkar BL, Dutilh BE, Alfenas-Zerbini P, Łobocka M, Tong Y, Brister JR, Moreno Switt AI, Klumpp J, Aziz RK, Barylski J, Uchiyama J, Edwards RA, Kropinski AM, Petty NK, Clokie MRJ, Kushkina AI, Morozova VV, Duffy S, Gillis A, Rumnieks J, Kurtböke İ, Chanishvili N, Goodridge L, Wittmann J, Lavigne R, Jang HB, Prangishvili D, Enault F, Turner D, Poranen MM, Oksanen HM, Krupovic M. 2020. Taxonomy of prokaryotic viruses: 2018–2019 update from the ICTV Bacterial and Archaeal Viruses Subcommittee. Arch Virol 165:1253–1260. doi: 10.1007/s00705-020-04577-8. [DOI] [PubMed] [Google Scholar]
  • 21.Page AJ, Cummins CA, Hunt M, Wong VK, Reuter S, Holden MT, Fookes M, Falush D, Keane JA, Parkhill J. 2015. Roary: rapid large-scale prokaryote pan genome analysis. Bioinformatics 31:3691–3693. doi: 10.1093/bioinformatics/btv421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Tan D, Zhang Y, Qin J, Le S, Gu J, Chen L-k, Guo X, Zhu T. 2020. A Frameshift Mutation in wcaJ Associated with Phage Resistance in Klebsiella pneumoniae. Microorganisms 8:378. doi: 10.3390/microorganisms8030378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Cai R, Wang G, Le S, Wu M, Cheng M, Guo Z, Ji Y, Xi H, Zhao C, Wang X, Xue Y, Wang Z, Zhang H, Fu Y, Sun C, Feng X, Lei L, Yang Y, Ur Rahman S, Liu X, Han W, Gu J. 2019. Three capsular polysaccharide synthesis-related glucosyltransferases, GT-1, GT-2 and WcaJ, are associated with virulence and phage sensitivity of Klebsiella pneumoniae. Front Microbiol 10:1189. doi: 10.3389/fmicb.2019.01189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wick RR, Judd LM, Gorrie CL, Holt KE. 2017. Unicycler: resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput Biol 13:e1005595. doi: 10.1371/journal.pcbi.1005595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Majkowska-Skrobek G, Markwitz P, Sosnowska E, Lood C, Lavigne R, Drulis-Kawa Z. 2021. The evolutionary trade-offs in phage-resistant Klebsiella pneumoniae entail cross-phage sensitization and loss of multidrug resistance. Environ Microbiol 23:7723–7740. doi: 10.1111/1462-2920.15476. [DOI] [PubMed] [Google Scholar]
  • 26.Hesse S, Rajaure M, Wall E, Johnson J, Bliskovsky V, Gottesman S, Adhya S. 2020. Phage Resistance in Multidrug-Resistant Klebsiella pneumoniae ST258 Evolves via Diverse Mutations That Culminate in Impaired Adsorption. mBio 11:14. doi: 10.1128/mBio.02530-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Henrici De Angelis L, Poerio N, Di Pilato V, De Santis F, Antonelli A, Thaller MC, Fraziano M, Rossolini GM, D’Andrea MM. 2021. Phage resistance is associated with decreased virulence in KPC-producing Klebsiella pneumoniae of the clonal group 258 clade II lineage. Microorganisms 9:762. doi: 10.3390/microorganisms9040762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Hao GJ, Shu RD, Ding LQ, Chen X, Miao YH, Wu JQ, Zhou HJ, Wang H. 2021. Bacteriophage SRD2021 recognizing capsular polysaccharide shows therapeutic potential in serotype K47 Klebsiella pneumoniae infections. Antibiotics-Basel 10:894. doi: 10.3390/antibiotics10080894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Song LJ, Yang XG, Huang JW, Zhu XK, Han GH, Wan Y, Xu Y, Luan GX, Jia X. 2021. Phage selective pressure reduces virulence of hypervirulent Klebsiella pneumoniae Through Mutation of the wzc. Gene Front Microbiol 12:11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Soundararajan M, von Bunau R, Oelschlaeger TA. 2019. K5 capsule and lipopolysaccharide are important in resistance to T4 phage attack in probiotic E. coli strain Nissle 1917. Front Microbiol 10:2783. doi: 10.3389/fmicb.2019.02783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Gordillo Altamirano F, Forsyth JH, Patwa R, Kostoulias X, Trim M, Subedi D, Archer SK, Morris FC, Oliveira C, Kielty L, Korneev D, O'Bryan MK, Lithgow TJ, Peleg AY, Barr JJ. 2021. Bacteriophage-resistant Acinetobacter baumannii are resensitized to antimicrobials. Nat Microbiol 6:157–161. doi: 10.1038/s41564-020-00830-7. [DOI] [PubMed] [Google Scholar]
  • 32.Santos-Lopez A, Rodriguez-Beltran J, San Millan A. 2021. The bacterial capsule is a gatekeeper for mobile DNA. PLoS Biol 19:e3001308. doi: 10.1371/journal.pbio.3001308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Styles KM, Locke RK, Cowley LA, Brown AT, Sagona AP. 2022. Transposable element insertions into the Escherichia coli polysialic acid gene cluster result in resistance to the K1F bacteriophage. Microbiol Spectr 10:e0211221. doi: 10.1128/spectrum.02112-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.CLSI. 2022. Performance Standards for Antimicrobial Susceptibility Testing; 32nd Informational Supplement. M100-S32. Clinical and Laboratory Standards Institute, Wayne, PA, USA. [Google Scholar]
  • 35.Cortes G, Borrell N, de Astorza B, Gomez C, Sauleda J, Alberti S. 2002. Molecular analysis of the contribution of the capsular polysaccharide and the lipopolysaccharide O side chain to the virulence of Klebsiella pneumoniae in a murine model of pneumonia. Infect Immun 70:2583–2590. doi: 10.1128/IAI.70.5.2583-2590.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Mostafavi SKS, Najar-Peerayeh S, Mobarez AM, Parizi MK. 2019. Characterization of uropathogenic E. coli O25b-B2-ST131, O15:K52:H1, and CGA: neutrophils apoptosis, serum bactericidal assay, biofilm formation, and virulence typing. J Cell Physiol 234:18272–18282. doi: 10.1002/jcp.28459. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

