Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2022 Nov 29;60(12):e01080-22. doi: 10.1128/jcm.01080-22

A Nationwide Plasmidome Surveillance in Thailand Reveals a Limited Variety of New Delhi Metallo-β-Lactamase-Producing Carbapenem-Resistant Enterobacteriaceae Clones and Spreading Plasmids

Ryuichiro Abe a,b, Yukihiro Akeda a,c,d,✉, Noriko Sakamoto a,e, Dan Takeuchi a, Yo Sugawara a,e, Norihisa Yamamoto d, Anusak Kerdsin f, Yuki Matsumoto g, Daisuke Motooka g, Warawut Laolerd h, Pitak Santanirand h, Masato Suzuki e, Keigo Shibayama i, Kazunori Tomono d, Tetsuya Iida a,b,g,j, Shigeyuki Hamada a
Editor: Alexander Mellmannk
PMCID: PMC9769800  PMID: 36445367

ABSTRACT

Despite frequent identification of plasmids carrying carbapenemase genes, the transfer of plasmids carrying carbapenemase genes is not well recognized in clinical settings because of technical limitations. To investigate the detailed mechanisms of the spread of carbapenem-resistant Enterobacteriaceae (CRE), we performed multifaceted genomic surveillance of CRE isolates in Thailand and analyzed their plasmidome. We analyzed 371 Enterobacteriaceae isolates carrying blaNDM-1 and 114 Enterobacteriaceae isolates carrying blaNDM-5 obtained from clinical samples of 473 patients in 11 representative hospitals located in six provinces in Thailand between 2012 and 2017. The complete structures of plasmids carrying blaNDM and chromosomal phylogeny were determined by combining Southern blotting hybridization analysis and our previously performed whole-genome short-read sequencing data. Dissemination of the blaNDM-5 gene among the Enterobacteriaceae isolates in Thailand was mainly owing to the nationwide clonal spread of Escherichia coli ST410 and regional clonal spreads of Escherichia coli ST361 and ST405. Analysis of blaNDM-1-carrying isolates revealed nationwide dissemination of two specific plasmids and nationwide clonal dissemination of Klebsiella pneumoniae ST16 accompanied with regional disseminations of three distinctive K. pneumoniae clones (ST231, ST14, and ST147) with different plasmids. Dissemination of CRE carrying blaNDM in Thailand is mainly based on nationwide clonal expansions of E. coli ST410 carrying blaNDM-5 and K. pneumoniae ST16 carrying blaNDM-1, nationwide dissemination of two distinctive plasmids carrying blaNDM-1, and accumulation of clonal expansions in regional areas. Although the overuse of antibiotics can promote CRE dissemination, the limited variety of transmitters highlights the importance of preventing horizontal dissemination among patients.

KEYWORDS: carbapenemase, plasmidome, plasmid analysis, NDM, carbapenemase-producing Enterobacterales, carbapenem-resistant Enterobacterales, nationwide study

INTRODUCTION

The global dissemination of multidrug-resistant (MDR) Enterobacteriaceae threatens health care systems worldwide (1). Among MDR Enterobacteriaceae, carbapenem-resistant Enterobacteriaceae (CRE) are an urgent antibiotic resistant threat because alternative treatment options, even for common bacterial infections, are limited. Carbapenem resistance is primarily conferred by carbapenemases, which hydrolyze carbapenems (2, 3). Klebsiella pneumoniae carbapenemases (KPCs), oxacillin-hydrolyzing (OXA)-48 carbapenemases, and New Delhi metallo-β-lactamases (NDMs) are the most commonly detected carbapenemases (3). In particular, NDMs have disseminated globally since the first NDM was identified in 2008 in a Swedish patient hospitalized in New Delhi, India (4, 5). Geographically close to India, Southeast Asia is an area of endemicity of NDM-producing Enterobacteriaceae (6–10). Notably, Thailand is one of the most popular tourist destinations worldwide, and antibiotics there are sold without prescription, which likely contributed to the inappropriate use of antibiotics and dissemination of MDR Enterobacteriaceae isolates. However, CREs in Thailand have been insufficiently studied to date (11, 12).

Carbapenemase genes are generally located on plasmids, which are frequently transmitted across species (13), and numerous studies have reported the plasmid-mediated transmission of blaNDM (5, 6, 10, 13–15). Thus, genetic tracking of plasmids carrying carbapenemase genes is useful for monitoring the spread of CRE isolates. However, while various large-scale studies have compared whole genomes of CRE isolates (16–19), few studies have conducted nationwide plasmidome analyses of CRE isolates carrying blaNDM. Currently, it is difficult to obtain complete plasmid sequences through short-read sequencing alone, and the cost of long-read sequencing is exorbitant for large-scale analysis of isolates. Therefore, large-scale plasmidome surveillance studies have only compared contigs encoding carbapenemases or mapped short-read sequences to a reference plasmid without analyzing plasmid sizes (19–21) and thus may have overlooked the existence of reorganizations, such as integration of plasmids or replication of certain regions (15). We previously integrated chromosomal phylogenetic analysis and plasmidome analysis using a combination of short- and long-read sequencing with Southern blotting hybridization to determine plasmid sizes, revealing the clonal dissemination of a plasmid encoding carbapenemase among chromosomally distinct CRE isolates in Osaka, Japan (22).

Our nationwide clinical CRE surveillance study enrolling 11 representative hospitals from 6 provinces in Thailand identified 747 carbapenemase-producing CRE isolates, including 493 NDM-producing CRE isolates (23). Here, we focused on the analysis of complete structures of the plasmids carrying blaNDM-1 or blaNDM-5 to unveil the mechanisms underlying the nationwide dissemination of NDM-producing CRE isolates in Thailand.

MATERIALS AND METHODS

CRE isolates producing NDM carbapenemases.

In our previous CRE surveillance enrolling 11 representative hospitals from 6 provinces in Thailand (23), various clinical specimens, including blood, sputum, urine, abdominal fluid, and stool, were collected between 2012 and 2017 (Fig. S1). We identified 747 carbapenemase-producing CRE isolates, including 493 NDM-producing CRE isolates (Fig. 1). Of the 493 NDM-producing CRE isolates, we identified 371 isolates carrying blaNDM-1 (44 Escherichia coli and 325 K. pneumoniae) and 114 isolates carrying blaNDM-5 (109 E. coli and 5 K. pneumoniae) obtained from 473 patients, excluding 1 isolate carrying blaNDM-3, 1 isolate carrying blaNDM-7, 1 isolate carrying blaNDM-9, and 5 isolates carrying blaNDM-4.

FIG 1.

FIG 1

Profile of carbapenem-resistant Enterobacteriaceae (CRE) isolates carrying blaNDM for analysis.

Southern blotting.

All isolates were subjected to Southern blotting probing blaNDM-1 following nuclease S1-digested pulsed-field gel electrophoresis to determine the sizes of the plasmids encoding NDM, as previously reported (22). The blaNDM-1 probe was prepared through PCR using the following primer set: NDM-F, atggaattgcccaatattatgcacccggtc; and NDM-R, tcagcgcagcttgtcggccatgcgggccgt. Plasmid sizes were determined using the BioNumerics software (version 7.5; Applied Maths NV, Sint-Martens-Latem, Belgium). Based on their sizes, plasmids carrying blaNDM-1 were classified into the following five groups: group NDM1-S, <50 kbp; group NDM1-M, 50 to 100 kbp; group NDM1-L, 100 to 150 kbp; group NDM1-LL, 150 to 200 kbp; and group NDM1-XL, >200 kbp. Plasmids carrying blaNDM-5 were classified into the following four groups: group NDM5-S, <50 kbp; group NDM5-M, 50 to 100 kbp; group NDM5-L, 100 to 130 kbp; and group NDM5-LL, >130 kbp.

Whole-genome sequencing (WGS) and plasmid analysis.

We used our whole-genome sequenced data obtained through the Illumina HiSeq 3000 (Illumina Corp., San Diego, CA, USA) or PacBio RSII platform (PacBio Corp., Menlo Park, CA, USA) following sequence alignments using the CLC Genomics Workbench 11.0.1 (CLC Bio, Aarhus, Denmark) (Data Set S1) (23). Phylogenetic analysis was conducted with CSI Phylogeny 1.4 (24), using Escherichia coli strain ECONIH1 (NZ_CP009859.1) and K. pneumoniae strain KPNIH1 (NZ_CP008827.1) as references. iTOL (25) was used to construct phylogenetic trees. Complete sequences of the NDM-encoding plasmids of representative isolates in each plasmid-size group were determined using GridION (Oxford Nanopore Technologies, Oxford, UK) or PacBio RSII, as previously reported (22). Following the identification of antimicrobial resistance genes, genomic structures of plasmids and plasmid replicon types were compared as previously reported (22). Plasmid clonality was investigated by mapping the raw HiSeq 3000 or PacBio RSII sequence reads to the representative plasmids in the groups, using the Burrows-Wheeler Aligner (BWA) (26). Sequence coverage was calculated using SAMtools (27), with a cutoff of 90% identity and coverage.

Data availability.

WGS data are available from the DNA Data Bank of Japan under the accession numbers listed in Data Set S1.

RESULTS

Classification of plasmids and structures of representative plasmids.

In total, 371 CRE isolates carrying blaNDM-1 and 114 CRE isolates carrying blaNDM-5 obtained from our CRE surveillance in Thailand were analyzed (Fig. 1). Two K. pneumoniae isolates carried blaNDM-1 in their chromosomes (28). In total, 44 E. coli isolates and 325 K. pneumoniae isolates harbored blaNDM-1 on a plasmid, and 109 E. coli isolates and 5 K. pneumoniae isolates harbored blaNDM-5 on a plasmid. As two NDM-1-positive isolates and six NDM-5-positive isolates simultaneously harbored blaNDM on plasmids of two distinct sizes, 371 plasmids carrying blaNDM-1 from 369 isolates and 120 plasmids carrying blaNDM-5 from 114 isolates were analyzed.

According to their sizes, plasmids carrying blaNDM-1 and those carrying blaNDM-5 were classified into five and four groups, respectively (Fig. 2). Complete sequences of representative blaNDM-carrying plasmids in each group were determined using GridION and Illumina HiSeq 3000 (Table 1). Representative plasmids carrying blaNDM-1 and blaNDM-5 showed low similarity, except for pC435_NDM1 and pC069_NDM1 (coverage, 65%; identity, 99.97%; query, pC069_NDM1) and pC405_NDM5 and pC016_NDM5 (coverage, 100%; identity, 99.98%; query, pC016_NDM5) (Fig. 3). The difference in plasmid size between pC405_NDM5 and pC016_NDM5 was attributed to the replication of a cassette carrying blaNDM-5 in pC016_NDM5. Despite the diversity of blaNDM-1-carrying cassettes, a transposon carrying blaNDM-5 was preserved on different plasmid backbones, except for endemic IncX3 plasmids carrying blaNDM-5 (pNDM_Z224) (29). The structure of this cassette was similar to those of cassettes reported worldwide (30). Interestingly, all plasmids carrying blaNDM-1 and blaNDM-5 harbored bleMBL (encoding bleomycin resistance) and trpF (encoding a phosphoribosylanthranilate isomerase) upstream of the blaNDM genes.

FIG 2.

FIG 2

Sizes of plasmids harboring genes encoding New Delhi metallo-β-lactamase-1 (NDM-1) and NDM-5. The sizes of plasmids carrying blaNDM were determined through Southern blotting probing blaNDM following S1-digested pulsed-field gel electrophoresis. Based on their sizes, plasmids carrying blaNDM-1 were classified into five groups (A), and plasmids carrying blaNDM-5 were classified into four groups (B).

TABLE 1.

Replicon types of representative plasmids

Plasmid groups Plasmid Size (bp) Replicon type Accession no.
Group NDM1-S pC099_NDM1 44,859 N2 LC613145
pC435_NDM1 54,064 FIB(pQil) LC521845
Group NDM1-M pC069_NDM1 100,591 FIB(pQil), R LC613144
Group NDM1-L pKP164_NDM1 116,295 FIA, FIB(AP001918) LC521851
Group NDM1-LL pKP46_NDM1 173,173 FIB(pQil), FII(K) LC613146
pC055_NDM1 172,648 C LC613143
pC045_NDM1 175,820 FIB(pQil), FII(K) LC521834
Group NDM1-XL pKP100_NDM1 296,678 FIB(pNDM-Mar), HI1B(pNDM-Mar) LC521849
pKP17_NDM1 319,887 C, FII(K) LC521852
Group NDM5-S pNDM-Z244 46,047 X3 NZ_MK450346.1
Group NDM5-M pC053_NDM5 102,023 FII LC521836
pC405_NDM5 108,173 FIA, FII(pAMA1167-NDM-5) LC521844
Group NDM5-L pC016_NDM5 118,761 FIA, FIB(AP001918), FII(pAMA1167-NDM-5) LC613142
Group NDM5-LL pC281_NDM5 156,037 FIA, FII(pRSB107) LC521842

FIG 3.

FIG 3

Comparison of representative plasmids in each group. (A) Comparison of plasmids carrying blaNDM-1. Plasmids carrying blaNDM-1 were distinct from each other; only two plasmids, pC435_NDM1 and pC069_NDM1, showed high similarity. pC069_NDM1 was larger than pC435_NDM1 owing to the acquisition of a region carrying additional antimicrobial resistance genes. The region carrying trpF, bleMBL, and blaNDM-1 was common among all plasmids and is enlarged at the bottom of the cartoon. Block arrows indicate confirmed or putative open reading frames (ORFs) and their orientations. The arrow size is proportional to the predicted ORF length. Red, carbapenem resistance gene; yellow, other antimicrobial resistance gene; light blue, conjugative transfer gene; blue, mobile element. Putative, hypothetical, or unknown genes are represented by gray arrows. Dark gray-shaded areas indicate regions with high identity between the two sequences. (B) Comparison of plasmids carrying blaNDM-5. Plasmids harboring blaNDM-5 carried the same segment carrying blaNDM-5 on distinctive plasmid backbones, except for pNDM-Z244. pC016_NDM5 was larger than pC405_NDM5 owing to duplication of the segment carrying blaNDM-5, despite their high similarity.

Clonality of blaNDM-1- and blaNDM-5-carrying plasmids.

All isolates were subjected to WGS using Illumina HiSeq 3000 or PacBio RS II. Plasmid clonality in each group was investigated by mapping the sequence reads to the representative plasmids (Table S1). WGS combined with Southern blotting hybridization results confirmed that most plasmids were highly clonal with the reference plasmids in each group, whereas only a small population showed low (<90%) similarity with the representative plasmids. Compared with blaNDM-1-carrying plasmids, blaNDM-5-carrying plasmids of 100 to 150 kbp could not be clearly separated based on size alone (Fig. 2). Plasmids of approximately 100 kbp included pC405_NDM5 and pC016_NDM5, which were clonal except for a duplicated region, and plasmids of approximately 130 kbp were classified as either pC016_NDM5 or pC281_NDM5 according to WGS results (Table S2). Considering the similarity of pC405_NDM5 and pC016_NDM5, only six and three distinctive plasmids were largely responsible for the transmission of blaNDM-1 and blaNDM-5, respectively, although the CPE isolates carrying blaNDM were obtained throughout Thailand (Table S1).

Phylogenetic analysis of CRE isolates disseminating blaNDM-carrying plasmids.

Phylogenetic analysis of K. pneumoniae isolates carrying blaNDM-1 revealed a clonal dissemination of four clades: the ST16 clade carrying pKP164_NDM1 (113 isolates), the ST231 clade carrying pKP46_NDM1 (21 isolates), the ST14 clade carrying pKP100_NDM1 (14 isolates), and the ST147 clade carrying pC069_NDM1 (39 isolates), with high similarity within each ST clade (Fig. 4). Single-nucleotide polymorphism (SNP) differences in each ST are shown in Data Set S2 and Tables S3 and S4. Each clone had disseminated without conjugation of plasmids carrying blaNDM-1 beyond the clades. Of the 113 K. pneumoniae ST16 isolates carrying pKP164_NDM1, 103 simultaneously possessed blaOXA-232, and these isolates were disseminated nationwide as we previously reported (31), whereas isolates in other clades were clonally disseminated only in specific regions. Meanwhile, pC099_NDM1 and pC055_NDM1 were spread among chromosomally distinct isolates of E. coli and K. pneumoniae throughout Thailand, indicating a broad dissemination of these specific plasmids (Fig. 4).

FIG 4.

FIG 4

Chromosomal phylogeny and plasmidome analysis of the isolates disseminating plasmids carrying blaNDM-1. (A to E) Chromosomal phylogenies of K. pneumoniae isolates carrying blaNDM-1 on a plasmid in group NDM1-S (A), group NDM1-L (B), group NDM1-M (C), group NDM1-LL (D), and group NDM1-XL (E) are shown. (F) Chromosomal phylogeny of E. coli isolates carrying blaNDM-1 is shown. Color codes are presented in the figure. The carriage of multiple plasmids carrying blaNDM-1 in one isolate is indicated as multiple colors in the plasmidome. pC099_NDM1 and pC055NDM1 are disseminated beyond the species nationwide. K. pneumoniae ST16 disseminated nationwide and maintained pKP164_NDM1, and K. pneumoniae ST147 and ST14 disseminated regionally and maintained pC069_NDM1 and pKP100_NDM1, respectively.

All E. coli isolates carrying blaNDM-5 were subjected to SNP analysis. Phylogenetic analysis of E. coli isolates carrying blaNDM-5 revealed a clonal dissemination of three ST clades: ST405, ST361, and ST410 (Fig. 5A). E. coli isolates in the ST405 clade carried pC281_NDM5 (13 isolates), the ST361 clade carried pC053_NDM5 (11 isolates), and the ST410 clade carried pC016_NDM5 or pC405_NDM5 (63 isolates) (Table 1). Isolates within the same ST clade were closely related, with differences of <58 SNPs, except for three isolates (C431w, EC08, and EC09) that carry different plasmids from the rest of the isolates in each clade. We identified five K. pneumoniae isolates carrying blaNDM-5 (ST11, ST16, ST48, and ST1089), with one isolate carrying pC053_NDM5 (ST1089) and three isolates carrying the worldwide reported IncX3 plasmid pNDM-Z244 (ST11 and ST48) (Fig. 5B) (14, 29, 32). These isolates disseminated mainly in the northeast region of Thailand.

FIG 5.

FIG 5

Chromosomal phylogeny and plasmidome analysis of the isolates carrying blaNDM-5. Chromosomal phylogenies of E. coli (A) and K. pneumoniae (B) isolates carrying blaNDM-5 are shown. Samples are color-coded according to the prefectures where they were collected (refer to Fig. 1). The plasmidome was analyzed by mapping the sequence reads using representative plasmids in each plasmid-size group as reference plasmids. Color codes are presented in the figure, and the carriage of multiple plasmids harboring blaNDM-5 in an isolate is indicated as multiple colors in the plasmidome.

DISCUSSION

Our data revealed an unexpectedly limited variety among the nationwide disseminated clones and plasmids. Interestingly, blaNDM-5 was disseminated through nationwide clonal expansion of E. coli ST410 and regional clonal expansion of E. coli ST361 and ST405 in the northeast region of Thailand (Fig. 5A). E. coli ST410 spread clonally nationwide and represented the largest proportion of the NDM-5 producers in Thailand. Importantly, all blaNDM-5 genes were identified on plasmids, and isolates in each ST clade harbored the nearly identical plasmids. E. coli isolates of these three ST types did not exchange plasmids beyond their clade, implying that they are independent of each other. As these ST types have been reported as NDM-5 producers worldwide (33–35), appropriate monitoring of these clones and deeper genomic analysis should be conducted in the future. Globally spread IncX3 plasmids (46 kbp) (14, 29, 32, 36) were identified in both E. coli and K. pneumoniae isolates, indicating plasmid dissemination; however, their proportion among transmitters of blaNDM-5 in Thailand was very small. NDM-1-positive K. pneumoniae of ST231, ST14, and ST147 were detected regionally in the northeast region of Thailand and Bangkok. In addition to the chromosomal clonality within each clade, plasmid clonality within the clades was high, as was the clonality of E. coli isolates carrying blaNDM-5. Despite the relatively broad clonal dissemination of these isolates, chromosomally encoded NDM-1 was identified in two K. pneumoniae ST14 isolates, only without broad dissemination (28). Moreover, 103 K. pneumoniae ST16 isolates carrying blaNDM-1 were also disseminated clonally but broadly in Thailand. Dissemination of K. pneumoniae ST16 carrying carbapenemase genes has been recently reported globally, stressing the importance of appropriate monitoring (37, 38). In contrast to all other detected blaNDM-1-carrying plasmids, pC099_NDM1 and pC055_NDM1 were disseminated nationwide, beyond ST clades and across species. Except for clonal dissemination of K. pneumoniae ST16, plasmid dissemination might be more powerful to broaden the territory than clonal dissemination. Consistent with reports from other countries, NDM-1 producers are more widely populated than NDM-5 producers to date (32, 36). This may be partially attributed to the emergence of highly transmissible plasmids carrying blaNDM-1, although the influx of transmissible plasmids carrying blaNDM-5, such as IncX3 plasmids from abroad, may change the situation in the future. Compared to other clonal expansions, E. coli ST410 carrying blaNDM-5 and K. pneumoniae ST16 carrying blaNDM-1 accounted for a large proportion of NDM producers broadly in Thailand. Therefore, the expansions of these clones may have occurred earlier than the other clonal expansions, or these strains may have potential to spread more rapidly than other clones. Along with these clonal spreads, extensive spreads of specific plasmids were observed.

By integrating phylogenetic chromosomal analysis and multifaceted plasmidome analysis, we demonstrated an unexpected high level of clonality among NDM-producing CRE isolates nationwide. We identified the dissemination of specific plasmids carrying blaNDM-1, although most CRE isolates carrying blaNDM disseminated clonally. The genomic structures of plasmids and chromosomes were distinct among the ST clades, indicating multiple independent outbreaks, although the origin of each clone was unknown. These findings imply that Thailand is in a rapidly ongoing stage of CRE dissemination. The use of antibiotics, including carbapenems, may promote colonization by CRE isolates through microbial substitutions or enhancement of carbapenem resistance through porin mutations (39). However, the high clonality of NDM-producing CRE isolates spreading nationwide highlights the importance of standard precautions to prevent patient-to-patient CRE dissemination. Siranosian et al. demonstrated that appropriate infection control measures successfully prevent sharing of gut microbiomes among patients undergoing hematopoietic cell transplantation (40). The limited genomic variety might be attributed to selection bias as the samples were not colonizing but clinically infecting isolates. Therefore, the study samples might have been selected as highly virulent CREs from larger CRE populations. Alternatively, clinically infecting CREs might have been transmitted directly, without swarming of colonizing Enterobacteriaceae in the host as a hotbed of plasmid conjugation (41). Relationships between the clinical dissemination and virulence of CRE isolates remain to be further analyzed.

Nationwide plasmidome analysis demonstrated that the dissemination of CRE carrying blaNDM in Thailand is mainly based on nationwide clonal expansions of E. coli ST410 clone carrying blaNDM-5 and K. pneumoniae ST16 clone carrying blaNDM-1, as well as on nationwide dissemination of two distinctive plasmids carrying blaNDM-1, accompanied with the accumulation of clonal expansions in regional areas. Unexpectedly limited variety of clones and plasmids disseminating carbapenem resistance suggested the importance of preventing patient-to-patient CRE dissemination. In addition to discouraging the overuse of antibiotics, we need to reframe countermeasures against the horizontal transfer of antimicrobial resistance.

ACKNOWLEDGMENTS

We thank the staff of all collaborating centers for sample collection.

We declare no conflict of interest.

This work was supported by the Japan Agency for Medical Research and Development (AMED). The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Footnotes

Supplemental material is available online only.

Supplemental file 1
Fig. S1 and Tables S1 to S4. Download jcm.01080-22-s0001.pdf, PDF file, 1.0 MB (1MB, pdf)
Supplemental file 2
Data Set S1. Download jcm.01080-22-s0002.xlsx, XLSX file, 0.04 MB (36.9KB, xlsx)
Supplemental file 3
Data Set S2. Download jcm.01080-22-s0003.xlsx, XLSX file, 0.06 MB (63.1KB, xlsx)

Contributor Information

Yukihiro Akeda, Email: akeda@biken.osaka-u.ac.jp.

Alexander Mellmann, University Hospital Münster.

REFERENCES

  • 1.World Health Organization. 2014. Antimicrobial resistance global report on surveillance. World Health Organization, Geneva, Switzerland. [Google Scholar]
  • 2.David S, Reuter S, Harris SR, Glasner C, Feltwell T, Argimon S, Abudahab K, Goater R, Giani T, Errico G, Aspbury M, Sjunnebo S, Feil EJ, Rossolini GM, AAnensen DM, Grundmann H, EuSCAPE Working Group . 2019. Epidemic of carbapenem-resistant Klebsiella pneumoniae in Europe is driven by nosocomial spread. Nat Microbiol 4:1919–1929. 10.1038/s41564-019-0492-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Nordmann P, Naas T, Poirel L. 2011. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis 17:1791–1798. 10.3201/eid1710.110655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, Walsh TR. 2009. Characterization of a new metallo-beta-lactamase gene, blaNDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother 53:5046–5054. 10.1128/AAC.00774-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Johnson AP, Woodford N. 2013. Global spread of antibiotic resistance: the example of New Delhi metallo-β-lactamase (NDM)-mediated carbapenem resistance. J Med Microbiol 62:499–513. 10.1099/jmm.0.052555-0. [DOI] [PubMed] [Google Scholar]
  • 6.Sugawara Y, Akeda Y, Hagiya H, Sakamoto N, Takeuchi D, Shanmugakani RK, Motooka D, Nishi I, Zin KN, Aye MM, Myint T, Tomono K, Hamada S. 2019. Spreading patterns of NDM-producing Enterobacteriaceae in clinical and environmental settings in Yangon, Myanmar. Antimicrob Agents Chemother 63:e01924-18. 10.1128/AAC.01924-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Khong WX, Xia E, Marimuthu K, Xu W, Teo YY, Tan EL, Neo S, Krishnan PU, Ang BSP, Lye DCB, Chow ALP, Ong RTH, Ng O. 2016. Local transmission and global dissemination of New Delhi metallo-β-lactamase (NDM): a whole genome analysis. BMC Genomics 17:452. 10.1186/s12864-016-2740-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Laolerd W, Akeda Y, Preeyanon L, Ratthawongjirakul P, Santanirand P. 2018. Carbapenemase-producing carbapenem-resistant Enterobacteriaceae from Bangkok, Thailand, and their detection by the Carba NP and modified carbapenem inactivation method tests. Microb Drug Resist 24:1006–1011. 10.1089/mdr.2018.0080. [DOI] [PubMed] [Google Scholar]
  • 9.van Duin D, Doi Y. 2017. The global epidemiology of carbapenemase-producing Enterobacteriaceae. Virulence 8:460–469. 10.1080/21505594.2016.1222343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Dortet L, Poirel L, Nordmann P. 2014. Worldwide dissemination of the NDM-type carbapenemases in Gram-negative bacteria. Biomed Res Int 2014:249856. 10.1155/2014/249856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hsu LY, Apisarnthanarak A, Khan E, Suwantarat N, Ghafur A, Tambyah PA. 2017. Carbapenem-resistant Acinetobacter baumannii and Enterobacteriaceae in south and southeast Asia. Clin Microbiol Rev 30:1–22. 10.1128/CMR.masthead.30-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Suwantarat N, Carroll KC. 2016. Epidemiology and molecular characterization of multidrug-resistant Gram-negative bacteria in Southeast Asia. Antimicrob Resist Infect Control 5:15. 10.1186/s13756-016-0115-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Kopotsa K, Osei Sekyere J, Mbelle NM. 2019. Plasmid evolution in carbapenemase-producing Enterobacteriaceae: a review. Ann N Y Acad Sci 1457:61–91. 10.1111/nyas.14223. [DOI] [PubMed] [Google Scholar]
  • 14.Paskova V, Medvecky M, Skalova A, Chudejova K, Bitar I, Jakubu V, Bergerova T, Zemlickova H, Papagiannitsis CC, Hrabak J. 2018. Characterization of NDM-encoding plasmids from Enterobacteriaceae recovered from Czech hospitals. Front Microbiol 9:1549. 10.3389/fmicb.2018.01549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.David S, Cohen V, Reuter S, Sheppard AE, Giani T, Parkhill J, Rossolini GM, Feil EJ, Grundmann H, Aanensen DM, EuSCAPE Working Group . 2020. Integrated chromosomal and plasmid sequence analyses reveal diverse modes of carbapenemase gene spread among Klebsiella pneumoniae. Proc Natl Acad Sci USA 117:25043–25054. 10.1073/pnas.2003407117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Bowers JR, Kitchel B, Driebe EM, MacCannell DR, Roe C, Lemmer D, de Man T, Rasheed JK, Engelthaler DM, Keim P, Limbago BM. 2015. Genomic analysis of the emergence and rapid global dissemination of the clonal group 258 Klebsiella pneumoniae pandemic. PLoS One 10:e0133727. 10.1371/journal.pone.0133727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Osei Sekyere J, Reta MA. 2020. Genomic and resistance epidemiology of Gram-negative bacteria in Africa: a systematic review and phylogenomic analyses from a one health perspective. mSystems 5:e00897-20. 10.1128/mSystems.00897-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Sherry NL, Lane CR, Kwong JC, Schultz M, Sait M, Stevens K, Ballard S, da Silva AG, Seemann T, Gorrie CL, Stinear TP, Williamson DA, Brett J, van Diemen A, Easton M, Howden BP. 2019. Genomics for molecular epidemiology and detecting transmission of carbapenemase-producing Enterobacterales in Victoria, Australia, 2012 to 2016. J Clin Microbiol 57:e00573-19. 10.1128/JCM.00573-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Cerqueira GC, Earl AM, Ernst CM, Grad YH, Dekker JP, Feldgarden M, Chapman SB, Reis-Cunha JL, Shea TP, Young S, Zeng Q, Delaney ML, Kim D, Peterson EM, O’Brien TF, Ferraro MJ, Hooper DC, Huang SS, Kirby JE, Onderdonk AB, Birren BW, Hung DT, Cosimi LA, Wortman JR, Murphy CI, Hanage WP. 2017. Multi-institute analysis of carbapenem resistance reveals remarkable diversity, unexplained mechanisms, and limited clonal outbreaks. Proc Natl Acad Sci USA 114:1135–1140. 10.1073/pnas.1616248114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Harris PNA, Alexander MW. 2020. Beyond the core genome: tracking plasmids in outbreaks of multidrug-resistant bacteria. Clin Infect Dis 1:1–2. [DOI] [PubMed] [Google Scholar]
  • 21.Wang Y, Zhang R, Li J, Wu Z, Yin W, Schwarz S, Tyrrell JM, Zheng Y, Wang S, Shen Z, Liu Z, Liu J, Lei L, Li M, Zhang Q, Wu C, Zhang W, Wu Y, Walsh TR, Shen J. 2017. Comprehensive resistome analysis reveals the prevalence of NDM and MCR-1 in Chinese poultry production. Nat Microbiol 2:16260. 10.1038/nmicrobiol.2016.260. [DOI] [PubMed] [Google Scholar]
  • 22.Abe R, Akeda Y, Sugawara Y, Takeuchi D, Matsumoto Y, Motooka D, Yamamoto N, Kawahara R, Tomono K, Fujino Y, Hamada S. 2020. Characterization of the plasmidome encoding carbapenemase and mechanisms for dissemination of carbapenem-resistant Enterobacteriaceae. mSystems 5:e00759-20. 10.1128/mSystems.00759-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Takeuchi D, Kerdsin A, Akeda Y, Sugawara Y, Sakamoto N, Matsumoto Y, Motooka D, Ishihara T, Nishi I, Laolerd W, Santanirand P, Yamamoto N, Tomono K, Hamada S. 2022. Nationwide surveillance in Thailand revealed genotype-dependent dissemination of carbapenem-resistant Enterobacterales. Microb Genom 8:e000797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kaas RS, Leekitcharoenphon P, Aarestrup FM, Lund O. 2014. Solving the problem of comparing whole bacterial genomes across different sequencing platforms. PLoS One 9:e104984. 10.1371/journal.pone.0104984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Letunic I, Bork P. 2019. Interactive Tree Of Life (iTOL) v4: recent updates and new developments. Nucleic Acids Res 47:W256–W259. 10.1093/nar/gkz239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Li H, Durbin R. 2009. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25:1754–1760. 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, 1000 Genome Project Data Processing Subgroup . 2009. The sequence alignment/map format and SAMtools. Bioinformatics 25:2078–2079. 10.1093/bioinformatics/btp352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Sakamoto N, Akeda Y, Sugawara Y, Takeuchi D, Motooka D, Yamamoto N, Laolerd W, Santanirand P, Hamada S. 2018. Genomic characterization of carbapenemase-producing Klebsiella pneumoniae with chromosomally carried blaNDM-1. Antimicrob Agents Chemother 62:e01520-18. 10.1128/AAC.01520-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Tian D, Wang B, Zhang H, Pan F, Wang C, Shi Y, Sun Y. 2020. Dissemination of the blaNDM-5 gene via IncX3-Type plasmid among Enterobacteriaceae in children. mSphere 5:e00699-19. 10.1128/mSphere.00699-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zou H, Jia X, Liu H, Li S, Wu X, Huang S. 2020. Emergence of NDM-5-producing Escherichia coli in a teaching hospital in Chongqing, China: IncF-type plasmids may contribute to the prevalence of blaNDM-5. Front Microbiol 11:334. 10.3389/fmicb.2020.00334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Abe R, Akeda Y, Takeuchi D, Sakamoto N, Sugawara Y, Yamamoto N, Kerdsin A, Matsumoto Y, Motooka D, Leolerd W, Santanirand P, Suzuki M, Shibayama K, Tomono K, Iida T, Hamada S. 2022. Clonal dissemination of carbapenem-resistant Klebsiella pneumoniae ST16 co-producing NDM-1 and OXA-232 in Thailand. JAC Antimicrob Resist 4:dlac084. 10.1093/jacamr/dlac084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Brinkac LM, White R, D’Souza R, Nguyen K, Obaro SK, Fouts DE. 2019. Emergence of New Delhi metallo-β-lactamase (NDM-5) in Klebsiella quasipneumoniae from neonates in a Nigerian hospital. mSphere 4:e00685. 10.1128/mSphere.00685-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Barrado L, Pérez-Vázquez M, Del Pozo JL, Martín-Salas C, Leiva J, Mazón A, Ezpeleta C, Oteo J. 2018. Clonal transmission of NDM-5-producing Escherichia coli belonging to high-risk sequence type ST405. Int J Antimicrob Agents 52:123–124. 10.1016/j.ijantimicag.2018.05.018. [DOI] [PubMed] [Google Scholar]
  • 34.Kim JS, Yu JK, Jeon SJ, Park SH, Han S, Park SH, Kang M, Jang JI, Park J, Shin EK, Kim J, Hong CK, Lee JH, Hwang YO, Oh YH. 2021. Dissemination of an international high-risk clone of Escherichia coli ST410 co-producing NDM-5 and OXA-181 carbapenemases in Seoul, Republic of Korea. Int J Antimicrob Agents 58:106448. 10.1016/j.ijantimicag.2021.106448. [DOI] [PubMed] [Google Scholar]
  • 35.Tsilipounidaki K, Athanasakopoulou Z, Billinis C, Miriagou V, Petinaki E. 2022. Letter to the editor: importation of the first bovine ST361 New Delhi metallo-5 positive Escherichia coli in Greece. Microb Drug Resist 28:386–387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Tang B, Chang J, Cao L, Luo Q, Xu H, Lyu W, Qian M, Ji X, Zhang Q, Xia X, Yang H. 2019. Characterization of an NDM-5 carbapenemase-producing Escherichia coli ST156 isolate from a poultry farm in Zhejiang, China. BMC Microbiol 19:82. 10.1186/s12866-019-1454-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Andrey DO, Pereira Dantas P, Martins WBS, Marques De Carvalho F, Almeida LGP, Sands K, Portal E, Sauser J, Cayô R, Nicolas MF, Vasconcelos ATR, Medeiros EA, Walsh TR, Gales AC. 2020. An emerging clone, Klebsiella pneumoniae carbapenemase 2-producing K. pneumoniae sequence Type 16, associated with high mortality rates in a CC258-endemic setting. Clin Infect Dis 71:e141–e150. 10.1093/cid/ciz1095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Espinal P, Nucleo E, Caltagirone M, Mattioni Marchetti V, Fernandes MR, Biscaro V, Rigoli R, Carattoli A, Migliavacca R, Villa L. 2019. Genomics of Klebsiella pneumoniae ST16 producing NDM-1, CTX-M-15, and OXA-232. Clin Microbiol Infect 25:385.e1–385.e5. 10.1016/j.cmi.2018.11.004. [DOI] [PubMed] [Google Scholar]
  • 39.Nikaido H. 2003. Molecular basis of bacterial outer membrane permeability revisited. Microbiol Mol Biol Rev 67:593–656. 10.1128/MMBR.67.4.593-656.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Siranosian BA, Brooks EF, Andermann T, Rezvani AR, Banaei N, Tang H, Bhatt AS. 2022. Rare transmission of commensal and pathogenic bacteria in the gut microbiome of hospitalized adults. Nat Commun 13:586. 10.1038/s41467-022-28048-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Qiao F, Wei L, Feng Y, Ran S, Zheng L, Zhang Y, Xiang W, Liu Y, Wu X, Duan X, Zhang W, Li Q, Guo H, Huang W, Zhu S, Wen H, Zong Z. 2020. Handwashing sink contamination and carbapenem-resistant Klebsiella infection in the intensive care unit: a prospective multicenter study. Clin Infect Dis 71:S379–S385. 10.1093/cid/ciaa1515. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

Fig. S1 and Tables S1 to S4. Download jcm.01080-22-s0001.pdf, PDF file, 1.0 MB (1MB, pdf)

Supplemental file 2

Data Set S1. Download jcm.01080-22-s0002.xlsx, XLSX file, 0.04 MB (36.9KB, xlsx)

Supplemental file 3

Data Set S2. Download jcm.01080-22-s0003.xlsx, XLSX file, 0.06 MB (63.1KB, xlsx)

Data Availability Statement

WGS data are available from the DNA Data Bank of Japan under the accession numbers listed in Data Set S1.


Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES