Skip to main content
NCBI home page
International Journal for Parasitology: Drugs and Drug Resistance logoLink to International Journal for Parasitology: Drugs and Drug Resistance
. 2022 Oct 29;20:108–112. doi: 10.1016/j.ijpddr.2022.10.002

Diethylcarbamazine mediated potentiation of emodepside induced paralysis requires TRP-2 in adult Brugia malayi

Sudhanva S Kashyap 1, Mark A McHugh 1, Alan P Robertson 1, Richard J Martin 1,∗
PMCID: PMC9772243  PMID: 36368250

Abstract

Human and veterinary filarial nematode infections are a major health concern in tropical countries. They are transmitted by biting insects and mosquitoes. Lymphatic filariasis, a group of filarial infections caused by Brugia spp. and Wucheria bancrofti affect more than 120 million people worldwide. Infected individuals develop swollen limbs and disfigurement, leading to an inability to work and ostracization from society. Control and prophylaxis for these infections involve mass drug administration combinations of anthelmintics including diethylcarbamazine (DEC). DEC has actions on microfilariae, but its effects on adult worms are less pronounced. The SLO-1 (BK) channel activator, emodepside, kills adults of many filarial species. However, the in vivo efficacy of emodepside is suboptimal against B. malayi, possibly due to reduced bioavailability in the lymphatic system. Expressing different slo-1 splice variants in B. malayi also affects sensitivity to emodepside. This study explores the potentiation of emodepside mediated paralysis by DEC in adult female B. malayi. Worminator motility measurements show that co-application of DEC and emodepside increases the potency of emodepside 4-fold. The potentiation of the emodepside effect persists even after the worms recover (desensitize) from the initial effects of DEC. RNAi knock-down demonstrates that the DEC-mediated potentiation of emodepside requires the presence of TRP-2 channels. Our study demonstrates that the addition of DEC could enhance the effect of emodepside where bioavailability or activity against a specific species may be low.

Graphical abstract

Image 1

Open in a new tab

1. Introduction

Lymphatic filariases belong to neglected tropical diseases that affect more than 120 million people worldwide. Lymphatic filariasis is caused by adults of filarial parasites including Brugia malayi, Brugia timori, and Wucheria bancrofti, which are transmitted from infected individuals to their new hosts by biting insects. Adult filaria are found in the human lymphatic system. In some individuals, they block the lymphatic vessels, leading to severe itching and skin thickening with gross swelling of infected limbs. This severe disfigurement produces the condition known as elephantiasis. Elephantiasis is associated with an inability to work and often rejection by society. Without effective vaccines and vector control, treatment and prophylactic control of these parasitic nematode infections rely on anthelmintic chemotherapy.

The strategy for controlling filarial nematodes has been to eliminate microfilariae from host blood to prevent transmission via biting insects. Diethylcarbamazine has been used since 1947 and currently is used to treat lymphatic filariasis but not onchocerciasis. Although it is a piperazine derivative, it is not a GABA agonist and has excitatory effects on the nematode muscle (Martin, 1982), which has required further clarification. Other classes of anti-filarial anthelmintics currently used include: the benzimidazoles, like albendazole (ALB), that bind to nematode β-tubulin and inhibit microtubule formation, metabolism, and egg-laying (Lacey, 1990) and; the macrocyclic lactones, like ivermectin (IVM) and moxidectin, that act as activators or positive allosteric modulators of invertebrate glutamate-activated chloride channels (Wolstenholme and Rogers, 2005). The combination of these drugs as a cocktail is used for Mass Drug Administration (MDA) by the WHO for lymphatic filariasis. Unfortunately, while these drugs are very effective in clearing microfilariae, they do not kill all adult worms. The adult worms can survive and propagate the disease for up to 10 years.

Emodepside belongs to the cyclo-octadepsipeptide class of anthelmintics that targets a broad spectrum of parasitic nematodes. Emodepside is active in vitro against microfilaria and adult filaria of many species (Kulke et al., 2017). It is effective in an in vivo model of bovine filaria, Onchocerca ochengi (Bah et al., 2021). Single-dose treatment of emodepside is reported to kill some adult filariae and could prove to be a major advance over current MDA programs that are ineffective against adult filaria.

SLO-1 channels (BK/Maxi K channels) are calcium-activated and voltage-gated potassium channels that regulate neurotransmission and muscle excitability. SLO-1 channels are transmembrane proteins that conduct K+ ions. These channels have a high single-channel conductance (250 pS). SLO-1 channels are essential for the regulation of neurotransmission in nematodes and are found in body-wall muscles and neurons (Wang et al., 2001). SLO-1 channels are activated by emodepside (Guest et al., 2007; Kulke et al., 2014a). In muscle cells of the parasitic nematode Ascaris suum, emodepside elicits K+ currents inhibited by the BK channel antagonist, iberiotoxin (Buxton et al., 2011). SLO-1 channels of the filarial nematode B. malayi heterologously expressed in Xenopus laevis oocytes are also activated by emodepside (Kashyap et al., 2019). In the adult B. malayi, knockdown of slo-1 transcript using dsRNA significantly reduces the emodepside induced paralysis, indicating that emodepside targets SLO-1 (Kashyap et al., 2019).

The in vivo efficacy of emodepside is complex. Whilst emodepside has adulticidal effects against Acanthocheilonema vitae in a single dose regimen, repeated doses were needed to clear Litomosoides sigmodontis (Zahner et al., 2001a). However, emodepside failed to kill B. malayi adults, although it did reduce the microfilaraemia (Zahner et al., 2001a). Various factors were attributed to this lack of effect on B. malayi adults, including the pharmacokinetics of emodepside limiting the distribution and concentration in the lymphatic system.

In this study, we have used motility assays using the Worminator system on adult female B. malayi to describe the potentiation of emodepside effects by DEC. We show that thapsigargin, a SERCA inhibitor that increases cytosolic calcium, also potentiates emodepside. We also show that the DEC potentiation of emodepside is independent of the spastic paralysis produced by DEC because it persists after the adult filariae have recovered their motility in DEC. We used RNAi with dsRNA to knock down the activation of TRP-2 channels by DEC to demonstrate that TRP-2 channels are required for the DEC potentiation of emodepside induced paralysis in B. malayi. These results suggest that a suitable and safe combination of DEC and emodepside could be useful to enhance the effects of emodepside against adults of recalcitrant filarial species.

2. Methods

2.1. Parasite maintenance

B. malayi adults were obtained from the NIH/NIAID Filariasis Research Reagent Resource Center (FR3; College of Veterinary Medicine, University of Georgia, Athens, GA, USA). Adult worms were maintained in non-phenol red Roswell Park Memorial Institute (RPMI) 1640 media (Life Technologies, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Fisher Scientific, USA) and 1% penicillin-streptomycin (Life Technologies, USA). The worms were stored individually in 24 well microtiter plates containing 2 mL RPMI -1640 media and placed in an incubator at 37 °C supplemented with 5% CO2.

2.2. Brugia malayi motility analysis

Each worm was placed in a single well of the microtiter plate containing 1 mL of RPMI media containing L-glutamine. Movement of the worms in each 24-well microtiter plate was analyzed using the Worminator system, as described by Marcellino et al. (2012). Briefly, this is a visual imaging system that automates and quantifies the worm movement on each plate. The velocity of movement of the pixel units of the image of each worm is recorded to generate the motility per minute score.

For emodepside concentration-response analysis, the drugs were added, and the worms were recorded at times 0, 60-, and 120-min post-treatment using the WormAssay v1.4 software. Emodepside concentration response plots were fitted 60 min post emodepside treatment in all experiments. For dsRNA experiments, adult worms were soaked in either 30 μg/mL of Bma trp-2, LacZ dsRNA, or DNA/RNase free water. Motility assays were performed 72 h post dsRNA treatment. The % motility for each worm was calculated using the formula below:

%Motility=Motilityperminutescoreofwormat60minutespostemodepsideMotilityperminutescoreofwormbeforedrugtreatment×100

2.3. Synthesis and delivery of dsRNA

dsRNA was synthesized as explained in (McCoy et al., 2015). Target and non-target T7 promoter labeled primers were amplified using the primers: trp2f, trp2r, trp2t7f and trp2t7r for the target Bma-trp-2 and; LacZF, LacZR, LacZFt7 and LacZRt7 for the non-target LacZ. The sequences of these primers are shown in Table 1. Amplification was done using Techne® PRIMEG (Bibby Scientific Limited, UK) with cycling conditions: 95 °C x 5min, 35 x (95 °C x 30s, 55 °C x 30s, 72 °C x 1min), 72 °C x 10min from sequence-verified cDNA templates. dsRNA was synthesized by T7 RiboMAX™ Express RNAi kit (Promega, USA) according to the manufacturer's instructions. The concentration and purity of dsRNA were assessed using a spectrophotometer. Adult B. malayi were soaked in 30 μg/mL dsRNA for four days. Worms were maintained in RPMI media, as explained before. Worms were snap-frozen in liquid nitrogen and stored at −80 °C for transcript analysis.

Table-1.

List of primers used in this study.

Primer Name Description Sequence 5' - 3′
trp-2f Bma trp-2 dsRNA PCR 5′ AAGAAGTACGTGGACCACCA
trp2r Bma trp-2 dsRNA PCR 3′ TCGAAGTGCAACGGTACATA
trp-2fT7 Bma trp-2 dsRNA PCR with t7 promoter 5′ TAATACGACTCACTATA AAGAAGTACGTGGACCACCA
trp-2rT7 Bma trp-2 dsRNA PCR with t7 promoter 3′ TAATACGACTCACTATA TCGAAGTGCAACGGTACATA
SSK 5F Bma GAPDH 5′ Fwd GACGCTTCAAGGGAAGTGTTTCTG
SSK 5R Bma GAPDH 3′ Rev GTTTTGGCCAGCACCACGAC
LacZF LacZ dsRNA 5′ CGTAATCATGGTCATAGCTGTTTC
LacZR LacZR dsRNA 3′ CTTTTGCTGGCCTTTTGCTC
LacZFt7 LacZ dsRNA with t7 promoter 5′ TAATACGACTCACTATAGGGCGTAATCATGGTCATAGCTGTTTC
LacZRt7 LacZR dsRNA with t7 promoter 3′ TAATACGACTCACTATAGGGCTTTTGCTGGCCTTTTGCTC
Open in a new tab

2.4. Analysis of transcript levels

cDNA from dsRNA-treated worms was amplified using target (Bma trp-2) and reference gene (Bma gapdh) primers (Table- 1). These genes were amplified in triplicate by quantitative real-time PCR (qPCR) using the CFX96 Touch™ Real-Time PCR Detection System and SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad, USA). Cycling conditions used were: 95 °C x 10min, 40 x (95 °C x 10s, 55 °C x 30s). PCR efficiencies were calculated using the CFX96 Software Suite (Bio-Rad, USA). Relative quantification of target gene knockdown was estimated by the ΔΔCt method (Pfaffl, 2001).

2.5. Drugs and solutions

Emodepside and diethylcarbamazine citrate were obtained from Millipore-Sigma (Darmstadt, Germany). They were dissolved in DMSO and water respectively. 1000x stocks were made for each concentration tested so the final concentration of the vehicle did not exceed 0.1%.

2.6. Data analysis

GraphPad Prism 7.0 (San Diego, CA) was used for data analysis. Mean ± S.E. values for each emodepside concentration data point were estimated using 6 to 11 different adult female Brugia worms. % Motility for was plotted against log emodepside concentrations for whole worm concentration-response relationships. Emodepside concentrations were log10 transformed before analysis. Concentration-response plots were constructed by fitting the data by nonlinear regression to determine the pEC50 values. Statistical analyses were performed on groups of values using 2-way ANOVA to determine if the group were significantly different. Bonferroni post hoc tests were used for multiple comparison tests to determine whether there were significant differences between groups. Significance levels were set to P < 0.05.

3. Results and discussion

3.1. DEC potentiates emodepside induced paralysis in adult female B. malayi

Emodepside has adulticidal effects on B. malayi (Kashyap et al., 2019). Sensitivity of emodepside varies between the sexes of adult Brugia: the female worms are 4.5x less sensitive than the males (Kashyap et al., 2019). DEC causes spastic paralysis of the worms, followed by recovery after 100 min (Verma et al., 2020). We tested the effect of 1 μM DEC on the flaccid paralytic effect of emodepside when both drugs were applied simultaneously. Fig. 1A shows concentration-dependent flaccid paralysis effect of emodepside on adult female Brugia. Fig. 1B&C shows that the paralysis caused by emodepside is significantly more potent in the presence of 1 μM DEC. The IC50 for emodepside alone was 447 nM (pIC50 = 6.35 ± 0.09), and for the combination of emodepside + 1 μM DEC, it was 82 nM (pIC50 = 7.08 ± 0.08) (p < 0.001, 2-way ANOVA).

Fig. 1.

Fig. 1

Open in a new tab

Flaccid paralysis produced by emodepside and potentiation by diethylcarbamazine and thapsigargin.

A) Photographs of adult female Brugia malayi in a 96-well plate. A single worm is seen in each well and outlined by red dots. The control worm shows several bends as it moves, but as the emodepside concentration increases, it shows fewer bends and straightens out due to flaccid paralysis.

B) Shows potentiation of inhibitory effect of emodepside by 1 μM DEC. IC50 values were measured 60 min post emodepside treatment. IC50 - emodepside (pink): 447 nM (pIC50 = 6.35 ± 0.09). Emodepside +1 μM DEC (green): 82 nM (pIC50 = 7.08 ± 0.08) DEC had a significant potentiating effect on emodepside: 2-way ANOVA, <0.001. N = 7 worms.

C) (2-way ANOVA, p = 0.007). N = 8 worms for each concentration & DF = 42 for both plots

Shows 1 μM thapsigargin potentiating the effects of emodepside on the motility of adult female B. malayi. IC50: emodepside (pink); 418 nM (pIC50 = 6.38 ± 0.09). Emodepside + thapsigargin (blue): 36 nM (pIC50 = 7.44 ± 0.06). 2-way ANOVA, significance of effect of thapsigargin p < 0.001. N = 7 worms. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

We have previously shown that DEC activates TRP channels in Brugia muscle. TRP-2 channels conduct calcium, and activation of TRP-2 by DEC leads to a calcium influx into the cell (Verma et al., 2020). We hypothesized that increased cytosolic calcium due to DEC could potentiate the emodepside mediated activation of SLO-1 K channels and, therefore, worm paralysis. To test this hypothesis, we used 1 μM thapsigargin – a SERCA inhibitor that increases cytosolic calcium. Simultaneous application of emodepside and 1 μM thapsigargin significantly potentiated the emodepside mediated flaccid paralysis of adult female B. malayi. The IC50 for emodepside in this batch of worms was 418 nM (pIC50 = 6.38 ± 0.09), and in the presence of 1 μM thapsigargin, it was 36 nM (pIC50 = 3.62 ± 0.06), Fig. 1C (p < 0.01, 2-way ANOVA). Treating worms with thapsigargin alone did not produce flaccid paralysis but instead caused a transient spastic paralysis similar to DEC (data not shown).

3.2. DEC desensitization does not affect emodepside potentiation

We have previously shown that the effect of DEC on B. malayi motility is a transient spastic paralysis, lasting ∼100 min and that the worms recover motility within 120 min even when maintained in the presence of the DEC (Verma et al., 2020). We investigated the DEC-mediated potentiation of emodepside to determine whether it was short-lasting and transient. We compared the concentration-dependent effects of emodepside immediately after the application of 1 μM DEC and at 120 min after exposure to 1 μM DEC. We observed no significant difference in emodepside potency in these two sets of worms (Fig, 2A). Thus, the potentiating effect of DEC on the action of emodepside lasts longer than the spastic paralysis that DEC produces.

3.3. TRP-2 activation by DEC required for emodepside potentiation

Using dsRNA treatment as previously described, we knocked down trp-2 in adult female B. malayi (Verma et al., 2017). We observed 82.38% trp-2 transcript knockdown in target dsRNA-treated worms and 20.75% knockdown in lacZ control worms (Fig. S1). We observed no significant change in the potency of emodepside when we compared the trp-2 dsRNA-treated worms and control worms (Fig. 2B). Emodepside IC50 for trp-2 knock-down worms was 288 nM (pIC50 = 6.54 ± 0.07) and for lacZ dsRNA treated control worms, it was 395 nM (pIC50 = 6.40 ± 0.06) (p > 0.05, 2-way ANOVA). These results suggest that TRP-2 channels do not interact genetically with SLO-1 channels in muscle cells.

Fig. 2.

Fig. 2

Open in a new tab

Long-term effects of DEC on emodepside potentiation and effects of TRP channel knockdown.

A) Emodepside concentration-response curves on worms treated with 1 μM DEC at time 0 (pink) and 120 min (black) before emodepside treatment. IC50: 114 nM (pIC50 = 6.94 ± 0.08) and 113 nM (pIC50 = 6.95 ± 0.07) respectively. The best fit lines superimpose.

B) Potency of emodepside is unaltered by the knockdown of trp-2. IC50: lacZ dsRNA + emodepside (pink): 395 nM (pIC50 = 6.40 ± 0.06). IC50: trp-2 dsRNA + emodepside (purple): 288 nM (pIC50 = 6.54 ± 0.07). No significant difference between lacZ and trp-2 dsRNA: 2-way ANOVA, p = 0.44. N = 8 worms.

C) Knockdown of trp-2 blocks the potentiation of emodepside effect caused by 1 μM DEC (blue). Non-specific dsRNA (lacZ) treated worms (pink) show increases sensitivity to emodepside in the presence of DEC. IC50: lacZ dsRNA + emodepside (pink): 321 nM (pIC50 = 6.49 ± 0.08) N = 7. IC50: lacZ dsRNA + emodepside +1 μM DEC (green): 100 nM (pIC50 = 7.01 ± 0.08). IC50: trp-2 dsRNA + emodepside +1 μM DEC (purple): 251 nM (pIC50 = 6.60 ± 0.08) N = 6 worms each. No significant difference was seen between the lacZ + emodepside (pink) and the trp-2 dsRNA + DEC + emodepside (blue); p = 0.57, 2-way ANOVA. . (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

We then treated trp-2 knock-down worms with 1 μM DEC and emodepside simultaneously. We found that DEC did not significantly potentiate emodepside-induced paralysis in the knock-down worms (Fig. 2C). The IC50 values for trp-2 dsRNA treated worms was 251 nM (pIC50 = 6.60 ± 0.8) and was not significantly different from the lacZ control worms, 321 nM (pIC50 = 6.54 ± 0.07) (p > 0.05, 2-way ANOVA). However, we saw significant potentiation of emodepside induced paralysis in lacZ dsRNA treated worms in the presence of 1 μM DEC and observed that the IC50 was reduced to 127 nM (pIC50 = 7 ± 0.08), Fig. 2C (p < 0.05, 2-way ANOVA). The lack of potentiation in trp-2 knock-down worms suggests that activation of the channel by DEC is required for the downstream potentiation of emodepside response.

4. Conclusions

Emodepside has been described as a potent microfilaricide in several studies (Kulke et al., 2014b; Kashyap et al., 2019; Hübner et al., 2021). In an in vivo study in bovines, emodepside showed potent macrofilaricidal effects against O. ochengi (Bah et al., 2021). In other adult filariae, like B. malayi and L. sigmodontis, the efficacy of emodepside in killing the adult worms was very modest (Zahner et al., 2001b). The sensitivity of the worm species appears to vary, as does the concentration of emodepside at the location of the worms in vivo. In dogs treated with an oral dose of emodepside of 1.9 mg/kg, the plasma concentration reaches 125 nM (Krüdewagen et al., 2015), although it is higher in the fat tissue. Worms residing in the lymphatic system may not receive a concentration of emodepside sufficient for the adulticide effect in the lymphatics, and this could explain the lack of effects of emodepside on adult B. malayi. The expression of SLO-1 isoforms also plays an important role in determining emodepside potency. In B. malayi, SLO-1F was described as more sensitive to emodepside than SLO-1A (Kashyap et al., 2019).

Combination therapy is used to treat several different nematode infections. Single-dose combinations of benzimidazoles with pyrantel and oxantel have been advocated against soil-transmitted helminths in recent years with relative success (Moser et al., 2019). MDA for lymphatic filariasis involves the combination of three anthelmintics: albendazole, DEC, and ivermectin. A recent trial found that a single dose of the triple therapy of ALB + DEC + IVM could clear W. bancrofti microfilaria more effectively than the combination of ALB + DEC (King et al., 2018). These previously described combination therapies exploit an additive effect that stems from separate drug target effects. We describe a proof of principle study here, where a combination of diethylcarbamazine and emodepside produces potentiation. The potentiation may be explained by the DEC-induced increase in cytosolic calcium and the calcium-dependent activation of the SLO-1 K channel, the target of emodepside. DEC is predicted to increase the potency of emodepside in vivo and kill worms in body locations where the bioavailability of emodepside is low.

There is an increasing interest in characterizing helminth TRP channels as anthelmintic targets. A recent study found a novel TRPMpzq receptor to be a target of praziquantel in Schistosoma spp. (Park et al., 2019). We have previously described that DEC activates TRPM and TRPC channels in B. malayi (Verma et al., 2020). Here, we observe that DEC potentiation requires the activation of the TRP-2 channel. RNAi of trp-2 in adult B. malayi results in the loss of potentiating effects of DEC. Our result further highlights the role of TRP channels as potential anthelmintic targets.

The potentiation of emodepside by DEC needs to be evaluated in other filarial species both in vitro and in vivo. DEC is currently contraindicated in patients with onchocerciasis, but a low dose of DEC could be helpful in improving the efficacy of emodepside. Emodepside is currently not being evaluated for lymphatic filariasis and its combination with DEC might prove to be very useful.

Declaration of competing interest

All authors have and declare no conflict of interest for the manuscript above for publication in IJPDDR.

Acknowledgments

We want to thank NIH/NIAID Filariasis Research Reagent Repository Center (www.filariasiscenter.org) for the regular supply of adult and microfilariae of Brugia malayi worms. The research was funded by: NIH NIAID grants R01AI047194, R01AI155413 and R21AI138967 to RJM and; The EA Benbrook Endowed Chair of Pathology and Parasitology. The funding agencies had no role in the design, execution or publication of this study. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of Allergy and Infectious Diseases.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.ijpddr.2022.10.002.

Appendix A. Supplementary data

The following is the Supplementary data to this article:

Multimedia component 1
mmc1.pptx (55.5KB, pptx)

References

  1. Bah G.S., Schneckener S., Hahnel S.R., Bayang N.H., Fieseler H., Schmuck G.M., Krebber R., Sarr A., Terjung C., Ngangyung H.F., Ekale D.D., Mfopit Y.M., Rufener L., Graham-Brown J., Tanya V.N., Glenschek-Sieberth M., Kulke D., Makepeace B.L. Emodepside targets SLO-1 channels of Onchocerca ochengi and induces broad anthelmintic effects in a bovine model of onchocerciasis. PLoS Pathog. 2021;17 doi: 10.1371/journal.ppat.1009601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Buxton S.K., Neveu C., Charvet C.L., Robertson A.P., Martin R.J. On the mode of action of emodepside: slow effects on membrane potential and voltage-activated currents in Ascaris suum. Br. J. Pharmacol. 2011;164:453–470. doi: 10.1111/j.1476-5381.2011.01428.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Guest M., Bull K., Walker R.J., Amliwala K., O'Connor V., Harder A., Holden-Dye L., Hopper N.A. The calcium-activated potassium channel, SLO-1, is required for the action of the novel cyclo-octadepsipeptide anthelmintic, emodepside, in Caenorhabditis elegans. Int. J. Parasitol. 2007;37:1577–1588. doi: 10.1016/j.ijpara.2007.05.006. [DOI] [PubMed] [Google Scholar]
  4. Hübner M.P., Townson S., Gokool S., Tagboto S., Maclean M.J., Verocai G.G., Wolstenholme A.J., Frohberger S.J., Hoerauf A., Specht S., Scandale I., Harder A., Glenschek-Sieberth M., Hahnel S.R., Kulke D. Evaluation of the in vitro susceptibility of various filarial nematodes to emodepside. Int J Parasitol Drugs Drug Resist. 2021;17:27–35. doi: 10.1016/j.ijpddr.2021.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Kashyap S.S., Verma S., Voronin D., Lustigman S., Kulke D., Robertson A.P., Martin R.J. Emodepside has sex-dependent immobilizing effects on adult Brugia malayi due to a differentially spliced binding pocket in the RCK1 region of the SLO-1 K channel. PLoS Pathog. 2019;15 doi: 10.1371/journal.ppat.1008041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. King C.L., Suamani J., Sanuku N., Cheng Y.C., Satofan S., Mancuso B., Goss C.W., Robinson L.J., Siba P.M., Weil G.J., Kazura J.W. A trial of a triple-drug treatment for lymphatic filariasis. N. Engl. J. Med. 2018;379:1801–1810. doi: 10.1056/NEJMoa1706854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Krüdewagen E.M., Remer C., Deuster K., Schunack B., Wolken S., Crafford D., Fourie J., Stanneck D. Chemical compatibility and safety of imidacloprid/flumethrin collar (Seresto®) concomitantly used with imidacloprid/moxidectin (Advocate®, Advantage® multi) and emodepside/praziquantel (Profender®) spot-on formulations. Parasitol. Res. 2015;114(Suppl. 1):S55–S80. doi: 10.1007/s00436-015-4514-z. [DOI] [PubMed] [Google Scholar]
  8. Kulke D., Townson S., Struever D., Frohberger S., Specht S., Scandale I., Maclean M., Verocai G., Wolstenholme A., Glenschek-Sieberth M., Harder A., Hoerauf A., Hübner M. ASTMH; Baltimore, USA: 2017. Comparison of the in Vitro Susceptibility to Emodepside of Microfilariae, Third-Stage Larvae and Adult Worms of Related Filarial Nematodes. [Google Scholar]
  9. Kulke D., von Samson-Himmelstjerna G., Miltsch S.M., Wolstenholme A.J., Jex A.R., Gasser R.B., Ballesteros C., Geary T.G., Keiser J., Townson S., Harder A., Krücken J. Characterization of the Ca2+-gated and voltage-dependent K+-channel Slo-1 of nematodes and its interaction with emodepside. PLoS Neglected Trop. Dis. 2014;8 doi: 10.1371/journal.pntd.0003401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Kulke D., von Samson-Himmelstjerna G., Miltsch S.M., Wolstenholme A.J., Jex A.R., Gasser R.B., Ballesteros C., Geary T.G., Keiser J., Townson S., Harder A., Krücken J. Characterization of the Ca2+-gated and voltage-dependent K+-channel Slo-1 of nematodes and its interaction with emodepside. PLoS Neglected Trop. Dis. 2014;8 doi: 10.1371/journal.pntd.0003401. e3401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Lacey E. Mode of action of benzimidazoles. Parasitol. today. 1990;6:112–115. doi: 10.1016/0169-4758(90)90227-u. [DOI] [PubMed] [Google Scholar]
  12. Marcellino C., Gut J., Lim K.C., Singh R., McKerrow J., Sakanari J. WormAssay: a novel computer application for whole-plate motion-based screening of macroscopic parasites. PLoS Neglected Trop. Dis. 2012;6 doi: 10.1371/journal.pntd.0001494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Martin R.J. Electrophysiological effects of piperazine and diethylcarbamazine on Ascaris suum somatic muscle. Br. J. Pharmacol. 1982;77:255–265. doi: 10.1111/j.1476-5381.1982.tb09294.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. McCoy C.J., Warnock N.D., Atkinson L.E., Atcheson E., Martin R.J., Robertson A.P., Maule A.G., Marks N.J., Mousley A. RNA interference in adult Ascaris suum--an opportunity for the development of a functional genomics platform that supports organism-, tissue- and cell-based biology in a nematode parasite. Int. J. Parasitol. 2015;45:673–678. doi: 10.1016/j.ijpara.2015.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Moser W., Schindler C., Keiser J. In: Advances in Parasitology. Keiser J., editor. Academic Press; 2019. Chapter five - drug combinations against soil-transmitted helminth infections; pp. 91–115. [DOI] [PubMed] [Google Scholar]
  16. Park S.K., Gunaratne G.S., Chulkov E.G., Moehring F., McCusker P., Dosa P.I., Chan J.D., Stucky C.L., Marchant J.S. The anthelmintic drug praziquantel activates a schistosome transient receptor potential channel. J. Biol. Chem. 2019;294:18873–18880. doi: 10.1074/jbc.AC119.011093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Pfaffl M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29 doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Verma S., Kashyap S.S., Robertson A.P., Martin R.J. Functional genomics in Brugia malayi reveal diverse muscle nAChRs and differences between cholinergic anthelmintics. Proc. Natl. Acad. Sci. U.S.A. 2017;114:5539–5544. doi: 10.1073/pnas.1619820114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Verma S., Kashyap S.S., Robertson A.P., Martin R.J. Author Correction: diethylcarbamazine activates TRP channels including TRP-2 in filaria, Brugia malayi. Commun Biol. 2020;3:449. doi: 10.1038/s42003-020-01194-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Wang Z.W., Saifee O., Nonet M.L., Salkoff L. SLO-1 potassium channels control quantal content of neurotransmitter release at the C. elegans neuromuscular junction. Neuron. 2001;32:867–881. doi: 10.1016/s0896-6273(01)00522-0. [DOI] [PubMed] [Google Scholar]
  21. Wolstenholme A.J., Rogers A.T. Glutamate-gated chloride channels and the mode of action of the avermectin/milbemycin anthelmintics. Parasitology. 2005;131(Suppl. l):S85–S95. doi: 10.1017/s0031182005008218. [DOI] [PubMed] [Google Scholar]
  22. Zahner H., Taubert A., Harder A., von Samson-Himmelstjerna G. Filaricidal efficacy of anthelmintically active cyclodepsipeptides. Int. J. Parasitol. 2001;31:1515–1522. doi: 10.1016/s0020-7519(01)00263-6. [DOI] [PubMed] [Google Scholar]
  23. Zahner H., Taubert A., Harder A., von Samson-Himmelstjerna G. Filaricidal efficacy of anthelmintically active cyclodepsipeptides. Int. J. Parasitol. 2001;31:1515–1522. doi: 10.1016/S0020-7519(01)00263-6. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.pptx (55.5KB, pptx)

Articles from International Journal for Parasitology: Drugs and Drug Resistance are provided here courtesy of Elsevier

RESOURCES