FIG S1

The frameshift mutation of ompK35 in strain 135077. The ompK35 gene of strain 135077 was identified using Kleborate v2.0.0 (https://github.com/katholt/Kleborate). The complete ompK35 of the reference WP_151502934.1 contains AA at position 85 and 86. In contrast, 135077 contains only one A at the positions with missing another A (shown by *). The frameshift mutation due to the deletion results in translating new amino acids of OmpK35 afterward. Download FIG S1, PDF file, 0.4 MB (416.7KB, pdf) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

TABLE S1

The host range of phage 150004. Download Table S1, DOCX file, 0.02 MB (19KB, docx) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S2

Characteristics of phage 150004. (A) Absorption rate of phage 150004. (B) Thermal stability of phage 150004. (C) pH stability of phage 150004. Download FIG S2, TIF file, 2.9 MB (2.9MB, tif) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S3

TEM morphology of phage 150004. Scale bar, 100 nm. Download FIG S3, TIF file, 2.0 MB (2MB, tif) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S4

Phylogenetic tree of phage 150004 and those of the Przondovirus genus. The tree was inferred using the one‐click mode of Phylogeny (www.phylogeny.fr). Phage 150004 is highlighted in blue. Download FIG S4, PDF file, 0.2 MB (172.1KB, pdf) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

TABLE S2

The complete genome and antimicrobial resistance genes of strains 135077 and PR1. Download Table S2, DOCX file, 0.02 MB (19.7KB, docx) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S5

Self-designed primers for the two overlapped PCR. The locations of the primers are shown. The two PCR are using 1-IF (TGGAATTGTTGCAGATTGGC)/1-IR (CCTGAAGCTGGGCAAAGTA) and 2-IF (GTCCGGATCATTTCGTCC)/2-IR (CACTGCCATCACCTATAACAATC), respectively. wbaZ was interrupted by the IS903-formed composite transposon. Download FIG S5, PDF file, 0.07 MB (68.6KB, pdf) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S6

Some biological differences between the parental strain and phage-resistant mutants. (A) Growth curve of parental strain 135077 and phage-resistant mutants PR1 and PR2. (B) Bacterial serum resistance assay of parental strain 135077 and phage-resistant mutants PR1 and PR2. Download FIG S6, TIF file, 1.9 MB (1.9MB, tif) .

Copyright © 2022 Yin et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

Articles from mSphere are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES