Abstract
Regulatory T cells (Tregs) in non-lymphoid organs provide critical brakes on inflammation and regulate tissue homeostasis. While so-called “tissue-Tregs” are phenotypically and functionally diverse, serving to optimize their performance and survival, upregulation of pathways related to circadian rhythms is a feature they share. Yet, the diurnal regulation of Tregs and its consequences are controversial and poorly understood. Here, we profiled diurnal variations in visceral-adipose tissue (VAT) and splenic Tregs in the presence and absence of core-clock genes. VAT, but not splenic, Tregs upregulated their cell-intrinsic circadian program, and exhibited diurnal variations in their activation and metabolic state. BMAL1 deficiency specifically in Tregs led to constitutive activation and poor oxidative metabolism in VAT, but not splenic, Tregs. Disruption of core-clock components resulted in loss of fitness: BMAL1-deficient VAT Tregs were preferentially lost during competitive transfers and in heterozygous BMAL1-deficient females. After 16 weeks of high-fat-diet feeding, VAT inflammation was increased in mice harboring BMAL1-deficient Tregs, and the remaining cells lost the transcriptomic signature of bona fide VAT Tregs. Unexpectedly, VAT Tregs suppressed adipocyte lipolysis, and BMAL1 deficiency specifically in Tregs abrogated the characteristic diurnal variation in adipose-tissue lipolysis, resulting in enhanced suppression of lipolysis throughout the day. These findings argue for the importance of the cell-intrinsic clock program in optimizing VAT Treg function and fitness.
ONE-SENTENCE SUMMARY:
Visceraladipose tissue Tregs turn up cell-intrinsic circadian rhythms to promote cellular fitness and regulate diurnal lipolysis
INTRODUCTION
Regulatory T cells (Tregs), particularly those expressing the transcription factor (TF) Foxp3, play an essential role in restraining overexuberant immune responses. Although early studies focused on Tregs circulating through lymphoid organs, it is by now well established that Tregs are located in non-lymphoid tissues as well. These so-called “tissue Tregs” have unique transcriptomes, T cell receptor (TCR) repertoires and growth/survival-factor dependencies that enable them to thrive in particular tissue environments, where they help maintain homeostasis (1). Even though tissue Tregs exhibit a diversity of phenotypes and functions, they also share transcriptomic modules that set them apart from their lymphoid-organ counterparts (1, 2). Intriguingly, pathways related to circadian rhythms are amongst the upregulated pathways shared most prominently, raising the question of whether tissue Tregs are subject to distinct diurnal regulation.
Mammalian circadian rhythms evolved to anticipate and adapt to diurnal variations in the environment. A set of “core-clock” genes encodes the molecular drivers of this process, the expression, activity and degradation of which form an autoregulatory feedback loop lasting approximately 24 hours (3). Heterodimeric complexes of BMAL1:CLOCK drive a core component of circadian transcription, including genes encoding its inhibitors, PER and CRY, and genes specifying its transcriptional regulators, the REV-ERBs and ROR [reviewed in (3)]. These molecular oscillators are stratified into a hierarchy of central and peripheral pacemakers according to whether they are localized in cells of the suprachiasmic nucleus of the brain or in cells of peripheral tissues. Peripheral clocks interpret synchronization signals from the central pacemaker, which is primarily synchronized by light, and from other environmental cues, like feeding and temperature, to generate cell-intrinsic rhythmicity (4–6).
Our understanding of circadian regulation of T cells and of the functions of their core-clock genes is just beginning to emerge. Rhythmic T cell migration between the circulation and lymphoid organs is the best-described circadian behavior: in mice, peak numbers of lymphocytes are found in circulation around zeitgeber time (ZT) 5 (ZT0 signalling onset of the light period), and in lymphoid organs around ZT13 (7–10). Additionally, naïve murine T cells isolated during the day are more likely to differentiate into T helper 17 (Th17) cells than those taken at night (11). However, core-clock genes were reported to be dispensable for T cell differentiation and for their responses to bacterial and viral infection (12), and expression of core-clock genes in splenic Tregs seemed to lack rhythmicity (13). Thus, the contexts wherein Tregs are subject to circadian regulation, as well as the consequences of such regulation, remain in question.
We decided to investigate the importance and function of circadian rhythms in the paradigmatic tissue-Treg population found in epididymal visceral-adipose tissue (VAT) of lean mice (14). Thymic Tregs seed VAT in the first weeks of life, where they proliferate indolently until they dominate the CD4+ T cell pool around 20–30 weeks of age (15). Their accumulation and survival depend on a unique transcriptome largely driven by the critical transcriptional regulator of adipocyte differentiation, PPARγ, as well as on their TCR and cytokines such as IL-33 (15–18). Importantly, VAT Tregs regulate local and systemic metabolic tenor by controlling both immunologic and non-immunologic cells (14, 16, 17).
Combining population-level and single-cell transcriptomics, adoptive transfer experiments, genetic ablation, obesity-inducing challenges, lipolysis assays, and cytofluorimetry-based single-cell metabolic assays, we uncovered a role for the cell-intrinsic clock in promoting the fitness of VAT, but not splenic, Tregs, regulating, for example, adipose-tissue lipolysis. The heightened circadian regulation in Tregs operating in non-lymphoid-tissue environments re-emphasizes their adaptability and striking divergence from their lymphoid-organ counterparts.
RESULTS
Elevated expression of core-clock genes in VAT Tregs
Since pathways related to circadian rhythms appeared to be upregulated in tissue Tregs (1, 2), we employed published microarray data to compare expression of the core-clock genes in VAT (16), muscle (19) and colonic lamina propria (20) Tregs with that of their lymphoid-organ counterparts. Core-clock genes, across all major arms of the cell-intrinsic clock machinery (Fig. 1A), were expressed at higher levels in Tregs from non-lymphoid than lymphoid tissues (Fig. 1B and fig. S1A). Focusing on VAT, we found much less evident up-regulation of the core-clock genes in conventional CD4+ T cells (Tconvs) than in Tregs (Fig. 1C and fig. S1B). Data from a Treg adoptive-transfer system confirmed that the VAT microenvironment up-regulated core-clock gene expression: transfer of Tregs from a VAT-Treg TCR-transgenic (tg) mouse line (18) into non-tg recipients resulted in accumulation of donor Tregs with elevated expression of core-clock genes in VAT in comparison with spleen (Fig. 1D and fig. S1C). Thus, expression of core-clock genes was elevated in tissue Tregs, VAT Tregs in particular, in comparison with their splenic counterparts, an increase induced by the tissular microenvironment.
Fig. 1: Upregulation of core-clock gene expression in VAT Tregs.

(A) Schematic of the cell-intrinsic circadian rhythms executed by core-clock gene products. (B) Core-clock gene expression by tissue Tregs from published microarray data: VAT (16), skeletal muscle 4 days after cardiotoxin injury (19), and colonic lamina propria (20) Tregs in comparison with lymphoid-organ Tregs from the same mice. (C) Core-clock gene expressions in VAT-Treg or -Tconv cells, from published microarray data on retired male breeders (28) in comparison with lymphoid-organ Tregs or Tconvs from the same mice. (B, C) p: * ≤ 0.05, ** ≤ 0.01, *** ≤ 0.001 according to Student’s t-test comparing expression in tissue versus paired lymphoid-organ Tregs. (D) Core-clock gene expression at zeitgeber 0 (onset of light phase) in donor Tregs 9 weeks after transfer in recipients’ VAT and spleen. Tregs from Foxp3-Cre.YFP+CD45.1+TCR-tg+ donors were transferred into Foxp3-Cre.YFP+CD45.1/2+ recipients. FDR: * ≤ 0.05, ** ≤ 0.01, *** ≤ 0.001 according to the quasi-likelihood F-test by EdgeR. n ≥ 3 per condition. VAT, visceral adipose tissue; Spl, spleen; AU, arbitrary units; TCR, T cell receptor; tg, transgenic.
Rhythmic expression of VAT-Treg core-clock genes
We next assessed diurnal expression profiles of the core-clock genes by population-level RNA sequencing of cytofluorimetrically sorted VAT Tregs. Plotting gene expression versus time, where zeitgeber (ZT) 0 denotes onset of the light phase and ZT12 the dark phase, revealed that expression of most of the core-clock genes (such as Bmal1, Per1-3, and Nr1d1,2) exhibited significant rhythmicity in VAT Tregs (Fig. 2A). The times of peak core-clock gene expression in VAT Tregs were similar to those previously reported for liver cells (21, 22), reinforcing the notion that peripheral tissues are usually synchronized. Expression of a few core-clock genes, specifically Cry1-2 and Rorα, lacked rhythmicity in VAT Tregs, which is not surprising given the report that not all core-clock genes are rhythmically expressed in peripheral tissues (23). In stark contrast, rhythmicity of core-clock genes in splenic Tregs appeared muted and was not statistically significant, with the exception of Nr1d2 (Fig. 2A).
Fig. 2: Rhythmic expression of core-clock genes and other loci in VAT Tregs.

Retired B6 male breeders (>35 weeks old) were sacrificed every 4 hours during a 12:12 light:dark cycle. ZT0 signals onset of the light period (see bars below relevant panels). Tregs were sorted as CD4+CD25+. (A) Expression of core-clock genes over time. (B) Heatmap of rhythmically expressed genes in VAT Tregs. (C) Distribution of the time of peak expression for rhythmically expressed genes in VAT Tregs. (D) Fold-change of maximum/minimum gene expression over time in rhythmically expressed genes. (E) Ingenuity Pathway Analysis of rhythmic genes. (F, G) Expression profile of selected rhythmicaly expressed genes in the TCR signaling pathway (F) and cholesterol biosynthesis pathways (G) from panel E. Circadian rhythmicity determined by JTK_Cycle. p: * ≤ 0.05, ** ≤ 0.01, *** ≤ 0.001. n = 3 for each time point from ZT0 to ZT16, n = 2 for ZT20. ZT, Zeitgeiber time. TCA, tricarboxylic acid; VAT, visceral adipose tissue; Spl, spleen; AU, arbitrary units; TCR, T cell receptor. Flow-cytometric gating strategies for all quantified or isolated cell-types can be found in fig. S7.
Looking beyond the core-clock genes to loci they might regulate, we identified over 600 genes with rhythmic expression in VAT Tregs after filtering out genes with low expression or a period of rhythmicity less than 16 hours (Fig. 2B, Table S1). Peak expression of most of these genes was near either ZT0 or ZT12 (Fig. 2C), with about a 1.5-to 2-fold change in expression between their highest and lowest expression (Fig. 2D). Pathway analysis on the rhythmically expressed genes in VAT Tregs revealed an enrichment in pathways related to protein ubiquitination, sirtuin signalling, cholesterol biosynthesis, T cell activation and mitochondrial metabolism (Fig. 2E). Transcripts encoding molecules involved in TCR signaling and cholesterol biosynthesis peaked mostly around ZT0/24 (Fig. 2F, G). Thus, clock genes were rhythmically expressed in VAT Tregs but generally not in splenic Tregs.
Core-clock-gene products enhance the fitnessof VAT Tregs
To assess the functional importance of the Treg-intrinsic clock, we abrogated expression of BMAL1 (which drives the forward loop of the clock and thereby promotes rhythmicity) specifically in Tregs by crossing Foxp3-Cre.YFP mice with a Bmal1flox/flox strain (24). The mutant offspring will hereafter be referred to as TregBmal1Δ mice (Foxp3-Cre.YFP+Bmal1flox/flox) as opposed to the TregBmal1WT controls (Foxp3-Cre.YFP+Bmal1wt/wt). We confirmed that the mutant Tregs lacked the floxed exon 8 (fig. S2A) by inspecting pile-ups generated from population-level RNA sequencing (RNA-seq). Furthermore, we verified the specificity of deletion under the Foxp3-Cre driver by quantitative RT-qPCR, and observed that Bmal1 expression was substantially decreased in Tregs but remained unaffected in CD4+ Tconvs or CD8+ T cells from the spleen (fig. S2B). As expected, loss of BMAL1 led to significant alterations in the expression of other core-clock genes at ZT0 in sorted VAT Tregs. Specifically, there was elevated expression of some genes, such as Cry1 and Npas2, and reduced expression of others, such as Nr1d1 and Nr1d2 (Fig. 3A).
Fig. 3: Loss of competitive fitness in VAT Tregs in the absence of BMAL1 or REV-ERBα.

(A, B): VAT Tregs were isolated at ZT0 from 18-to-30-week-old male TregBmal1WT (WT) or TregBmal1Δ (Δ) mice. (A) Expression of core-clock genes at 18 weeks of age determined by RNA-seq analysis. (B) Fraction of VAT Tregs across age groups at ZT0 (left) and at ZT0 vs ZT12 (right). Left: pooled data from 4 independent experiments; right: representative data of 3 independent experiments. n ≥ 2 per group per experiment. (C-G) Competitive transfer of a 1:1 mix of Tregs from 6-to-8-week-old male mice of the indicated genotype into 8-to-10-week-old recipients, as schematized in (C). (D, E) Fractions of Bmal1 WT and Bmal1 Δ donor cells expressed as a percentage of total Tregs (D) or of total donor Tregs (E) in the recipients’ VAT. (F) similar to panel E but from the recipients’ spleen 12 weeks after transfer. (G) Fraction of donor cells in cycle (Ki67+). For 9 and 12 weeks after transfer, representative data of at least 3 experiments, n ≥ 3 per experiment. (H) Tregs in gonadal fat of Foxp3-Cre+/−.YFP+/−Bmal1flox/flox female heterozygotes. Fraction of Cre− versus Cre+ Tregs; left: representative flow plot; middle: frequency; right: cell number. (I-K) Competitive transfer of a 1:1 mix of Tregs from the indicated genotypes into Foxp3-Cre.YFP+CD45.1/2+ recipients and assessed 12 weeks after transfer. Data pooled from 2 independent experiments. (I,J) Fractions of Nr1d1 WT and Nr1d1 Δ donors expressed as a percentage of total Tregs (I) or of total donor Tregs (J) in the recipient’s VAT. (K) Same as panel I, but from the recipients’ spleen. (p: * ≤0.05, ** ≤0.01, *** ≤ 0.001 according to Student’s t-test for the transfer experiments; quasi-likelihood F-test by EdgeR for RNA-seq data. wks, weeks; VAT, visceral adipose tissue; Spl, spleen; AU, arbitrary units; TCR, T cell receptor; tg, transgenic. Flow-cytometric gating strategies for all quantified or isolated cell-types can be found in fig. S7.
Since the VAT-Treg compartment in adult mice receives little contribution from circulating Tregs (15), we expected diurnal variation in the circulation of lymphoid-organ T cells (8) to have little impact on the VAT-Treg pool size. Accordingly, the number and fraction of VAT Tregs remained similar at ZT0 and ZT12, and between TregBmal1WT and TregBmal1Δ mice at ZT0 (Fig. 3B and fig. S2C). The frequency of Tregs in the spleen also lacked diurnal variation and appeared normal in the absence of BMAL1 (fig. S2D).
We suspected that the Treg-intrinsic clock might promote fitness without impacting accumulation at homeostasis. Thus, we assessed the fitness of BMAL1-deficient Tregs in a competitive adoptive-transfer system. When polyclonal lymphoid-organ Tregs are transferred under this protocol, they do not accrue in VAT; however, Tregs from the VAT-Treg TCR-tg mouse line mentioned above do accumulate after transfer, reflecting efficient recognition of their TCR’s ligand (18). We generated Foxp3-Cre.YFP+.CD45.1+.TCR-tg+Bmal1 WT and Foxp3-Cre.YFP+.CD45.2+.TCR-tg+Bmal1 Δ donor strains. Bmal1 WT and Bmal1 Δ Tregs were transferred at a 1:1 ratio into Foxp3-Cre.YFP+.CD45.1/2+ recipients, and donor-Treg accumulation was quantified in the VAT and spleen at various timepoints thereafter (Fig. 3C). Donor Tregs were first detected in VAT 6 weeks after transfer, when the Bmal1 WT and Bmal1 Δ cells were present at an equal ratio. By 7.5 to 9 weeks, the Bmal1 Δ population had undergone a preferential expansion, representing over 70% of the total donor-Treg pool. However, this transient dominance was followed by a crash of the Bmal1 Δ Treg population, such that mutant cells represented less than 10% of donor Tregs 12 weeks after transfer (Fig. 3D–E). Similar dynamics were observed for donor-Treg numbers (fig. S2E). In contrast, Bmal1 WT and Bmal1 Δ Tregs persisted equally well in the spleen at 12 weeks after transfer (Fig. 3F), suggesting a tissue-specific role for the Treg-intrinsic clock in promoting fitness. The reduced number of Bmal1 Δ cells was not due to a lack of proliferation as the fractions of Ki67+ donor cells were similar in the presence and absence of Bmal1 (Fig. 3G); nor did it appear to reflect migration to other tissues (fig. S2F). We also verified that the reduction of Bmal1 Δ Tregs was not due to the CD45 allele they expressed, as competitive transfer of CD45.1+ and CD45.2+ WT cells led to similar persistence in the recipients’ VAT (fig. S2G). Therefore, loss of Bmal1 Δ donor cells most likely issued from a difference in survival.
Finally, loss of fitness was not restricted to adoptive transfer settings nor to TCR-tg Tregs. Because the Foxp3 gene maps to the X chromosome, random X-inactivation in female mice randomly silences one of the Foxp3 alleles in each cell. Thus, in Foxp3-Cre.YFP+/−Bmal1flox/flox heterozygotes, half of the Tregs express BMAL1 (Cre-) while half do not (Cre+). The number and fraction of Cre+ Tregs in the gonadal fat of female heterozygotes were substantially lower than those of co-resident Cre− Tregs (Fig. 3H). Only 20% of total Tregs were Cre+ and their numbers were significantly less than Cre− Tregs (Fig. 3H). As expected, control Foxp3-Cre.YFP+/− females without Bmal1 deletion did not show these differences: Cre+ cells represented 40% of total Tregs in the gonadal fat, and the numbers of Cre+ and Cre− Tregs were similar (fig. S2H, I).
To rule out transcriptional effects of Bmal1 unrelated to its role in circadian rhythms, we performed analogous experiments on another core-clock gene, Nr1d1, encoding REV-ERBα. Like the TregBmal1Δ strain, Foxp3-Cre.YFP+.Nr1d1flox/flox (hereafter referred to as TregNr1d1Δ) mice showed normal accumulation of VAT Tregs (fig. S2J). However, donor Nr1d1 Δ Tregs did not persist like Nr1d1 WT Tregs did in the recipients’ VAT 12 weeks after transfer (Fig. 3I, J), whereas competitively transferred Tregs of the two genotypes were maintained equally well in the spleen (Fig. 3K). Since Nr1d1 Δ Tregs showed no reduction in Bmal1 expression at ZT12 (fig. S2K), consistent with the role of REV-ERBα in repression of Bmal1 expression, the loss of competitive fitness of both Bmal1 Δ and Nr1d1 Δ donor cells indicated that circadian rhythms, rather than expression of Bmal1 per se, promoted VAT-Treg fitness.
Diurnal variation of the activation state of ST2+ Treg subtypes
As a preliminary step in understanding the mechanisms underlying diurnal control of VAT-Treg fitness, we performed single-cell (sc)RNA-seq on VAT Tregs at ZT0 and ZT12 from TregBmal1WT and TregBmal1Δ animals. To permit simultaneous isolation of cell populations at ZT0 and ZT12, we housed half of the experimental animals in a room with the opposite light cycle for at least 14 days (25), and verified that the animals therein indeed entrained to the new light regimen (fig. S3A). Cells from the four conditions were separately hashtagged and encapsulated together. After demultiplexing, we obtained robust scRNA-seq data for over 6,500 VAT CD4+ T cells, with an average of 1,300 genes detected per cell.
Overlay of Foxp3 expression on a Uniform Manifold Approximation and Projection (UMAP) of the pooled datasets allowed us to distill the Treg compartment (fig. S3B), consisting of over 2,000 cells. We then reclustered the Tregs, revealing five distinct subtypes (Fig. 4A). The p1 ST2+, p2 ST2+, Tbet+, IL18R+ and resting clusters were distinguished by divergent and diagnostic gene expression profiles (Fig. 4B). For instance, the resting cluster expressed elevated levels of Sell and Ccr7; the Tbet+ cluster higher levels of Cxcr3 and Tbx21; and the IL18R+ cluster elevated levels of Il18r, Cxcr3 and S1pr1. Two clusters expressed Il1rl1, encoding ST2: p1 with higher levels of Areg, Nfkbia and Junb transcripts; p2 with elevated Ly6c expression (Fig. 4B). A differential density map revealed enrichment of the p1 over the p2 ST2+ subtype in ZT0 VAT Tregs, as well an increased representation of the Il18r+ subtype (Fig. 4C).
Fig. 4: Diurnal variation of activation state within the ST2+ Treg population.

(A-D, G-J) scRNA-seq analysis of 21-to-23-week-old Foxp3-Cre.YFP+ (WT) and Foxp3-Cre.YFP+Bmal1flox/flox (Δ) VAT Tregs at ZT0 and ZT12. (A) Heterogeneity of VAT Tregs visualized by UMAP. Left: a composite of all four conditions; right: disentangled plots for each condition. (B) Heatmap of top 30 differentially expressed genes of the clusters distinguished in panel A. (C) Cell-density differential between the UMAPs of ZT0 and ZT12 Bmal1 WT VAT Tregs; frequencies of p1 and p2 subtypes of ST2+ cells are indicated. (D) Differential RNA expression of cell-surface markers for flow cytometric distinction of p1 ST2+ and p2 ST2+ Tregs. (E) Fraction of CD69hi VAT Tregs at ZT0 or ZT12 in B6 mice. Left: flow cytometric dot plot; right: summary data. (F) Fraction of CD69hi splenic Tregs at ZT0 and ZT12. (E,F) Pooled data from two independent experiments. (G) KEGG pathway analysis by EnrichR of differentially expressed genes in cells of the p1 and p2 ST2+ clusters. (H-J) Examples of differentially expressed genes encoding activation (H), effector (I), and survival (J) molecules. ** p ≤ 0.01 by Student’s t-test. n ≥ 3 per group per experiment. UMAP, Uniform Manifold Approximation and Projection; VAT, visceral adipose tissue; Spl, spleen. Flow-cytometric gating strategies for all quantified or isolated cell-types can be found in fig. S7.
To validate these findings at the protein level, we searched for differentially expressed genes whose products could be detected by flow cytometry. Antibodies recognizing CD62L, ST2, IL18R, CD39, CD69 and CD25 distinguished the five Treg clusters defined in Fig. 4A (fig. S3C). For the p1 and p2 ST2+ clusters, levels of Cd69, Cd44 and Il2ra transcripts were all higher in the p1 cluster, whereas Ly6c transcript levels were augmented in the p2 cluster (Fig. 4D). However, by flow cytometry, cell-surface expression of only CD69 clearly distinguished the two subtypes of ST2+ cells. CD69high ST2+ Tregs showed a higher mean fluorescence intensity (MFI) of CD44 and CD25 staining, and a lower MFI of Ly6c staining compared with those of CD69low ST2+ Tregs, mirroring the scRNA-seq data (fig. S3D). Consistent with the enrichment of p1 ST2+ Tregs at ZT0 (Fig. 4C), the fraction of CD69high cells was significantly higher within the ST2+ Treg population at ZT0 compared with ZT12 (Fig. 4E). In contrast, splenic Tregs showed a constant component of CD69high cells (Fig. 4F).
We then used the scRNA-seq data to explore differences between the p1 and p2 ST2+ subtypes as well as to examine their interrelationships. Consistent with the higher CD44, CD25 and CD69 expressions, which are canonical T cell activation markers, Tregs of the p1 ST2+ subtype appeared to be more activated. Pathway analysis identified heightened NF-κB and TCR signaling pathways (Fig. 4G), and transcripts encoding activation markers such as IκBα, NR4A1, EGR1 and JUNB were expressed at an elevated level (Fig. 4H). Furthermore, p1 ST2+ cells expressed higher levels of transcripts encoding Treg effector molecules such as Areg, Ctla4 and Il10 (Fig. 4I), as well as transcripts encoding pro-survival molecules such as Tnfaip3, Bcl2a1b and Il10ra (Fig. 4J). On the other hand, p2 ST2+ cells expressed more Ki67 transcripts, indicative of more cells in cycle (fig. S3E); thus the two subtypes might reflect a balance of activation versus proliferation. RNA-velocity analysis, which predicts the likely future state of a cell based on the ratio of spliced to unspliced transcripts (26, 27), revealed distinct trajectories at the two time-points. At ZT12, a trajectory from the p2 toward the p1 ST2+ subtype was predicted. That trajectory was absent at ZT0; instead, a subset of p1 ST2+ cells exhibited a trajectory toward the p2 subtype (fig. S3F). In brief, then, the VAT-Treg compartment includes multiple Treg subtypes. Clear diurnal variation was seen in the relative contributions of the p1 and p2 subtypes of ST2+ cells.
Heightened activation state of Bmal1 Δ VAT Tregs
Diurnal variations within the ST2+ Treg population raised the question of whether they depended on the Treg-intrinsic circadian clock. Analysis of cell density differences on the UMAP reproduced from Fig. 4A (Fig. 5A, left) revealed an enrichment in ST2+ Tregs, particularly the p1 ST2+ subtype, at both ZT0 (Fig. 5A, center) and ZT12 (Fig. 5A, right) in Bmal1 Δ compared with Bmal1 WT Tregs. Furthermore, Bmal1 Δ Tregs showed an enrichment of the p1 ST2+ subtype at both ZT0 and ZT12 (Fig. 5A), in contrast to WT cells, for which we observed a diurnal switch in the dominant ST2+ subtype (Fig. 4C), suggesting that Bmal1 Δ VAT Tregs might be constitutively activated. Indeed, population-level RNA-seq revealed heightened activation terms such as “Th1 and Th2 activation”, “TNFR2 signaling” and “IL-2 signaling”, as well as elevated expression of genes encoding cytokine common-γ-chain receptors (Il2ra, Il7r) and members of the NF-κB signaling pathway (Nfkbia, Nfkb1, Traf1) in Bmal1 Δ cells (Fig. 5B and fig. S4A). Consistent with the scRNA-seq data, TregBmal1Δ mice had an elevated fractions of ST2+ Tregs (Fig. 5C), which translated into an enrichment of the canonical VAT-Treg signature (28) (Fig. 5D). Transcripts upregulated in the p1 vs p2 ST2+ clusters were also enriched in the Bmal1 Δ Treg transcriptome (Fig. 5E). According to flow cytometric analysis, the fraction of CD69high cells within the ST2+ VAT-Treg population was higher in TregBmal1Δ than TregBmal1WT mice (Fig. 5F), consistent with an enrichment of the p1 ST2+ subtype. This enrichment was accompanied by a non-significant relative decrease in the Tbet+ (Il18r−) subtype in Bmal1 Δ VAT Tregs (fig. S4B). In contrast, the fraction of CD69high Tregs was the same in TregBmal1WT and TregBmal1Δ spleens. (Fig. 5F). Consistent with the transcriptomic data, the MFI of CD44 staining was significantly higher and the MFI of CD25 staining trended higher in Bmal1 Δ than in Bmal1 WT VAT Tregs (Fig. 5G). These variations were not present in splenic Tregs (fig. S4C).
Fig. 5: Elevated activation state of Bmal1 Δ Tregs.

(A) Cell-density differential comparing Bmal1 WT and Bmal1 Δ VAT Tregs at ZT0 (middle) and ZT12 (right). The left panel re-presents figure 4A for convenient and accurate comparison. (B-D) Population-level RNA-seq of Bmal1 WT and Bmal1 Δ VAT Tregs from 18-week-old male mice at ZT0. (B) Ingenuity Pathway Analysis. (C) Fraction of ST2+ VAT Tregs from 18–30-week-old male mice at ZT0. (D) Volcano plot overlaid with up- (red) and down- (blue) regulated VAT-Treg signature genes (28). (E) Volcano plot overlaid with genes upregulated in the p1 ST2+ cluster (orange) or p2 ST2+ cluster (pink). (F) Left: flow plot. Right: summary data showing fraction of CD69high Tregs in VAT and spleen at ZT0 or ZT12. (G) Geometric MFI (gMFI) of CD44 (left, middle) and CD25 (right) expression at ZT0. For flow cytometric data, p: * ≤0.05, ** ≤0.01, *** ≤ 0.001 according to Student’s t-test. Th, T helper cell; TNFR2, tumor necrosis factor recptor 2; ZT, Zeitgeiber time; VAT, visceral adipose tissue; Spl, spleen. Flow-cytometric gating strategies for all quantified or isolated cell-types can be found in fig. S7.
Male and female mice have distinct gonadal VAT Treg compartments (18, 29, 30). We identified five Treg subtypes in Tregs isolated from the gonadal fat (gVAT) of 8-to-12-week-old female mice using the gating strategy adopted from our single-cell analysis (fig. S4D). The fraction of ST2+ cells was lower in female than male mice, consistent with prior reports (29, 30). Similar to males, female Bmal1 Δ mice exhibited an increased fraction of gVAT ST2+ Tregs and a decrease in the Tbet+ (IL18r−) Treg subtype (fig. S4E). However, representation of the CD69hi p1 subtype within the ST2+ population was unchanged in mutant Tregs (fig. S4E).
A heightened activation state in the absence of Bmal1 likely also explained the preferential expansion of the Bmal1 Δ donor-derived Treg population at 9 weeks after competitive transfer. Indeed, population-level RNA-seq on sorted Bmal1 WT and mutant donor-derived cells at this time-point revealed an enrichment in activation pathways such as “TNF-alpha signaling via NF-kb” and “IL-2/Stat5 Signaling” (fig. S4F). Expression of Egr1, Nfkb1, Cd44, Il2ra and Il7r were increased in Bmal1 Δ donor-derived cells (fig. S4G), as they were in the non-competitive setting (fig. S4A). Flow cytometric analysis confirmed the expected increase in CD44 MFI in Bmal1 Δ donor-derived cells 12 weeks after transfer (fig. S4H). Thus, Bmal1 Δ Tregs showed an enrichment of the ST2+ subtype in both male and female mice at steady-state, and were more activated than their WT counterparts in male mice and after adoptive transfer.
VAT Tregs enforce diurnal lipolysis
We next sought to identify the physiological function(s) of the cell-intrinsic clock in VAT Tregs. When fed on lean chow, TregBmal1Δ mice exhibited a small increase in adiposity compared with their WT littermates (Fig. 6A), without significant changes in their glucose tolerance or insulin sensitivity (fig. S5A). Because increased adiposity can result from reduced lipolysis, and given that the extent of adipose-tissue lipolysis is known to oscillate diurnally (31), we interrogated the role of Tregs in this process. Systemic depletion of Tregs, achieved through diphteria toxin (DT) administration to >16-week-old Foxp3-DTR+ mice (Fig. 6B), provoked a rapid decrease in epididymal VAT (eVAT) weight 3 days after DT injection (Fig. 6C), and the epididymal fat pads were visibly smaller (Fig. 6D), suggestive of increased lipolysis. To assess the lipolytic rate of adipose tissue, we explanted eVAT and stimulated it with norepinephrine (NE) in vitro, as described previously (32, 33). This approach circumvents the challenge of interpreting serum glycerol levels, which depend on both lipolytic output and peripheral-organ uptake (34). Explants from Treg-depleted animals were less sensitive to NE stimulation and resisted further lipolysis, expressed as micromolar release of glycerol per milligram per hour, while basal glycerol release were similar (Fig. 6E). This diminished lipolysis in vitro likely resulted from an elevated lipolysis in vivo. For instance, injection of the β3-adrenergic agonist CL316,243 (CL) to B6 mice, which is well known to induce extensive lipolysis in vivo, also resulted in diminished lipolysis in vitro (fig. S5B).
Fig. 6. VAT Tregs enforce diurnal lipolysis.

(A) Body composition of 18-to-24-week-old male mice. (B-E, G-H) lipolysis experiments in 22-to-32-week-old male Foxp3-DTR+ mice. (B) schematic of DT injection and subsequent analyses. (C-E) Body and epididymal VAT weight (C); photo of epididymal fat pad (D); in vitro glycerol release rate of VAT explants (E) 3 days after DT injection at ZT12 (F) in vitro glycerol release rate of VAT explants isolated from TregBmal1WT male mice stimulated with 0.1μM norepinephrine. (G-H) Fraction of p1 ST2+ (CD69hi) Tregs (G); in vitro glycerol release rate of VAT explants 4 weeks after DT injection stimulated with 0.1μM norepinephrine (H). (I) in vitro glycerol release rate of VAT explants of 12-to-23-week-old TregBmal1WT and TregBmal1Δ male mice stimulated with 0.1μM norepinephrine pooled from two independent experiments. For in vitro lipolysis assays, each dot is one explant, two explants were taken per mouse per condition. Paired Student’s t-test between littermate pairs was performed for panel A. For other panels, p: * ≤0.05, ** ≤0.01, *** ≤ 0.001 according to Student’s t-test. DTR, diphteria toxin receptor; μM, micro-molar; mg, milligram; h, hour; NE, norepinephrine; ZT, zeitgeiber time. Flow-cytometric gating strategies for all quantified or isolated cell-types can be found in fig. S7.
eVAT explants taken at ZT12 underwent significantly more in vitro lipolysis in response to NE stimulation than did those taken at ZT0 (Fig. 6F), indicative of a diurnal rhythm in lipolysis. However, explants from mice deficient in the ST2+ Treg population, in particular the p1 subtype, did not exhibit this rhythmicity. Four weeks after DT injection, eVAT weight and VAT Treg numbers had normalized in DT-injected mice (fig. S5C), but the fraction of p1 ST2+ Tregs remained low (Fig. 6G). Explants from these animals exhibited constitutively low lipolysis in vitro (Fig. 6H), suggesting that p1 ST2+ Tregs de-sensitized adipocytes to NE-induced lipolysis in vivo and was required for diurnal rhythmicity. Finally, we assessed whether adipose-tissue lipolysis was controlled by BMAL1 in Tregs. Diurnal rhythms of lipolysis in eVAT from TregBmal1Δ mice appeared blunted: in vitro lipolysis was elevated at both ZT0 and ZT12 after NE stimulation (Fig. 6I), indicative of reduced lipolysis in vivo and consistent with the increased adiposity of TregBmal1Δ mice (Fig. 6A). Thus, BMAL1 expression enables VAT Tregs to help enforce a diurnal rhythm in adipocyte lipolysis.
Accelerated activation but loss of fitness during high-fat-diet challenge
The heightened activation state of Bmal1 Δ Tregs in lean mice prompted us to characterize these mutant cells in the context of chronic activation such as high-fat-diet (HFD)-induced obesity. Upon HFD feeding, the VAT-Treg compartment responds in two distinct stages (35). VAT Tregs initially undergo a period of proliferation to counter mounting levels of inflammation (35) and their transcriptome shows an enrichment of the VAT-Treg signature (28). With chronic HFD feeding, bona fide (ST2+, KLRG1+, GATA3+) VAT Tregs are greatly reduced and the remnant cells lack the canonical VAT-Treg signature (14, 28, 35). We fed TregBmal1WT and TregBmal1Δ mice on a lean diet for 14 weeks to establish a normal pool of VAT Tregs, followed by HFD feeding for 4, 8 or 16 weeks (Fig. 7A). Weight gain was similar between the two genotypes (fig. S6A), as was the fraction and number of VAT Tregs (Fig. 7B and fig. S6B). But after 4 weeks of HFD, transcriptional profiling of VAT Tregs revealed an enrichment of the VAT-Treg signature in the mutants’ Treg transcriptome (Fig. 7C), associated with an elevated fraction of ST2+ Tregs (fig. S6C), and higher cell-surface expression of CD44 and CD25 (Fig. 7D). In contrast, after 16 weeks of HFD, the VAT-Treg signature was decreased in Bmal1 Δ compared with Bmal1 WT Tregs (Fig. 7E), suggestive of poor adaptation of Bmal1 Δ Tregs. As a result, TregBmal1Δ mice had a higher fraction of CD11c+ inflammatory macrophages (Fig. 7F), and a trend toward a greater accumulation of CD8+ T cells at this time-point (fig. S6D), idicative of increased VAT inflammation. In line with this notion, inflammatory pathways distinguished the eVAT depots from TregBmal1WT and TregBmal1Δ mice after 16 weeks of HFD, as assessed by whole-tissue RNA-seq. Pathways related to interferon, IL6 and TNFα signaling were upregulated in the VAT of TregBmal1Δ mice, whereas metabolic pathways such as fatty acid metabolism and oxidative phosphorylation were downregulated (Fig. 7G, H). Glucose and insulin tolerance, assessed at 7 and 9 weeks after HFD feeding, were similar between the two genotypes (fig. S6E). Thus, disruption of the cell-intrinsic clock impaired VAT Tregs’ ability to adapt to the dysregulated VAT environment induced by HFD feeding.
Fig. 7. Accelerated activation but loss of fitness in Bmal1 Δ Tregs during HFD challenge.

TregBmal1WT and TregBmal1Δ mice were fed a LFD for 14 weeks followed by a HFD for indicated durations; VAT Tregs were isolated at ZT0, schematized in (A). (B) Percent of VAT Tregs. (C) Volcano plot of VAT-Treg transcriptome after 4 weeks of HFD, overlaid with VAT-Treg signature genes similar to figure 6D. (D) gMFI of CD44 (left) and CD25 (right) staining after 4 weeks of HFD. (E) Volcano plot of VAT-Treg transcriptome after 16 weeks of HFD, overlaid with VAT-Treg signature genes. (F) Fraction of CD11c+ macrophages. (G) Volcano plot of whole VAT transcriptome; up- or downregulated genes with p ≤ 0.05 and ≥1.5 fold change are highlighted; genes of interest are boxed. (H) Gene Set Enrichment Analysis (GSEA) of whole VAT transcriptome. For flow cytometric data, p: * ≤0.05, ** ≤0.01, *** ≤ 0.001 according to Student’s t-test. Data representative or pooled of at least two experiments. NES, normalized enrichment score; HFD, high-fat diet; wks, weeks. Flow-cytometric gating strategies for all quantified or isolated cell-types can be found in fig. S7.
Diurnal variation in mitochondrial electron transport chain activity
To explore potential mechanisms of how BMAL1 promoted Treg fitness, we returned to the rhythmic pathways identified in VAT Tregs (Fig. 2E). Besides loci associated with TCR activation, we noted that the rhythmically expressed genes in VAT Tregs encoded molecules related to several mitochondrial oxidative metabolism pathways (Fig. 2E). Genes encoding components of the electron transport chain (ETC) and the tricarboxylic acid (TCA) cycle peaked between ZT20 and ZT0/24 according to JTK_CYCLE analysis (Fig. 8A). We analyzed the metabolic states of VAT Tregs at ZT0 and ZT12 to be consistent with other experiments, although analysis at ZT20 might have revealed even greater differences. Due to the very low number of VAT Tregs in individual mice, we could not implement conventional methods such as Seahorse assays to evaluate mitochondrial metabolism. Instead, we turned to flow cytometry to assess mitochondrial oxidative metabolism by measuring the mitochondrial membrane potential (ΔΨm) at steady-state and after inhibition of ATP synthase (Complex V). Catabolism of molecules such as glucose, fatty acids and amino acids ultimately feeds into the TCA cycle, where acetyl-CoA is sequentially oxidized and electrons are passed to the ETC via reduction and oxidation of NAD+/NADH. Electron transport is coupled to translocation of protons from the mitochondrial matrix into the intermembrane space. Such proton translocation generates an electrochemical gradient across the inner mitochondrial membrane, the ΔΨm, which is primarily used to power ATP synthesis at Complex V. While the basal ΔΨm is a function of proton influx and efflux, inhibition of Complex V by oligomycin impairs proton influx to the matrix, and the resulting elevation of ΔΨm is indicative of the extent of mitochondrial oxidative metabolism (Fig. 8B). In other words, higher TCA cycle and ETC activity would result in a larger increase in mitochondrial membrane potential after oligomycin treatment.
Fig. 8: Circadian regulation of mitochondrial electron transport chain activity.

(A) Circadian expression profiles of rhythmically expressed genes in the oxidative phosphorylation and TCA cycle pathways. RNA-seq data from figure 2. (B) Schematic of mitochondrial membrane potential at baseline (left) and after inhibition of Complex V by oligomycin (right). Red color emphasizes changes after oligomycin inhibition. (C, D) Basal mitochondrial membrane potential measured by TMRE at ZT0 and ZT12 in VAT (C) and splenic (D) Tregs. (E) VAT and splenic Treg responses to oligomycin. Ratio calculated as post-oligomycin gMFI/basal gMFI. (F) Basal TMRE in p1 ST2+ (CD69hi ST2+) and p2 ST2+ (CD69lo ST2+) VAT Tregs at ZT0 and ZT12; (G) their response to oligomycin. (H, I) Basal mitochondrial membrane potential of Bmal1 WT and Bmal1 Δ VAT (H) and splenic (I) Tregs at ZT0. (J) VAT and splenic Treg responses to oligomycin in TregBmal1WT and TregBmal1Δ mice at ZT0. p: * ≤0.05, ** ≤0.01 by Student’s t-test. Basal TMRE plots: representative of at least two independent experiments. Oligomycin/basal FC: pooled from at least two independent experiments. n ≥ 2 per condition per experiment. IMS, intermembrane space; oxphos, oxidative phosphorylation; TMRE, tetramethylrhodamine ethyl ester; FC, fold change. Flow-cytometric gating strategies for all quantified or isolated cell-types can be found in fig. S7.
At baseline, VAT Tregs had a lower ΔΨm at ZT0 than at ZT12, as measured by tetramethylrhodamine ethyl ester (TMRE) labeling (Fig. 8C), unlike splenic Tregs, wherein the ΔΨm remained constant (Fig. 8D). The lower ΔΨm at ZT0 reflected greater oxidative phosphorylation, since inhibition by 1 μM oligomycin induced a greater increase in membrane potential in VAT Tregs at ZT0 than ZT12 (Fig. 8E); in contrast, splenic Tregs responded similarly to oligomycin at the two timepoints (Fig. 8E). Within ST2+ Tregs, the p1 subtype exhibited the most prominent diurnal changes (Fig. 8F, G).
VAT Tregs from TregBmal1Δ mice exhibited a higher baseline ΔΨm at ZT0 than their counterparts from Bmal1 WT littermates (Fig. 8H), whereas such differences were not observed in the spleen (Fig. 8I). These ΔΨm differences translated into a greater response to oligomycin in Bmal1 WT than Bmal1 Δ VAT Tregs, but not in the corresponding splenic Tregs (Fig. 8J). Overall, these findings illustrated VAT-specific diurnal variation in the extent of mitochondrial oxidative metabolism and suggested a role for BMAL1 in promoting ETC activity in VAT Tregs.
DISCUSSION
It has been reported that the adaptive immune response is unaffected by the cell-intrinsic clock (12). However, that study focused on lymphocytes within lymphoid organs, and we found that the transcriptomes of Tregs within non-lymphoid, compared with lymphoid, tissues were enriched in pathways associated with circadian rhythms (1, 2). In this report, we showed that genes encoding core components of the cell-intrinsic clock were rhythmically expressed in VAT, but not splenic, Tregs. Treg-specific mutations of core-clock genes impacted VAT, but not splenic, Treg activation, metabolism and, ultimately, fitness. These differences had organismal consequences: for example, the cell-intrinsic clock enabled VAT Tregs to enforce a diurnal rhythm in epididymal VAT lipolysis.
As Tregs refine their phenotype in various tissues, they become more activated and adapt their cellular metabolism to their specific locale (1). There is past and current evidence that both of these processes fall under circadian control. T cells isolated at different ZTs are differentially sensitive to TCR stimulation (36, 37). Murine CD8+ T cells isolated during the day are more robustly activated after recognition of cognate antigen in vitro, and exhibit a diurnal variation in their activation after DC-mediated vaccination in vivo (37). BMAL1 restrained VAT, but not splenic, Treg activation, similar to its role in other immunocyte populations. Inflammatory cytokine production in macrophages or IL-22 and IL-17 production in ILC3s are heightened after Bmal1 or Nr1d1 deletion (38–44). The brakes on cell activation imposed by BMAL1 in multiple immunocyte lineages that lack TCRs also suggest that the NF-κB signaling pathway might be a primary target of circadian regulation. Indeed, Bmal1 deletion heightens NF-κB signaling in macrophages (38) and intestinal epithelial cells (45).
Many of the rhythmically expressed genes in VAT Tregs belonged to metabolic pathways. Our results evidenced a clear diurnal variation in the TCA cycle and in ETC activity. Rhythms in mitochondrial ETC activity can originate from several processes. For instance, mitochondria undergo diurnal cycles of fusion and fission (46–48), which modulate the efficiency of ATP production. Fused mitochondria, which are more efficient at producing ATP, occur early in the day (46–49) and are associated with a heightened mitochondrial oxygen consumption rate and ATP production (47, 48). In VAT Tregs, the timing of increased oxidative metabolism coincided with the period of heightened activation state to potentially meet an elevated energy demand. These variations were not present in splenic Tregs, highlighting the different metabolic needs of their VAT-Treg counterparts.
In the absence of these and presumably other temporal modulations, VAT Tregs lost fitness in competitive transfers, in female Bmal1 heterozygotes, and in response to HFD challenge. The reduced fitness resulted from disruption of the core-clock program rather than loss of BMAL1 expression per se, since adoptive transfer of either Bmal1 or Nr1d1 Δ Tregs led to loss of fitness. Some of the phenotypes in TregBmal1Δ mice might be attributable to other core-clock proteins, such as REV-ERBα, whose expression was significantly altered by loss of BMAL1. The constitutively heightened activation state in Bmal1-deficient Tregs suggests dysregulation of the NF-κB signaling pathway, which is intimately related to apoptosis and necrosis. Indeed, the upstream regulators of NF-κB signaling serve a second, less recognized, function as cell death checkpoints, and NF-κB target genes are known to regulate cell-death (reviewed in (50, 51)). However, the in vivo signals that result in cell death instead of pro-survival signaling by NF-κB in VAT Tregs after competitive transfer remain undefined. Furthermore, ETC activity appeared dampened in Bmal1 Δ VAT Tregs and might contribute to the loss of fitness. BMAL1 promotes mitochondrial oxidative metabolism (42, 46, 52). An inefficient mitochondrial respiration in the absence of BMAL1 increases the production of reactive oxygen species (ROS) (53) and ROS exhibits circadian rhythmicity (41, 42, 47). Poorly optimizied mitochondrial function can impair Treg fitness and function, as has been shown in other reports (54–58).
We uncovered a role for VAT Tregs in regulating diurnal lipolysis of the adipose tissue, which requires BMAL1 expression in Tregs. Norepinephrine-induced lipolysis is an important mechanism for providing nutrients during states of energy deprivation (59), but excessive lipolysis recruits inflammatory infiltrates to the adipose tissue (60, 61). Thus, adipocyte lipolysis is highly regulated. In mice, lipolysis peaks near ZT0 (31), and we recapitulated these findings in vitro as VAT explants isolated at ZT0 resisted further norepinephrine stimulation, compared with those taken at ZT12. We found that ST2+ Tregs, in particular the p1 subtype, suppressed lipolysis in lean animals, and rhythmic lipolysis was disrupted in both DT-treated Foxp3-DTR+ mice and in TregBmal1Δ animals. It seems likely that VAT Tregs regulate lipolysis by controlling the inflammatory tenor of the adipose tissue, since cytokines such as TNFα induce lipolysis (62, 63). Alternatively, Tregs might control other VAT immunocytes that modulate sympathetic nervous signaling, such as macrophages (32, 64). Lastly, VAT Tregs might control the sympathetic tone directly through an unknown mechanism. That VAT Tregs enforce diurnal lipolysis is consistent with their role in promoting metabolic homeostasis in VAT (14, 16, 17).
It is unclear how VAT Tregs are entrained by circadian rhythms. Identifying specific signals that entrain them, indeed non-neuronal cells in general, remains an important goal in the field. Hormonal, neuronal and metabolic signals are drivers of some of the mechanisms (reviewed in (6)). TCR activation upregulates the expression of core-clock genes such as Bmal1 and Nfil3 (65, 66), and thus might kick-start the cell-intrinsic clock program. Metabolic cues such as insulin signaling (67) might also entrain resident immunocytes. Given the diurnal lipolysis of adipose tissue, whether lipid species also provide entrainment cues to VAT Tregs is an intriguing possibility.
While we did not find most core-clock genes to be significantly rhythmic in splenic Tregs, it remains possible that a more frequent and prolonged sampling, for instance over 48 hours with a 2-hour sampling interval, might detect weak rhythmicity in the expression of other core-clock genes. Nonetheless, other studies have noted a similarly weak rhythmicity in splenocytes (12, 13). Rhythmicity in VAT Tregs entailed changes on the order of 2-fold, which is less than what has been observed with some cell-types, such as hepatocytes, but is similar to observations on other immunocytes (68, 69). Lastly, due to the very low number of VAT Tregs per mouse, we could not perform metabolomics or metabolite-tracing experiments to pinpoint the specific metabolic reactions under diurnal control.
Tissue microenvironments undergo significant changes throughout the day. The elevated rhythmicity of core-clock gene expression provides a molecular mechanism for VAT Tregs to synchronize and adapt to the changing tissue environment. An improved understanding of the diurnal behaviors of tissue Tregs might help maximize the efficacies of Treg-based immunotherapeutic strategies.
MATERIALS AND METHODS
Study design
This study aimed to establish to what extent circadian rhythms occurs in Tregs in VAT versus the spleen, and how important it is. To that end, we performed transcriptomic profiling by population-level and single-cell RNA sequencing over circadian time, as well as cytofluorimetry-based metabolic assays in C57BL/6 and mutant littermates lacking core-clock components.
Mice
C57BL/6 (B6), B6.CD45.1 (stock number 002014, B6.SJL-Ptprca Pepcb/BoyJ) and Bmal1flox/flox (stock number 007668, B6.129S4(Cg)-Arntltm1Weit/J) mice were obtained from the Jackson Laboratory. Nr1d1flox/flox mice have been reported (University of Pennsylvania) (70). Foxp3-Ires GFP.hDTR mice were obtained from A. Rudensky (Memorial Sloan Kettering Cancer Center). The B6.Foxp3-Ires GFP (71), B6.Foxp3-Cre.YFP (72), and VAT TCR-tg lines (18) have been described. Mice lacking Bmal1 or Nr1d1 specifically in Tregs were generated by crossing B6.Foxp3-Cre.YFP mice with the respective flox strains, and are typically referred to in the text as TregBmal1Δ or TregNr1d1Δ For transfer experiments, knock-out donor strains were generated by crossing B6.Foxp3-Cre.YFP.CD45.2+ mice with VAT TCR-tg mice and either the Bmal1flox/flox or Nr1d1flox/flox strain to obtain Foxp3-Cre.YFP.CD45.2+.TCR-tg+ Bmal1flox/flox or Nr1d1flox/flox offspring. Female heterozygous Cre strains were generated by crossing Foxp3-Cre.YFP+/+Bmal1flox/flox with Bmal1flox/flox mice. Wild-type donor strains were obtained by crossing B6.Foxp3-Cre.YFP mice with B6.CD45.1 and VAT TCR-tg mice to obtain Foxp3-CreYFP.CD45.1+.TCR-tg+ offspring. Recipients were generated by crossing B6.Foxp3-Cre.YFP with B6.CD45.1 to obtain Foxp3-Cre.YFP.CD45.1/2+ offspring. Appropriate littermate controls were always used except for transfer experiments, where co-housed donors of similar age were used. All animals were housed in specific pathogen-free facilities at Harvard Medical School’s Center for Animal Resources and Comparative Medicine. All experiments were performed under protocols approved by the HMS Institutional Animal Care and Use Committee (protocol# IS00001257).
Mice were housed under a strict 12h:12h light: dark cycle. In some experiments, they were entrained in a reverse light-cycle room for a minimum of 14 days with a 12h:12h dark: light cycle, which enabled simultaneous tissue collection from mice at different circadian time-points. To assess adaptation to reverse light cycle, mice were housed individually with unrestricted access to running wheels equipped with activity tracking (Columbs Instruments). Wheel revolutions were recorded in each cage every 10 seconds and cumulative wheel turns from all mice are plotted.
Unless otherwise noted, weaned mice were fed a low-fat-diet chow (no.5053, Picolab Rodent Diet 20; 13% kcal fat) ad libitum. For high-fat-diet experiments, mice were fed a low-fat-diet chow (no.5053) ad libitum until 14 weeks of age, then fed a high-fat diet (Open Source Diet D12492, 60% kcal fat) ad libitum for 4, 8 or 16 weeks.
Tissue preparations for flow cytometry and cell sorting
Tissue preparation has been previously described with slight modifications (29) Briefly, male mice were euthanized by CO2. Epididymal VAT and spleen were excised and placed in Dulbecco’s modified Eagle’s medium (DMEM) containing 2% fetal bovine serum (FBS) and 10mM HEPES (referred to as FACs buffer). VAT depots were minced with scissors and incubated with FACs buffer containing 1.5mg/mL collagenase type II (Sigma) at 37°C for 20 minutes. The adipocyte layer was removed after centrifugation at 420 g. Red blood cells were lysed by ACK lysing buffer (Gibco). Spleen and lymph nodes were mechanically dissociated by mashing against a 40 μM filter, followed by red blood cell removal by ACK lysis. For liver, lung and kidney preparations, excised tissues were minced with scissors and incubated in 1% FCS DMEM containing 0.5mg/mL collagenase IV (Gibco), 150 μg/mL DNase I (Sigma) at 37°C for 30–45 minutes. Digested tissues were filtered and washed. For liver and kidney, leukocytes were enriched by centrifugation (10 min at 800 × g) with 36% Percoll (GE Healthcare).
For surface-antigen staining, single-cell suspensions were incubated in phosphate-buffered saline (PBS) containing live/dead stain and surface antibodies for 10 minutes on ice, followed by washes in FACs buffer. For intracellular staining, single-cell suspensions were fixed in eBioscience Fix/Perm buffer for 20–30 minutes at room temperature, followed by permeabilization in eBioscience permeabilization buffer. Cells were stained with intracellular antibodies for 30 minutes at room temperature followed by washes with permeabilization buffer.
The following antibodies were used: anti-mouse -CD4 (GK1.5), -CD8α (53–6.7), -CD11b (M1/70), -CD11c (N418), -CD19 (6D5), -CD39 (Duha59), -CD45 (30-F11), CD45.1 (A20), -CD45.2 (104), CD62L (MEL-14), -CD69 (H1.2F3), -Il18r/CD218α (BG/IL18RA), -CD44 (IM7), -Il17r/CD127 (A7R34), -CD206 (C068C2), -Ly6c (HK1.4), -F4/80 (BM8) and -I-A/I-E (M5/114.15.2) all from BioLegend; -CD25 (PC61), -TCRβ (H57–597) and -Ki67 (B56) from BD bioscience; -Foxp3 (FJK-16s), -Il33R/ST2 (RMST2–2) and -Klrg1 (2F1) from Thermofisher. Live/Dead fixable viability dye yellow, near-IR or UV (Thermofisher) were used to distinguish live and dead cells. Typically Tregs were defined as CD45+ TCRβ+ CD4+ Foxp3+. For cell sorting, Tregs were defined as CD45+ Tcrb+ CD4+ YFP+ CD8α− CD11b− CD11c− CD19− DAPI−, unless otherwise specified.
For 5-ethynyl-2’-deoxyuridine (EdU) experiments, 40μg/g of body weight EdU (Thermofisher) was intraperitoneally injected 12 hours before sacrifice. EdU was detected using Click-iT plus Pacific Blue Flow Cytometry Assay Kit (Thermofisher) according to the manufacturer’s instructions.
RNA Sequencing
RNA sequencing was performed as described at www.immgen.org. 1000 Tregs were double-sorted directly into 5 μl TCL-buffer (Qiagen) containing 1% β-mercaptoethanol (Sigma). For adoptive transfer experiments, 500 cells were double-sorted. Smart-seq2 libraries were prepared and sequenced as previously described (73) using the Broad Genomics Platform. Briefly, RNA was captured and purified using RNAClean XP beads (Beckman Coulter). Polyadenylated mRNA was selected using an anchored oligo(dT) primer (50 –AAGCAGTGGTATCAACGCAGAGTACT30VN-30) and converted to cDNA by reverse transcription. Limited PCR amplification was performed on the first-strand cDNA followed by Tn5 transposon-based fragmentation using the Nextera XT DNA Library Preparation Kit (Illumina). Samples were PCR amplified for 12 cycles using barcoded primers such that each sample carried a specific combination of eight base Illumina P5 and P7 barcodes for subsequent pooling and sequencing. Paired-end sequencing was performed on an Illumina NextSeq 500 using 2 × 38bp reads with no further trimming. Reads were aligned to the mouse genome (GENCODE GRCm38/mm10 primary assembly and gene annotations vM16; https://www.gencodegenes.org/mouse_releases/16.html) with STAR 2.5.4a (https://github.com/alexdobin/STAR/releases). Ribosomal RNA gene annotations were removed from GTF (General Transfer Format) file. Gene-level quantification was calculated by featureCounts (http://subread.sourceforge.net/). Raw read counts tables were normalized by the median of ratios method with DESeq2 package from Bioconductor (https://bioconductor.org/packages/release/bioc/html/DESeq2.html) and then converted to GCT and CLS format. Samples with less than 1 million uniquely mapped reads or with fewer than 8,000 genes over ten reads were considered low quality and removed, followed by further screening for contamination by using known cell-type-specific transcripts. Biological replicates with poor Pearson correlation (<0.9) were removed. Genes with less than 10 reads across samples or a high coefficient of variation (typically >0.6) were removed. Differential gene-expression analysis was performed using EdgeR (74); differentially expressed genes were defined as p ≤ 0.05 according to quasi-likelihood F-test. For pathway enrichment analysis, differentially expressed genes were analyzed by Ingenuity Pathway Analysis (Qiagen, https://www.qiagenbioinformatics.com/products/ingenuitypathway-analysis) (75), Gene Set Enrichment Analysis (Subramanian et al 2005) or EnrichR (76, 77). Enriched pathways were defined as FDR ≤0.05. In some cases, previously established signatures were tested for enrichment in our dataset, where significant enrichment was defined as p ≤0.05 according to Fisher’s exact test.
For whole-tissue RNA-sequencing, RNA was extracted from VAT using the RNeasy lipid tissue mini kit following the manufacturer’s protocol (Qiagen). 2ng of RNA was added into 5 μl TCL-buffer (Qiagen) containing 1% β-mercaptoethanol (Sigma) and sequenced as above.
RT-PCR
RNA was extracted from 100,000 sorted splenocytes using Trizol (Invitrogen) following the manufacturer’s protocol. Complementary DNA synthesis was performed using a Maxima H Minus Reverse Transcriptase kit (Thermo Fisher Scientific). Quantitative PCR (qPCR) was run on a QuantStudio 5 Real-Time PCR System (Applied Biosystems). The expression of Bmal1 was calculated by the 2−ΔΔCt method relative to the expression of the ribosomal subunit 36b4 (Rplp0). Primer sequences: Bmal1 AGGATCAAGAATGCAAGGGAGG (F), TGAAACTGTTCATTTTGTCCCGA (R); Rplp0 GGAGTGACATCGTCTTTAAACCCC (F), TCTGCTCCCACAATGAAGCA (R).
Adoptive transfers
Cells from 6-to-8-week-old male donors were pooled from spleen and peripheral lymph nodes, followed by enrichment for CD4+ cells using Dynabeads untouched Mouse CD4 (Thermofisher). Cells were single sorted for YFP+ Tregs. For the competitive transfer experiments, a 1:1 mix of 250,000 donor Tregs from wild-type or knock-out donors (500,000 total Tregs) were resuspended in PBS and intravenously injected via the tail vein into 8-to-10-week-old male recipients. Donor and recipient mice were fed a low-fat-diet chow with 21% kcal fat (no. 5058, Picolab Rodent Diet 20)
scRNA-seq
34,000 VAT and 32,000 splenic CD4+ T cells were sorted and multiplexed using TotalSeq hashing antibodies (BioLegend). Cell encapsulation, RNA isolation, and hash library construction and sequencing were performed by the Broad Institute Genomic Services using the 10X Genomics platform. Samples were processed using 3’ v3.1 chemistry and hashed cells were loaded onto one lane. cDNA and gene expression libraries were constructed following the manufacturer’s instructions (10X Genomics). Gene expression libraries were sequenced on HiSeq X. Samples were demultiplexed using cellranger v6.0 and hash libraries were processed using cite-seq-count (https://hoohm.github.io/CITE-seq-Count/)
Data analysis was performed following the Seurat v3 pipeline (78). Low-quality cells were removed and were defined as those with less than 700 or more than 3000 unique genes, as well as those with >10% mitochondrial gene reads. Clusters of proliferating cells were also removed. Non-CD4+ T cell contaminants were removed using well-known cell-identity markers. Clustering, dimensionality reduction onto UMAP, differential gene expression, and visualization were performed using the built-in functions of Seurat v3. Density distributions were calculated using two-dimensional kernel density estimation.
RNA velocity was performed as described (27). Briefly, the spliced and unspliced counts were calculated from the original sequencing data using the RNA velocity package (26). The spliced and unspliced expression matrices were then integrated into the single-cell data matrix, and the scvelo package was used to calculate the velocity vectors using the dynamical model of transcriptional dynamics and splicing kinetics. The calculated velocity vectors were then projected onto the UMAP embedding calculated during the scRNA-seq analysis.
Lipolysis assays
The in vitro lipolysis assay was adapted from previous studies (32, 33, 79). Briefly, approximately 20mg of epididymal VAT was excised into 200μl of 1g/L glucose DMEM (Gibco) supplemented with 10 mM HEPES, 2% fatty-acid free bovine serum albumin (Sigma), and 5 μM Triacsin C (Sigma) (collectively referred to as “lipolysis buffer”), with or without norepinephrine (A0937 Sigma) for 1 hour at 37°C. Explants were then transferred into fresh lipolysis buffer with or without NE for an additional hour, and the supernatant was collected for glycerol quantification following the manufacturer’s protocol (SGA1, Zenbio). To quantify protein content, the we placed the fat pad into a 1 mL of chloroform:methanol (2:1 v/v) with 1% glacial acetic acid (extraction solution) for 1 hour at 37°C while rotating, and then incubated the material in 500μl of 0.3N NaOH with 0.1% SDS in dH2O (lysis buffer) overnight at 55 °C. The lysis buffer supernatant was taken for protein quantification using the Pierce BCA Assay following the manufacturer’s protocol (Thermofisher). Glycerol release rate was expressed as μM glycerol per milligram protein per hour.
For induction of lipolysis in vivo, 1mg/kg CL316,243 (Sigma) was i.p-injected. Serum was collected via the tail vein using non-heparinized capillary tubes (Fisher) and was allowed to clot at room temperature for 15 minutes. After centrifugation at 2000 × g for 15 minutes, the supernatant was assayed for free fatty acid or glycerol levels following the manufacturer’s protocol (GFA-1 Zenbio).
Foxp3-DTR+ mice was i.p-injected with 20ng per g body weight of DT once per day, at ZT10-ZT12, for three consecutive days.
Organismal metabolism
Organismal metabolism was assessed by the glucose tolerance test (GTT) and insulin tolerance test (ITT). For the GTT, mice were fasted for 5 hours and acclimatized to the experiment room for 45 minutes, followed by intraperitoneal injection of 1g/kg body weight of glucose. Glucose levels were then measured from tail vein blood at 0, 20, 40, 60, 90 and 120 minutes after the glucose injection. For ITT, mice were fasted for 4 hours, followed by 45 minutes of acclimatization to the experiment room. They were intraperitoneally injected with 0.6 unit/kg (Humulin R U-100 from Eli Lilly) body weight, followed by glucose level measurements at 0, 20, 40, 60, 90 and 120 minutes after injection. Blood glucose levels were measured using a Contour glucose meter.
Cellular metabolism
Mitochondrial membrane potential was measured using tetramethylrhodamine ethyl ester perchlorate (TMRE) from Thermofisher. Single-cell suspensions were stained with surface antibodies as described above and washed in FACs buffer. Cells were then incubated in round-bottom 96-well tissue-culture plate (Corning) in 100μl of DMEM + 2% FBS + 10 mM HEPES + 2mM glutamine at 37°C for 30 minutes. Where applicable, cells were treated with 1 μM oligomycin (delivered at 3X concentration in 50 μL) at 37°C for 10 minutes. Finally, cells were stained with 100 μM TMRE (delivered at 4X in 50 μL) at 37°C for 20 minutes. Cells were spun down and resuspended in cold FACs buffer without any further washes before immediate acquisition on the flow cytometer.
Statistical analyses
Data are routinely shown as mean ± SD. Unless stated otherwise, statistical significance was determined by two-tailed Student’s t-test using GraphPad Prism 9.0. * p <0.05; ** p <0.01; *** p < 0001. A value of more than three standard deviations from the mean was adopted as criteria to exclude outliers. Independent replicate experiments were typically performed with at least two biological replicates per group. Circadian rhythmicity of gene expression was assessed using JTK_CYCLE (80). Rhythmic genes were defined as p ≤ 0.05, gene expression ≥ 20, and period ≥ 16 hours. Time of peak expression was determined by JTK_CYCLE.
Supplementary Material
fig. S1: Expression of core-clock genes.
fig. S2: Clock genes confer fitness to VAT Tregs.
fig. S3: Treg heterogeneity.
fig. S4: Characterization of Bmal1Δ Tregs.
fig. S5: VAT Tregs regulate adipocyte lipolysis.
fig. S6: TregBmal1WT and TregBmal1Δ mice during HFD challenge
fig. S7: Gating strategies
Table S1: JTK analysis of VAT and splenic Treg transcriptome over circadian time
ACKNOWLEDGEMENTS
We thank Y. Chen, A. Baysoy, K. Seddu, A. Cook, B. Vijaykumar, L. Yang, K. Hattori, Dr. A. Ortiz-Lopez, N. Asinovski, F. Chen, G. Buruzula, A. Wood, C. Araneo, F. Lopez, D. Ischiu, Drs. B. Hanna and M. Marin-Rodero, for experimental assistance, Dr. C. Laplace for graphics, and Dr. B. Spiegelman and his lab for helpful advice. Cell sorting was supported by the Flow Cytometry Core of NIH P30 DK036836 and by the Harvard Medical School Flow Cytometry Core.
FUNDING
This work was supported by the following grants and fellowships: NIH DK092541, NIH RC2DK116691, and the JPB Foundation to D.M; the JPB Foundation and NIH DK45586 to M.L; NIH F32AG072874 to PL and T32GM007753 for TJ.
Footnotes
Published version can be found at: https://www.science.org/doi/10.1126/sciimmunol.abl7641
COMPETING INTERESTS:
The authors declare no competing interests.
DATA AND MATERIALS AVAILABILITY
Population-level RNA-seq between genotypes (GSE206775) and over circadian time (GSE206774), RNA-seq of whole VAT (GSE206776), and scRNA-seq (GSE206949) datasets have been deposited in Gene Expression Omnibus.
References and Notes
- 1.Muñoz-Rojas AR, Mathis D, Tissue regulatory T cells: regulatory chameleons. Nat Rev Immunol. 21, 597–611 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Dispirito JR et al. , Molecular diversification of regulatory T cells in nonlymphoid tissues. Sci Immunol. 3, eaat5861 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Takahashi JS, Transcriptional architecture of the mammalian circadian clock. Nat Rev Genet. 18, 164–179 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Dibner C, Schibler U, Albrecht U, The mammalian circadian timing system: organization and coordination of central and peripheral clocks. Annu Rev Physiol. 72, 517–549 (2010). [DOI] [PubMed] [Google Scholar]
- 5.Saini C et al. , The mammalian circadian timing system: synchronization of peripheral clocks. Cold Spring Harb Symp Quant Biol. 76, 39–47 (2011). [DOI] [PubMed] [Google Scholar]
- 6.Schibler U et al. , Clock-talk: interactions between central and peripheral circadian oscillators in mammals. Cold Spring Harb Symp Quant Biol. 80, 223–232 (2015). [DOI] [PubMed] [Google Scholar]
- 7.Suzuki K et al. , Adrenergic control of the adaptive immune response by diurnal lymphocyte recirculation through lymph nodes. J Exp. Med 213, 2567–2574 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Druzd D et al. , Lymphocyte circadian clocks control lymph node trafficking and adaptive immune responses. Immunity. 46, 120–132 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Shimba A et al. , Glucocorticoids drive diurnal oscillations in T cell distribution and responses by inducing interleukin-7 receptor and CXCR4. Immunity. 48, 286–298 (2018). [DOI] [PubMed] [Google Scholar]
- 10.He W et al. , Circadian expression of migratory factors establishes lineage-specific signatures that guide the homing of leukocyte subsets to tissues. Immunity. 49, 1175–1190 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Yu X et al. , TH17 cell differentiation is regulated by the circadian clock. Science. 342, 727–730 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Hemmers S, Rudensky AY, The cell-intrinsic circadian clock is dispensable for lymphocyte differentiation and function. Cell Rep. 11, 1339–1349 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Hand LE et al. , Regulatory T cells confer a circadian signature on inflammatory arthritis. Nat Commun. 11, 1658 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Feuerer M et al. , Lean, but not obese, fat is enriched for a unique population of regulatory T cells that affect metabolic parameters. Nat Med. 15, 930–939 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kolodin D et al. , Antigen- and cytokine-driven accumulation of regulatory T cells in visceral adipose tissue of lean mice. Cell Metab. 21, 543–557 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Cipolletta D et al. , PPAR-γ is a major driver of the accumulation and phenotype of adipose tissue Treg cells. Nature. 486, 549–553 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Vasanthakumar A et al. , The transcriptional regulators IRF4, BATF and IL-33 orchestrate development and maintenance of adipose tissue-resident regulatory T cells. Nat. Immunol 16, 276–285 (2015). [DOI] [PubMed] [Google Scholar]
- 18.Li C et al. , TCR transgenic mice reveal stepwise, multi-site acquisition of the distinctive fat-Treg phenotype. Cell. 174, 285–299 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Burzyn D et al. , A special population of regulatory T cells potentiates muscle repair. Cell. 155, 1282–1295 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Sefik E et al. , Individual intestinal symbionts induce a distinct population of RORγ+ regulatory T cells. Science. 349, 993–997 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Masri S et al. , Partitioning circadian transcription by SIRT6 leads to segregated control of cellular metabolism. Cell. 158, 659–672 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Ceglia N et al. , CircadiOmics: circadian omic web portal. Nucleic Acids Res. 46, W157–W162 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Mure LS et al. , Diurnal transcriptome atlas of a primate across major neural and peripheral tissues. Science. 359, (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Storch KF et al. , Intrinsic circadian clock of the mammalian retina: importance for retinal processing of visual information. Cell. 130, 730–741 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Eckel-Mahan K, Sassone-Corsi P, Phenotyping Circadian Rhythms in Mice. Curr. Protoc. Mouse. Biol 5, 271–281 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.La Manno G et al. , RNA velocity of single cells. Nature. 560, 494–498 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Bergen V et al. , Generalizing RNA velocity to transient cell states through dynamical modeling. Nat Biotechnol. (2020). [DOI] [PubMed] [Google Scholar]
- 28.Cipolletta D et al. , Appearance and disappearance of the mRNA signature characteristic of Treg cells in visceral adipose tissue: age, diet, and PPARγ effects. Proc Natl Acad Sci U S A. 112, 482–487 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Spallanzani RG et al. , Distinct immunocyte-promoting and adipocyte-generating stromal components coordinate adipose tissue immune and metabolic tenors. Sci Immunol. 4, eaaw3658 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Vasanthakumar A et al. , Sex-specific adipose tissue imprinting of regulatory T cells. Nature. 579, 581–585 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Shostak A, Meyer-Kovac J, Oster H, Circadian regulation of lipid mobilization in white adipose tissues. Diabetes. 62, 2195–2203 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Camell CD et al. , Inflammasome-driven catecholamine catabolism in macrophages blunts lipolysis during ageing. Nature. 550, 119–123 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Schweiger M et al. , Measurement of lipolysis. Methods Enzymol. 538, 171–193 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Patsouris D et al. , PPARα governs glycerol metabolism. J Clin Invest. 114, 94–103 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Li C et al. , Interferon-α-producing plasmacytoid dendritic cells drive the loss of adipose tissue regulatory T cells during obesity. Cell Metab. S1550–4131(21)00277–1 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Fortier EE et al. , Circadian variation of the response of T cells to antigen. J Immunol. 187, 6291–6300 (2011). [DOI] [PubMed] [Google Scholar]
- 37.Nobis CC et al. , The circadian clock of CD8 T cells modulates their early response to vaccination and the rhythmicity of related signaling pathways. Proc Natl Acad Sci U S A. 116, 20077–20086 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Curtis AM et al. , Circadian control of innate immunity in macrophages by miR-155 targeting Bmal1. Proc Natl Acad Sci U S A. 112, 7231–7236 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Oishi Y et al. , Bmal1 regulates inflammatory responses in macrophages by modulating enhancer RNA transcription. Sci Rep. 7, 7086 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Sutton CE et al. , Loss of the molecular clock in myeloid cells exacerbates T cell-mediated CNS autoimmune disease. Nat Commun. 8, 1923 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Early JO et al. , Circadian clock protein BMAL1 regulates IL-1β in macrophages via NRF2. Proc Natl Acad Sci U S A. 115, E8460–E8468 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Alexander RK et al. , Bmal1 integrates mitochondrial metabolism and macrophage activation. eLife. 9, e54090 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Teng F et al. , A circadian clock is essential for homeostasis of group 3 innate lymphoid cells in the gut. Sci Immunol. 4, (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Wang Q et al. , Circadian rhythm-dependent and circadian rhythm-independent impacts of the molecular clock on type 3 innate lymphoid cells. Sci Immunol. 4, (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Mukherji A, Kobiita A, Ye T, Chambon P, Homeostasis in intestinal epithelium is orchestrated by the circadian clock and microbiota cues transduced by TLRs. Cell. 153, 812–827 (2013). [DOI] [PubMed] [Google Scholar]
- 46.Jacobi D et al. , Hepatic Bmal1 regulates rhythmic mitochondrial dynamics and promotes metabolic fitness. Cell Metab. 22, 709–720 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Schmitt K et al. , Circadian control of DRP1 activity regulates mitochondrial dynamics and bioenergetics. Cell Metab. 27, 657–666 (2018). [DOI] [PubMed] [Google Scholar]
- 48.Collins EJ et al. , Post-transcriptional circadian regulation in macrophages organizes temporally distinct immunometabolic states. Genome Res. (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Sardon Puig L, Valera-Alberni M, Canto C, Pillon NJ, Circadian rhythms and mitochondria: connecting the dots. Front Genet. 9, 452 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Kondylis V, Kumari S, Vlantis K, Pasparakis M, The interplay of IKK, NF-κB and RIPK1 signaling in the regulation of cell death, tissue homeostasis and inflammation. Immunol Rev. 277, 113–127 (2017). [DOI] [PubMed] [Google Scholar]
- 51.Blanchett S, Boal-Carvalho I, Layzell S, Seddon B, NF-κB and extrinsic cell death pathways - entwined do-or-die decisions for T cells. Trends Immunol. 42, 76–88 (2021). [DOI] [PubMed] [Google Scholar]
- 52.Peek CB et al. , Circadian clock NAD+ cycle drives mitochondrial oxidative metabolism in mice. Science. 342, 1243417 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Murphy MP, How mitochondria produce reactive oxygen species. Biochem. J 417, 1–13 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.He N et al. , Metabolic control of regulatory T cell (Treg) survival and function by Lkb1. Proc Natl Acad Sci U S A. 114, 12542–12547 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Yang K et al. , Homeostatic control of metabolic and functional fitness of Treg cells by LKB1 signalling. Nature. 548, 602–606 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Weinberg SE et al. , Mitochondrial complex III is essential for suppressive function of regulatory T cells. Nature. 565, 495–499 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Beier UH et al. , Essential role of mitochondrial energy metabolism in Foxp3+ T-regulatory cell function and allograft survival. FASEB J. 29, 2315–2326 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Field CS et al. , Mitochondrial integrity regulated by lipid metabolism is a cell-intrinsic checkpoint for Treg suppressive function. Cell Metab. 31, 422–437 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Duncan RE et al. , Regulation of lipolysis in adipocytes. Annu Rev Nutr. 27, 79–101 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Kosteli A et al. , Weight loss and lipolysis promote a dynamic immune response in murine adipose tissue. J Clin Invest. 120, 3466–3479 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Roth Flach RJ et al. , β3-Adrenergic receptor stimulation induces E-selectin-mediated adipose tissue inflammation. J Biol Chem. 288, 2882–2892 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Grant RW, Stephens JM, Fat in flames: influence of cytokines and pattern recognition receptors on adipocyte lipolysis. Am. J Physiol Endocrinol Metab 309, E205–E213 (2015). [DOI] [PubMed] [Google Scholar]
- 63.Zhang HH et al. , Tumor necrosis factor-alpha stimulates lipolysis in differentiated human adipocytes through activation of extracellular signal-related kinase and elevation of intracellular cAMP. Diabetes. 51, 2929–2935 (2002). [DOI] [PubMed] [Google Scholar]
- 64.Pirzgalska RM et al. , Sympathetic neuron-associated macrophages contribute to obesity by importing and metabolizing norepinephrine. Nat Med. 23, 1309–1318 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Wakamatsu E, Mathis D, Benoist C, Convergent and divergent effects of costimulatory molecules in conventional and regulatory CD4+ T cells. Proc Natl Acad Sci U S A. 110, 1023–1028 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Hassall AH, The microscopic anatomy of the human body: in health and disease (S. Highley, London, 1846). [Google Scholar]
- 67.Crosby P et al. , Insulin/IGF-1 drives PERIOD synthesis to entrain circadian rhythms with feeding time. Cell. 177, 896–909 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Godinho-Silva C et al. , Light-entrained and brain-tuned circadian circuits regulate ILC3s and gut homeostasis. Nature. 574, 254–258 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Guan D et al. , The hepatocyte clock and feeding control chronophysiology of multiple liver cell types. Science. 369, 1388–1394 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Dierickx P et al. , SR9009 has REV-ERB-independent effects on cell proliferation and metabolism. Proc Natl Acad Sci U S A. 116, 12147–12152 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Bettelli E et al. , Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature. 441, 235–238 (2006). [DOI] [PubMed] [Google Scholar]
- 72.Rubtsov YP et al. , Regulatory T cell-derived interleukin-10 limits inflammation at environmental interfaces. Immunity. 28, 546–558 (2008). [DOI] [PubMed] [Google Scholar]
- 73.Picelli S et al. , Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc. 9, 171–181 (2014). [DOI] [PubMed] [Google Scholar]
- 74.McCarthy DJ, Chen Y, Smyth GK, Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids Res. 40, 4288–4297 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Krämer A, Green J, Pollard J Jr., Tugendreich S, Causal analysis approaches in Ingenuity Pathway Analysis. Bioinformatics. 30, 523–530 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Chen EY et al. , Enrichr: interactive and collaborative HTML5 gene list enrichment analysis tool. BMC. Bioinformatics 14, 128 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Kuleshov MV et al. , Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res. 44, W90–W97 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Stuart T et al. , Comprehensive integration of single-cell data. Cell. 177, 1888–1902 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Baskaran P, Thyagarajan B, Measurement of basal and forskolin-stimulated lipolysis in inguinal adipose fat pads. J Vis. Exp (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Hughes ME, Hogenesch JB, Kornacker K, JTK_CYCLE: an efficient nonparametric algorithm for detecting rhythmic components in genome-scale data sets. J Biol Rhythms. 25, 372–380 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
fig. S1: Expression of core-clock genes.
fig. S2: Clock genes confer fitness to VAT Tregs.
fig. S3: Treg heterogeneity.
fig. S4: Characterization of Bmal1Δ Tregs.
fig. S5: VAT Tregs regulate adipocyte lipolysis.
fig. S6: TregBmal1WT and TregBmal1Δ mice during HFD challenge
fig. S7: Gating strategies
Table S1: JTK analysis of VAT and splenic Treg transcriptome over circadian time
Data Availability Statement
Population-level RNA-seq between genotypes (GSE206775) and over circadian time (GSE206774), RNA-seq of whole VAT (GSE206776), and scRNA-seq (GSE206949) datasets have been deposited in Gene Expression Omnibus.
