Abstract
Background
Genital ulcer disease (GUD) is a sexually transmitted disease characterised by ulcerating lesions. Despite the introduction of sexually transmitted infections (STIs) syndromic management approach into primary healthcare in South Africa (SA) in 1995, the prevalence of STIs in South Africa remains high.
Objectives
The study investigated the aetiology of GUD and factors influencing it among public community health centre (CHC) attendees in the Eastern Cape, South Africa.
Method
A total of 105 participants were recruited among individuals presenting with GUD from three CHCs located in the Eastern Cape Province, South Africa. Blood and genital ulcer samples were collected from consented participants. Blood samples with suitable sera were tested for human immunodeficiency virus (HIV) and syphilis. Herpes simplex virus types 1/2 (HSV–1/2), Chlamydia trachomatis, Treponema pallidum, Haemophilus ducreyi and Klebsiella granulomatis were detected in nucleic acid extracted from genital ulcer specimens.
Results
Out of the 98 samples with suitable sera, 55.1% and 8.2% were HIV and syphilis seropositive, respectively. Ulcerating STI pathogens were detected in 31.4% of the study participants. Herpes simplex virus type 2 was the most detected pathogen (16.2%) followed by Chlamydia trachomatis (10.5%), HSV-1 (8.6%), Haemophilus ducreyi (8.6%) and Treponema pallidum (6.7%). Multiple pathogens were detected in 13.3% of participants. Detected multiple ulcerating pathogens were common among HIV-positives (p = 0.016).
Conclusion
Molecular methods for diagnosing pathogens have the potential to improve the management of GUD. Data generated from this study would contribute to the limited data on GUD in the Eastern Cape Province. Further research with a larger sample size is recommended.
Contribution
Data generated would contribute to the limited data on GUD in the Eastern Cape province, South Africa.
Keywords: genital ulcer disease, sexually transmitted infections, ulcerating pathogens, human immunodeficiency virus, herpes simplex virus
Background
Genital ulcer disease (GUD) is a sexually transmitted disease (STD) characterised by ulcerating lesions on the genital area, perineum or perianal skin.1,2 Genital ulcers may also develop following non-infectious agents, for example, sexual trauma and fixed drug eruptions.2,3 When genital ulceration is a result of an infection, the cause can be an STD such as genital herpes caused by herpes simplex virus type 2 (HSV-2), syphilis caused by Treponema pallidum, chancroid caused by Haemophilus ducreyi, lymphogranuloma venereum (LGV) caused by Chlamydia trachomatis serotypes L1-3 and donovanosis caused by Klebsiella granulomatis.4 Herpes simplex virus type 1 (HSV-1) can also be isolated in genital lesions.5,6,7
Sexually transmitted infections (STIs) are considered a burden to the public health sector, especially in low- and middle-income countries. Asymptomatic cases of STI are also prevalent and can be transmitted, and they have a significant negative impact on STI management.8,9 Management and treatment of STIs are costly to healthcare services.8 In 2018, the World Health Organisation (WHO) estimated one million daily cases of STIs, worldwide.10 In rural KwaZulu-Natal, South Africa (SA), a survey conducted among youth revealed a high burden of STIs with Chlamydia being the highest.11 It was found that syphilis cases among antenatal care attendees were not declining as the cases rose from 1.6% in 2011 to 2.0% in 2015.12 There is a reported noticeable decline in the prevalence of chancroid worldwide although the infection might still occur in some African and Caribbean regions.13,14 Genital herpes was the relatively prevalent aetiology of genital ulcer syndrome.15 Herpes simplex virus type 2 is the major cause of GUD and a highly prevalent STI, worldwide.16 In one South African study, 65.2% of GUD cases had ulcer-derived STI pathogens, with HSV accounting for 60.7% of these cases, followed by Treponema pallidum (3.9%), Chlamydia trachomatis L1-3 (0.9%) and Haemophilus ducreyi (0.5%).17 The proportion of GUD due to bacterial pathogens had dramatically become less in sub-Saharan Africa.18,19
Genital ulceration may be a predisposing or concomitant factor in transmitting HIV.3,20,21 With STIs, the risk of male–female HIV transmission increases; moreover, the female–male transmission becomes even higher.22 The HIV infection enhancement can be because of various processes, such as the disturbance of normal epithelial barriers with ulcerations, causing the recruitment of HIV-susceptible T-lymphocytes or macrophages to the infected area as part of the host’s immune response.22,23 Human immunodeficiency virus-infected persons are more likely to be coinfected with chronic herpesviruses, which replicate periodically producing viable herpes virions.24 A South African study revealed that contracting either HIV or HSV-2 will encourage infection by the other.25
The GUD epidemiology is also influenced by sexual partners’ gender, socioeconomic factors, multiple/increased sexual companions, status on HIV and local prevalence, drug use, limited prevention, inadequate knowledge of STIs, commercial sex and circumcision.26 Young people are at increased risk of acquiring STIs because of their risky behaviour, which is an important health and social concern.27,28 High rate of unprotected sex among the heterosexual and homosexual population is driven by several factors, among which there is fear of being considered unfaithful in the relationship and money and gifts in exchange for sex.29
The syndromic STI management approach is beneficial, but it limits the opportunities for diagnosing asymptomatic STIs.9,30 Syndromic STI management is the diagnosis of STIs based on symptoms and signs, which subsequently leads to their treatment, with point-of-care therapies to treat the majority of microbes that produce specific syndromes without confirmation with the laboratory tests.31 It was introduced into South African primary healthcare in 1995; despite this introduction, the burden of STIs remains high. The WHO recommended that syndromic management algorithms be regularly re-evaluated through performing aetiological and antimicrobial resistance periodically.15 Acyclovir was added for genital herpes patients with first episodes of the disease13; however, treatment failures were reported.5,6
There is limited data on GUD in the King Sabata Dalindyebo local municipality (KSDLM), Eastern Cape province of SA, despite the strong evidence that GUD presents a major health challenge. The lack or shortage of evidence-based data in this locality triggered an interest in investigating the aetiology of GUD and its associated factors, and hence this study among public community health centre (CHC) attendees.
Research methods and design
Study setting and population
The study was conducted in the KSDLM in the OR Tambo district municipality. Participants were from Gateway, Ngangelizwe and Stanford Terrace CHCs. These CHCs were selected from other KSD CHCs based on the highest number of patients seen between April 2016 and August 2016 presenting with STIs according to the statistics by the KSD health department.
Participants presenting with genital ulcers were recruited between May 2018 and July 2019 during their routine visits at the CHCs. Participants were recruited by educating all CHC attendees using GUD posters. Those who self-reported to have the signs and symptoms of GUD (visible, unhealed ulcers) were physically examined and included in the study. Recruitment and informed consent processes were conducted in English and isiXhosa, a locally spoken language. Trained HIV counsellors conducted the pre- and post-HIV counselling at the CHCs.
Participants were interviewed privately to collect socio-demographic and clinical information, followed by clinical examination and sample collection by a research nurse assisted by the investigator. Structured questionnaire forms were administered, explained and completed with the assistance of the research nurse and/or investigator. The nurse performed the clinical examination. Venous blood was collected into plain tubes. Genital ulcers were swabbed using sterile Dacron swabs (Clinical Sciences Diagnostics Ltd, Booysens, SA) and were put in transport medium, stored at −20 °C and transported to the University of KwaZulu-Natal, Microbiology laboratory, Durban, SA for analysis.
Screening of HIV and syphilis
Blood specimens were centrifuged and the sera stored at −80 °C prior to testing for syphilis and HIV. Rapid plasma reagin (RPR) test (Fortress Diagnostics Limited, United Kingdom) was used to test for syphilis followed by Treponema pallidum haemagglutination assay (TPHA) as a confirmatory test (Fortress Diagnostics Limited, United Kingdom). HIV was tested using OnsiteTM HIV 1/2 Ab Plus Combo Rapid Test (CTK Biotech, Inc., Poway, California, United States). The tests were all performed following the manufacturer’s instructions. Rapid plasma reagin /TPHA seropositive participants were referred to the CHC for management.
DNA extraction
Phenol-chloroform (ThermoFisher Scientific) method was used to extract DNA from the genital ulcer swabs according to the manufacturer’s instructions. Genital ulcer disease swabs were resuspended in 500 μL 20% sodium dodecyl sulphate (SDS) and homogenised (Benchmark Scientifics, Bead Blaster 24 homogeniser, 4 pulses × 30 s; 4 m/s; inter-time 10 s; ambient temperature). Samples were centrifuged at 3000 g for 10 min, and the supernatant (500 μL) was transferred into a clean vial. The homogenate (300 μL) was transferred to a new tube, and 300 μL of UltraPure™ phenol:chloroform:isoamyl alcohol (25:24:1, volume per volume [v/v]) (Invitrogen™ UltraPure™) was added and vortexed vigorously for 10 s, microcentrifuged for 3 min at maximum speed, room temperature. The supernatant (300 μL) was transferred to a new tube containing 100 mM of sodium acetate (Merck), 20 μg of glycogen (Invitrogen) and two volumes of absolute ethanol (Merck). The mixture was incubated in ice for 30 min to precipitate the DNA, after which the samples were centrifuged at 15 900 g for 30 min, and the supernatant was discarded. After the evaporation of the ethanol, the DNA was resuspended with 30 μL of ultrapure sterile water and stored at −70 °C. DNA concentration and quality were determined using a Nanodrop 2000 Spectrophotometer (ThermoScientific, Waltham, Massachusetts, United States).
Detection of Genital ulcer disease pathogens
The master mix for HSV-2 (assay ID: Vi04646232_s1), Chlamydia trachomatis (Ba04646249_s1), HSV1, Treponema pallidum, Haemophilus ducreyi and Klebsiella granulomatis was prepared by adding 5 μL polymerase chain reaction (PCR)-grade water (Qiagen, Germany), 0.5 μL FAM-labelled probe/primer mix, 2.5 μL Fast Start 4 × probe master mix (ThermoFisher, Part No. 4444434) and 2 μL DNA to make a volume of 10 μL per sample. Amplification was performed at 95 °C for 30 s followed by 45 cycles comprising denaturation at 95 °C for 3 s and annealing at 60 °C for 30 s. Detection of amplified fluorescent products was carried out at the end of the annealing phase. Published primers and probes43,44 were used for the detection of HSV-1, Chlamydia trachomatis, Treponema pallidum, Haemophilus ducreyi and Klebsiella granulomatis (Table 1). Clinical samples that were PCR positive or negative for HSV-1, HSV-2, Treponema pallidum, Haemophilus ducreyi, Chlamydia trachomatis or Klebsiella granulomatis were included as internal controls. Klebsiella granulomatis was detected using conditions as described by Carter and colleagues.32
TABLE 1.
List of primers and probes used to detect ulcerating pathogens in the study.
| PCR target | DNA target | Primers and probe | Sequences (5’ to 3’) |
|---|---|---|---|
| HSV1 | gB region | HSV1-f | GCAGTTTACGTACAACCACATACAGC |
| HSV1-r | AGCTTGCGGGCCTCGTT | ||
| HSV1-p | FAM- CGGCCCAACATATCGTTGACATGGC-MGB | ||
| Treponema pallidum | GenBank sequence | TP-Zh-131-f | GCCTTTGAGATGGGGATAGC |
| (M88726.1) | TP-Zh-245-r | GTCGCAGGCTCATCTCTGA | |
| TP-Zh-220-p | FAM-CCGCAGCCCCTTTCCTCTCA-MGB | ||
| Haemophilus ducreyi | GenBank | HD-Zh-992-f | ACATCCATAGAAGAACTCAGAGATGA |
| sequences (M75078.1) | HD-Zh-1150-r | TTGAGTTCCCATCAYTACATGCT | |
| HD-Zh-1022-p | FAM-GTGCCTTCGGGAACTATGTGACAGGT-MGB | ||
| Chlamydia trachomatis | Pmp gene | LGV-f | CTG TGC CAA CCT CAT CAT CAA |
| LGV-r | AGA CCC CCT CCG AGC ATC ACT | ||
| LGV-p | FAM-CCT GCT CCA ACA GT-MGB | ||
| Klebsiella granulomatis | phoE | KG-f | CTA TGA CAG CAA GGA TGG CGA |
| KG-r | CAG ACC GAA GTC GAA CTG ATA CTG |
Source: Adapted from Glatz M, Juricevic N, Altwegg M, et al. A multicenter prospective trial to asses a new real-time polymerase chain reaction for detection of Treponema pallidum, herpes simplex-1/2 and Haemophilus ducreyi in genital, anal and oropharyngeal ulcers. Clin Microbiol Infect. 2014;20(12):O1020-7 and Knauf S, Batamuzi EK, Mlengeya T, et al. Treponema infection associated with genital ulceration in wild baboons. Vet Pathol. 2012;49(2):292–303.
HSV1, Herpes simplex virus type 1; DNA, Deoxyribonucleic acid; LGV, lymphogranuloma venereum; PCR, polymerase chain reaction.
Data analysis
All variables were captured and coded in Microsoft excel. Single infection was defined as infection with one pathogen type, while multiple infection was defined as two or more pathogen types in the same sample. GraphPad Prism Software v8.0.1.244 statistical software was used to perform chi-squared for trends, Fisher’s exact to compare the proportion between variables and the relative risk (RR). A p value ≤ 0.05 was used to indicate statistical significance.
Ethical considerations
All study aspects were approved by the Human Research Ethics Committee of Walter Sisulu University (HREC: 015/2016), EC Department of Health (EC_2016RP26_934) and KSD Department of health sub-district, Mthatha. Written informed consent was obtained from participants.
Results
Demographic characteristics of the population
A total of 105 public CHC attendees with GUD participated in the study. The majority were from Gateway CHC (91.4%, 96/105), with only 6.7% (7/105) from Ngangelizwe CHC and 1.9% (2/105) from Stanford Terrace CHC. Participants’ age ranged from 16 to 57 years, with a median of 28 years. Most participants were single (79%, 83/105), female (74.3%, 78/105), living in an informal settlement (54.3%, 57/105) and rural area residents (26.7%, 28/105). The education level ranged from primary to tertiary, with the highest number at secondary level (50.5%, 53/105). The bulk of the participants were unemployed (38.1%, 40/105) and students (26.7%, 28/105). The majority of the participants reported not being substance abusers (alcohol, drugs, smoking of any kind, 68.6%, 72/105), followed by those drinking alcohol with/without dagga (21.9%, 23/105). The majority of the participants were seen to be engaging in unprotected sex (87.6%, 92/105). Almost half the population (47.6%, 50/105) had two or more sexual partners at a time (Table 2).
TABLE 2.
Demographic characteristics of the study population.
| Variable | n | % |
|---|---|---|
| Gender | ||
| Female | 78 | 74.3 |
| Male | 27 | 25.7 |
| Age | ||
| 16–25 years | 41 | 39.0 |
| 26–35 years | 41 | 39.0 |
| 36–57 years | 23 | 21.9 |
| Partners age range | ||
| < 18–39 years | 80 | 76.2 |
| > 40 years | 15 | 14.3 |
| Missing data | 10 | 9.5 |
| Marital status | ||
| Single | 83 | 79.0 |
| Married/widowed/divorced | 17 | 16.2 |
| Missing data | 5 | 4.8 |
| Residence | ||
| Informal settlement | 57 | 54.3 |
| Rural | 28 | 26.7 |
| Semi-urban | 9 | 8.6 |
| Urban | 11 | 10.5 |
| Education | ||
| Primary | 7 | 6.7 |
| Secondary | 53 | 50.5 |
| Matric | 21 | 20.0 |
| Tertiary | 22 | 21.0 |
| Missing data | 2 | 1.9 |
| Occupation | ||
| Employed | 35 | 33.3 |
| Unemployed | 40 | 38.1 |
| Student | 28 | 26.7 |
| Missing data | 2 | 1.9 |
| Substance abuse | ||
| Alcohol, dagga, cigarette | 28 | 26.7 |
| Clean | 72 | 68.6 |
| Missing data | 5 | 4.8 |
| Protected sex | ||
| Yes | 7 | 6.7 |
| No | 92 | 87.6 |
| Missing data | 6 | 5.7 |
| No. of sexual partners | ||
| 1 | 49 | 46.7 |
| ≥ 2 | 50 | 47.6 |
| Missing data | 6 | 5.7 |
Prevalence of laboratory detected ulcerating sexually transmitted infection pathogens and factors among public community health centre attendees with genital ulcer disease
Out of the 98 sera, Treponema pallidum was detected in 33 (8.2%) samples, while 33 of the 105 ulcer swabs (31.4%) were positive for ulcerating STIs. Multiple pathogens were detected in 13.3% (14/105) of specimens. The most commonly detected ulcerating STI was HSV-2, 16.2%, (17/105) followed by Chlamydia trachomatis L1-3, 10.5% (11/105), HSV-1, 8.6% (9/105), Haemophilus ducreyi, 8.6% (9/105) and Treponema pallidum, 6.7% (7/105) and no Klebsiella granulomatis was detected. Prevalence of ulcerating STIs was higher among GUD HIV-negative compared to HIV-positive participants (40.9%, 18/44 vs 22.2%, 12/54, p < 0.001). The ulcerating STIs were detected as single infections among GUD HIV-negative (p < 0.001) and as multiple infections among the HIV-positive (p = 0.016) population (Table 3).
TABLE 3.
Prevalence of ulcerating pathogens among public community health centre attendees with Genital ulcer disease.
| Ulcerating pathogens | Overall (n = 105) |
HIV-negative (n = 44) |
HIV-positive (n = 54) |
p * | |||
|---|---|---|---|---|---|---|---|
| n | % | n | % | n | % | ||
| Prevalence of GUD pathogens | 33 | 31.4 | 18 | 40.9 | 12 | 22.2 | 0.051 |
| Single organisms | 19 | 18.1 | 18 | 40.9 | 5 | 9.3 | < 0.001 |
| Multiple organism (2–4) | 14 | 13.3 | 0 | 0.0 | 7 | 13.0 | 0.016 |
| Herpes simplex virus type 2 | 17 | 16.2 | 9 | 20.5 | 7 | 13.0 | 0.412 |
| Herpes simplex virus type 1 | 9 | 8.6 | 3 | 6.8 | 5 | 9.3 | 0.727 |
| Chlamydia trachomatis L1-3 | 11 | 10.5 | 4 | 9.1 | 6 | 11.1 | > 0.999 |
| Treponema pallidum | 7 | 6.7 | 5 | 11.4 | 1 | 1.9 | 0.087 |
| Haemophilus ducreyi | 9 | 8.6 | 3 | 6.8 | 5 | 9.3 | 0.727 |
| Klebsiella granulomatis | 0 | 0.0 | 0 | 0.0 | 0 | 0.0 | |
| Total GUD pathogens detected | 53 | 50.6 | 24 | 54.5 | 24 | 44.4 | 0.417 |
GUD, genital ulcer disease.
, Compared HIV-positive with HIV-negative. The p-values in bold are significant p < 0.05.
Herpes simplex virus type 2 was more prevalent among HIV-positive participants than HIV-negatives (13%, 7/54 vs 20.5%, 9/44), and this was not statistically significant, p = 0.412. There was no difference among the HIV-positive and HIV-negative participants for HSV-1 (9.3%, 5/54 vs 6.8%, 3/44, p = 0.727) and Haemophilus ducreyi (9.3%, 5/54 vs 6.8%, 3/44, p = 0.727). There was a noticeable difference in the prevalence of Treponema pallidum between HIV-positive and HIV-negative participants (1.9%, 1/54 vs 11.4%, 5/44), respectively, and this was not statistically significant, p = 0.087 (Table 3).
The prevalence of GUD pathogens was higher among male participants than female participants (48.1% vs 25.6%, RR: 0.75, 95% CI: 0.53–0.98, p = 0.053). It was also higher among participants with partners aged < 18–39 years compared with > 40 years (33.8% vs 13.3%, RR: 2.53, 95% CI: 0.84–9.29, p = 0.138) and among participants with matric (28.6%, RR: 0.50, 95% CI: 0.08–2.32, p = 0.639) or tertiary education level (27.3%, RR: 0.52, 95% CI: 0.09–2.44, p = 0.646); however, the associations were not statistically significant (Table 4).
TABLE 4.
Demographic factors associated with laboratory detected ulcerating Sexually transmitted infection pathogens.
| Variable | N | GUD pathogens |
||||
|---|---|---|---|---|---|---|
| n | % | RR | 95% CI | p | ||
| Gender | ||||||
| Female | 78 | 20 | 25.6 | ref | ||
| Male | 27 | 13 | 48.1 | 0.75 | 0.53–0.98 | 0.053 |
| Age | ||||||
| 16–25 years | 41 | 13 | 31.7 | ref | ||
| 26–35 years | 41 | 12 | 29.3 | 1.08 | 0.57–2.08 | > 0.999 |
| 36–57 years | 23 | 8 | 34.8 | 0.91 | 0.46–1.90 | > 0.999 |
| Partners age range | ||||||
| < 18–39 years | 80 | 27 | 33.8 | ref | ||
| > 40 years | 15 | 2 | 13.3 | 2.53 | 0.84–9.29 | 0.138 |
| Missing data | 10 | 4 | 40.0 | 0.84 | 0.44–2.10 | 0.732 |
| Marital status | ||||||
| Single | 83 | 25 | 30.1 | ref | ||
| Married/widowed/divorced | 17 | 6 | 35.3 | 0.85 | 0.45–1.85 | 0.775 |
| Missing data | 5 | 2 | 40.0 | 0.75 | 0.34–2.65 | 0.643 |
| Residence | ||||||
| Informal settlement | 57 | 15 | 26.3 | ref | ||
| Rural | 28 | 11 | 39.3 | 0.67 | 0.36–1.28 | 0.316 |
| Semi-urban | 9 | 4 | 44.4 | 0.59 | 0.29–1.52 | 0.267 |
| Urban | 11 | 3 | 27.3 | 0.96 | 0.39–2.90 | > 0.999 |
| Education | ||||||
| Primary | 7 | 1 | 14.3 | ref | ||
| Secondary | 53 | 18 | 34.0 | 0.42 | 0.07–1.66 | 0.414 |
| Matric | 21 | 6 | 28.6 | 0.50 | 0.08–2.32 | 0.639 |
| Tertiary | 22 | 6 | 27.3 | 0.52 | 0.09–2.44 | 0.646 |
| Missing data | 2 | 2 | 100.0 | 0.14 | 0.03–0.78 | 0.083 |
| Occupation | ||||||
| Employed | 35 | 8 | 22.9 | ref | ||
| Unemployed | 40 | 16 | 40.0 | 0.57 | 0.28–1.13 | 0.140 |
| Student | 28 | 8 | 28.6 | 0.80 | 0.35–1.84 | 0.772 |
| Missing data | 2 | 1 | 50.0 | 0.46 | 0.17–2.59 | 0.432 |
| Substance abuse | ||||||
| Alcohol, dagga, cigarette | 28 | 8 | 28.6 | ref | ||
| Clean | 72 | 22 | 30.6 | 0.94 | 0.46–1.76 | > 0.999 |
| Missing data | 5 | 3 | 60.0 | 0.48 | 0.21–1.40 | 0.304 |
| Protected sex | ||||||
| Yes | 7 | 1 | 14.3 | ref | ||
| No | 92 | 27 | 29.3 | 0.49 | 0.09–1.87 | 0.669 |
| Missing data | 6 | 5 | 83.3 | 0.17 | 0.03–0.73 | 0.029 |
| Number of sexual partners | ||||||
| 1 | 49 | 15 | 30.6 | Ref | ||
| ≥ 2 | 50 | 17 | 34.0 | 0.90 | 0.51–1.59 | 0.831 |
| Missing data | 6 | 1 | 16.6 | 1.84 | 0.48–10.52 | 0.660 |
Note: Missing values reflect in italics
STI, Sexually transmitted infections; GUD, Genital ulcer disease; RR, relative risk.
Condom use was associated with decreased prevalence of GUD pathogens (14.3% vs 29.3%; RR: 0.49, 95% CI: 0.09–1.87), but this was not statistically significant (p = 0.669). The prevalence of GUD pathogens was not influenced by age, residential area, marital status, number of sexual partners or substance abuse (Table 4).
Factors associated with genital ulcer disease among HIV-positive and HIV-negative participants
Among the GUD participants, 55.1% (54/98) were HIV-positive versus 44.9% (44/98) who were HIV-negative, and this was not statistically significant, p = 0.198. A significantly higher population was females in both HIV-positives (77.8%, 42/54 vs 22.2%, 12/54, p < 0.001) and HIV-negatives (65.9%, 29/44; 34.1%, 15/44, p = 0.005). Interestingly, among female participants, a significantly higher proportion of the population was HIV-positive (59.2%, 42/71) than HIV-negative (40.8%, 29/71, p = 0.044); while this was not observed among male participants (p = 0.587, Table 5). Among HIV-negatives, the proportion of the GUD population decreased with increasing age significantly (p < 0.001) but not among HIV-positives (p = 0.683, Figure 1). The majority of the participants were 16–25 years and were HIV-negative (63.2%, 24/38) than HIV-positive (36.8%, 14/38, p = 0.038). In contrast, among the 36–57 years’ group, the majority were HIV-positive (76.2%, 16/21) than HIV-negative (23.8%, 5/21, p = 0.002, Table 5).
TABLE 5.
Factors associated with Genital ulcer disease among HIV-positive and HIV-negative participants.
| Variable | N | HIV-positive |
HIV-negative |
p * | ||||
|---|---|---|---|---|---|---|---|---|
| n | % | p | n | % | p | |||
| Overall | 98 | 54 | 55.1 | 44 | 44.9 | 0.198 | ||
| Gender | ||||||||
| Female | 71 | 42 | 77.8 | ref | 29 | 65.9 | ref | 0.044 |
| Male | 27 | 12 | 22.2 | < 0.001 | 15 | 34.1 | 0.005 | 0.587 |
| Age | ||||||||
| 16–25 years | 38 | 14 | 25.9 | 0.683 | 24 | 54.5 | < 0.001 | 0.038 |
| 26–35 years | 39 | 24 | 44.4 | 15 | 34.1 | 0.069 | ||
| 36–57 years | 21 | 16 | 29.6 | 5 | 11.4 | 0.002 | ||
| Partners age range | ||||||||
| < 18–39 years | 77 | 39 | 72.2 | ref | 38 | 86.4 | ref | > 0.999 |
| > 40 years | 14 | 12 | 22.2 | < 0.001 | 2 | 4.5 | < 0.001 | < 0.001 |
| Missing data | 7 | 3 | 5.6 | < 0.001 | 4 | 9.1 | < 0.001 | > 0.999 |
| Marital status | ||||||||
| Single | 77 | 41 | 75.9 | ref | 36 | 81.8 | ref | 0.519 |
| Married/widowed/divorced | 16 | 11 | 20.4 | < 0.001 | 5 | 11.4 | < 0.001 | 0.076 |
| Missing data | 5 | 2 | 3.7 | < 0.001 | 3 | 6.8 | < 0.001 | > 0.999 |
| Residence | ||||||||
| Informal settlement | 53 | 28 | 51.9 | ref | 25 | 56.8 | ref | 0.698 |
| Rural | 25 | 18 | 33.3 | 0.079 | 7 | 15.9 | < 0.001 | 0.004 |
| Semi-urban | 9 | 4 | 7.4 | < 0.001 | 5 | 11.4 | < 0.001 | > 0.999 |
| Urban | 11 | 4 | 7.4 | < 0.001 | 7 | 15.9 | < 0.001 | 0.395 |
| Education | ||||||||
| Primary | 7 | 5 | 9.3 | ref | 2 | 4.5 | ref | 0.286 |
| Secondary | 48 | 28 | 51.9 | < 0.001 | 20 | 45.5 | < 0.001 | 0.153 |
| Matric | 21 | 14 | 25.9 | 0.041 | 7 | 15.9 | 0.157 | 0.063 |
| Tertiary | 21 | 7 | 13.0 | 0.761 | 14 | 31.8 | 0.002 | 0.063 |
| Missing data | 1 | 0 | 0.0 | 1 | 2.3 | > 0.999 | ||
| Occupation | ||||||||
| Employed | 34 | 25 | 46.3 | ref | 9 | 20.5 | ref | < 0.001 |
| Unemployed | 38 | 23 | 42.6 | 0.847 | 15 | 34.1 | 0.231 | 0.108 |
| Student | 24 | 5 | 9.3 | < 0.001 | 19 | 43.2 | 0.038 | < 0.001 |
| Missing data | 2 | 1 | 1.9 | < 0.001 | 1 | 2.3 | 0.015 | > 0.999 |
| Substance abuse | ||||||||
| Alcohol, dagga | 21 | 12 | 22.2 | ref | 9 | 20.5 | ref | 0.538 |
| Cigarette only | 5 | 4 | 7.4 | 0.055 | 1 | 2.3 | 0.015 | 0.206 |
| Clean | 68 | 36 | 66.7 | < 0.001 | 32 | 72.7 | < 0.001 | 0.607 |
| Missing data | 4 | 2 | 3.7 | 0.008 | 2 | 4.5 | 0.049 | > 0.999 |
| Protected sex | ||||||||
| Yes | 5 | 2 | 3.7 | ref | 3 | 6.8 | ref | > 0.999 |
| No | 88 | 49 | 90.7 | < 0.001 | 39 | 88.6 | < 0.001 | 0.175 |
| Missing data | 5 | 3 | 5.6 | > 0.999 | 2 | 4.5 | > 0.999 | > 0.999 |
| No. of sexual partners | ||||||||
| 1 | 47 | 28 | 51.9 | ref | 19 | 43.2 | ref | 0.098 |
| ≥ 2 | 45 | 22 | 40.7 | 0.335 | 23 | 52.3 | 0.522 | > 0.999 |
| Missing data | 6 | 4 | 7.4 | < 0.001 | 2 | 4.5 | < 0.001 | 0.567 |
, compares HIV-positives and HIV-negatives. The p-values in bold are significant < 0.05.
FIGURE 1.
Human immunodeficiency virus status according to age groups among women and men with genital ulcer disease.
A high proportion of GUD was seen in the participants with partners aged < 18–39 years compared with > 40 years in both HIV-positives (72.2%, 39/54; 22.2% 12/54, p < 0.001) and HIV-negatives (86.4%, 38/44; 4.5%, 2/44, p < 0.001). A significant proportion of the GUD students was HIV-negative compared with the HIV-positive (79.2%, 19/24 vs 28.2%, 5/24, p < 0.001). While in the employed population with GUD, a high proportion was HIV-positive (73.5%, 25/34 vs 26.5%, 9/34, p < 0.001, Table 5). The majority of the population reported single marital status compared with other married/widowed/divorced marital status, in both HIV-positive (75.9%, 41/54; 20.4%, 11/54, respectively, p < 0.001) and HIV-negative (81.8%, 36/44; 11.4%, 5/44, respectively, p < 0.001) groups. Importantly, among the groups with single marital status, the proportion did not differ when stratified according to HIV status (p = 0.519). Similar findings were observed among the married/widowed/divorced marital status group (p = 0.076, Table 5).
Among the GUD HIV-positive group, a higher proportion resided in informal settlement compared with the rural; however, this was not statistically significant (51.9%, 28/54; 33.3%, 18/54; p = 0.079), while among the HIV-negative population, there was a significantly higher proportion (56.8%, 25/44 vs 15.9%, 7/44; p < 0.001). Furthermore, there was a significant higher GUD HIV-positives residing in informal settlement than semi-urban (51.9%, 28/54 vs 7.4%, 4/54; p < 0.001) or urban residents (51.9%, 28/54 vs 7.4%, 4/54; p < 0.001). Similar findings were observed among the GUD HIV-negatives (56.8%, 25/44; 11.4%, 5/44, p < 0.001; 56.8%, 25/44; 15.9%, 7/44; p < 0.001), respectively. The rural GUD population showed a significantly lesser proportion of HIV-negatives compared with HIV-positives (28.0%, 7/25; 72.0%, 18/25; p = 0.004, Table 5).
Few GUD HIV-positive participants had primary than secondary education (9.3%, 5/54; 51.9%, 28/54; p < 0.001) and matric (9.3%, 5/54; 25.9% 14/54, p = 0.041) but not tertiary education (9.3%, 5/54; 13.0% 7/54, p = 0.761). Among GUD HIV-negative participants, a smaller proportion had primary than secondary education (4.5%, 2/44; 45.5%, 20/44; p < 0.001) and tertiary (4.5%, 2/44; 31.8% 14/44, p = 0.002) and matric education (4.5%, 2/44; 15.9% 7/44, p = 0.063). The GUD HIV-positive employed population had higher prevalence of students (46.3%, 25/54; 9.3%, 5/54; p < 0.001) and unemployed population (46.3%, 25/54; 42.6%, 23/54; p = 0.847). In contrast, the GUD HIV-negatives had a lower employed population than students (20.5%, 9/44; 43.2%, 19/44; p = 0.038) followed by unemployed (20.5%, 9/44; 34.1%, 15/44; p = 0.231) but not statistically significant.
Among the GUD HIV-positive population, those that reported clean of substance abuse were significantly higher than alcohol/dagga users (66.7%, 36/54; high 22.2%, 12/54; p < 0.001) as also seen in the HIV-negative group (72.7%, 32/44 vs 20.5%, 9/44; p < 0.001). A significantly high proportion of GUD was seen in the HIV-positive and HIV-negative population, and they reported unprotected sexual intercourse (90.7%, 49/54 vs 3.7%, 2/54; p < 0.001 and 88.6%, 39/44; 6.8%, 3/44; p < 0.001, respectively). There was no difference in the number of sexual partners among the GUD HIV-positive and HIV-negative populations (Table 5).
Discussion
The high number of GUD infections observed among the female participants in the present study could be because of the increased risk of GUD that is associated with the more fragile surface of female reproductive organs.33 The observed low proportion of GUD infections among male participants could be because of less willingness to be involved in a research study or few men with GUD attending the CHC. However, it has been reported that among men, clinically GUD diagnosis is a predictor of re-visiting primary prevention facilities.34
A third of the GUD population had ulcerating STIs. Studies revealed that the development of genital ulcers might not only be because of STIs but also non-infectious agents.2,3 The observed low prevalence of ulcerating pathogens might be because of non-infectious agents2,3 or low viral load of the pathogen that resulted in false-negative results.35,36 There was more than one type of ulcerating STIs in some specimens, and this was prevalent among HIV-population. Previous studies reported that there could be more than one aetiological agent in any genital/anal/perianal ulcer.28 Literature has documented that HIV-population is at increased risk of multiple STIs as pathogens share transmission routes.37
Herpes simplex virus type 2 was reported as the most causative organism of GUD. Similar observations were observed in this study. A South African study also indicated that HSV-2 remained the leading cause of ulcerating STI pathogen, supporting the use of acyclovir in the STI syndromic management.17 Herpes simplex virus type 1 was also one of the causes of GUD in this study. Studies previously conducted have revealed that HSV-1 can also be isolated in genital lesions,5,6,7,26 and this could be because of the increased practice of orogenital sex.38 This study revealed that Chlamydia trachomatis L1-3 was still a burden in SA. Previous studies have reported Chlamydia to be among pathogens causing a high burden of STIs among youth in SA.11 Klebsiella granulomatis was not detected in this study, a finding similar to a previous study that was conducted among the South African population that also reported negative Klebsiella granulomatis in genital ulcer specimens.39 The negative results are probably because of public recognition of Donovanosis as a health problem with control measures or as a result of the improvement of health services or living standards.14
Haemophilus ducreyi was the third-highest ulcerating pathogen in this study. Studies conducted worldwide have reported a decline of chancroid; however, infections might still occur in some African and Caribbean regions.13,14 This calls for review or monitoring of the STI syndromic management approach because Haemophilus ducreyi still seems to be burdensome. The high prevalence of ulcerating STIs among participants living in a semi-urban and rural area compared with participants in informal settlement and urban area residents has been observed in a study conducted in three clinical research sites in Durban, SA, where HSV-2 prevalence was also high among participants in rural/semi-rural areas of Durban. The higher prevalence in rural areas could be attributed to women who have less access to jobs and may engage in more transactional sex. Furthermore, rural areas have less access to healthcare, including STI treatment and free condoms.40 Lower social status, lower education levels and lower income have been associated with increased risk of STIs.41 The informal settlement population was more affected by the GUD and with a higher HIV-positivity rate compared with other population groups in this study; however, the prevalence of GUD pathogen was low.
The GUD prevalence was less dominant among participants with primary education, which is contrary to findings from other studies that reported lower education level as a risk factor for STIs.40 Similarly, others have reported drug use as one of the factors influencing the epidemiology of GUD,26 which is contrary to the current study’s findings, which found no difference in the prevalence of ulcerating STIs among alcohol/dagga/cigarettes and those not using them. Supposedly, this might be because of false reporting. However, the HIV-positivity rate was a bit higher among those taking alcohol/drugs/cigarettes compared to the HIV-negativity rate. Factors such as socioeconomic factors, lack of adequate knowledge of STIs and multiple or increased sexual partners are reported to influence the epidemiology of GUD.26 This is supported by high GUD or ulcerating STIs among the unemployed and no-condom use population in this study.
The HIV seroprevalence rate among GUD participants was high (55.1%). The relationship between genital ulcers and HIV acquisition is well documented in the literature.3,20,21 Disruption of normal epithelial barriers with ulcerations causes recruitment of HIV-susceptible T-lymphocytes or macrophages to the infected area as part of the host’s immune response.22 South African researchers also found the prevalence of HIV co-infection among GUD patients to be high.17
Syphilis serology had different results from the nucleic acid detection method. There was not much difference in percentages, but two samples were positive in both serological and nucleic acid tests. The reason could be that syphilis is a multistage STD. The primary stage is characterised by a chancre, where the test’s sensitivity is high in collected nucleic acid test samples. Serological tests might be negative at the primary stage because of the window period between transmission and seroconversion, and as the stages progress, the serology test would be positive.42
Limitations of the study
The small sample size in this study could be a limitation. Therefore, a larger sample size is recommended. The distribution of participants from the three recruitment sites was not equal, and there were few male participants. Therefore, the results could not be generalised to represent the three CHCs. Despite these limitations, this study remains valuable for the EC population. Further research with larger sample size is recommended.
Conclusion
Herpes simplex virus type 2 was the leading cause of GUD in KSDLM followed by Chlamydia trachomatis L1-3, HSV-1 and Haemophilus ducreyi and Treponema pallidum. The use of molecular methods in diagnosing ulcerating STIs can potentially improve the management of GUD. Sexually transmitted infections/STD and sexual behaviour education interventions remain essential to improve sexual behaviour and reduce the STD burden.
Acknowledgements
The authors wish to acknowledge Sister Z.N. Jafta for participants’ enrolment and sample collection, the staff of the CHCs for use of their facilities and Nelson Mandela Academic Clinical Research Unit for using their facilities for sample storage.
Competing interests
The authors declare that they have no financial or personal relationships that may have inappropriately influenced them in writing this article.
Authors’ contributions
T.R.T. and T.R.A. contributed in conceptualisation of the study. T.R.T. acquired funding. T.R.T., R.S., T.R.A. and Z.Z.A.M contributed in data curation and investigation. Formal analysis was perfomed by T.R.T. and Z.Z.A.M. Resources were provided by R.S., T.R.A. and Z.Z.A.M. The initial draft of the manuscript was written by T.R.T. All authors reviewed, edited and approved the final manuscript.
Funding information
The funder was Walter Sisulu University’s University Capacity Development Grant Research Fund (TRT). Opinions, findings and conclusions or recommendations are those of the authors alone and do not reflect the Walter Sisulu University Research Fund’s opinions.
Data availability
The data that support the findings of this study are available on request from the first author (T.R.T.) and corresponding author (Z.Z.A.M.).
Disclaimer
The views expressed in this article are those of the authors and not reflecting the authors’ affiliated institution or funder.
Footnotes
How to cite this article: Tshaka TR, Singh R, Apalata TR, Mbulawa ZZA. Aetiology of genital ulcer disease and associated factors among Mthatha public clinic attendees. S Afr J Infect Dis. 2022;37(1), a444. https://doi.org/10.4102/sajid.v37i1.444
References
- 1.Cohen DE, Mayer K. Chapter 4. Genital ulcer disease. In: Klausner JD, Hook EW, editors. Current diagnosis & treatment of sexually ransmitted diseases. New York, NY: The McGraw-Hill Companies; 2007. [Google Scholar]
- 2.Roett MA, Mayor MT, Uduhiri KA. Diagnosis and management of genital ulcers. Am Fam Physician. 2012;85(3):254–262. [PubMed] [Google Scholar]
- 3.Misra RS. Sexually transmitted disease and AIDS. New Delhi: Vigyan Prasar; 1996. [Google Scholar]
- 4.Mutua FM, M’imunya JM, Wiysonge CS. Genital ulcer disease treatment for reducing sexual acquisition of HIV. Cochrane Database Syst Rev. 2012;8:CD007933. 10.1002/14651858.cd007933.pub2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.LeGoff J, Péré H, Bélec L. Diagnosis of genital herpes simplex virus infection in the clinical laboratory. Virology J. 2014;11(1):1–17. 10.1186/1743-422x-11-83 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Groves MJ. Genital herpes: A review. Am Fam Physician. 2016;93(11):928–934. [PubMed] [Google Scholar]
- 7.Sarquiz-Martínez B, González-Bonilla CR, Santacruz-Tinoco CE, et al. Differential detection of enterovirus and herpes simplex virus in cerebrospinal fluid by real-time RT-PCR. Intervirology. 2017;60(3):118–124. 10.1159/000480508 [DOI] [PubMed] [Google Scholar]
- 8.Hughes G, Field N. The epidemiology of sexually transmitted infections in the UK: Impact of behavior, services and interventions. Future Microbiol. 2015;10(1):35–51. 10.2217/fmb.14.110 [DOI] [PubMed] [Google Scholar]
- 9.Caruso G, Giammanco A, Virruso R, Fasciana T. Current and future trends in the laboratory diagnosis of sexually transmitted infections. Int J Environ Res Public Health. 2021;18(3):1–17. 10.3390/ijerph18031038 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Morhason-Bello IO, Fagbamigbe AF. Association between knowledge of sexually transmitted infections and sources of the previous point of care among Nigerians: Findings from three national HIV and AIDS reproductive health surveys. Int J Reprod Med. 2020;2020:6481479. 10.1155/2020/6481479 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Francis SC, Mthiyane TN, Baisley K, et al. Prevalence of sexually transmitted infections among young people in South Africa: A nested survey in a health and demographic surveillance site. PLoS Medicine. 2018;15(2):e1002512. 10.1371/journal.pmed.1002512 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Pillay S, Tooke L. Symptomatic congenital syphilis in a tertiary neonatal unit in Cape Town, South Africa: High morbidity and mortality in a preventable disease. S Afr Med J. 2019;109(9):652–658. 10.7196/SAMJ.2019.v109i9.13817 [DOI] [PubMed] [Google Scholar]
- 13.Workowski KA, Bolan GA. Sexually transmitted diseases treatment guidelines. MMWR Recomm Rep; 2015;64(RR-03):1–137. [PMC free article] [PubMed] [Google Scholar]
- 14.Bennett JE, Dolin R, Blaser MJ. Mandell, Douglas, and Bennett’s principles and practice of infectious diseases. 8th ed. In: Bennett JE, Dolin R, Blaser MJ, editors. Philadelphia, PA: Elsevier Saunders; 2015. [Google Scholar]
- 15.Lewis DA, Marumo E. Revision of the national guideline for first-line comprehensive management and control of sexually transmitted infections: What’s new and why? SA Fam Pract. 2010;52(1):20–24. 10.1080/20786204.2010.10873926 [DOI] [Google Scholar]
- 16.Harfouche M, Abu-Hijleh FM, James C, Looker KJ, Abu-Raddad LJ. Epidemiology of herpes simplex virus type 2 in sub-Saharan Africa: Systematic review, meta-analyses, and meta-regressions. eClinicalMedicine. 2021;35:100876. 10.1016/j.eclinm.2021.100876 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kularatne RS, Muller EE, Maseko DV, Kufa-Chakezha T, Lewis DA. Trends in the relative prevalence of genital ulcer disease pathogens and association with HIV infection in Johannesburg, South Africa, 2007–2015. PLoS One. 2018;13(4):e0194125. 10.1371/journal.pone.0194125 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Phiri S, Zadrozny S, Weiss HA, Martinson F, et al. Etiology of genital ulcer disease and association with HIV infection in Malawi. Sex Transm Dis. 2013;40(12):923–928. 10.1097/olq.0000000000000051 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Purwoko MIH, Devi M, Nugroho SA. Granuloma inguinale. BSM: J Biomed. 2021;5(7):659–668. 10.32539/bsm.v5i7.330 [DOI] [Google Scholar]
- 20.O’Farrell N, Morison L, Moodley P, et al. Genital ulcers and concomitant complaints in men attending a sexually transmitted infections clinic: Implications for sexually transmitted infections management. Sex Transm Dis. 2008;35(6):545–549. 10.1097/OLQ.0b013e31816a4f2e [DOI] [PubMed] [Google Scholar]
- 21.Lewis DA, Müller E, Steele L, et al. Prevalence and associations of genital ulcer and urethral pathogens in men presenting with genital ulcer syndrome to primary health care clinics in South Africa. Sex Transm Dis. 2012;39(11):880–885. 10.1097/OLQ.0b013e318269cf90 [DOI] [PubMed] [Google Scholar]
- 22.Ballard RC. Genital herpes and HIV infection: Can we still exploit the intimate relationship? SA J Epidemiol Infect. 2011;26(4):210–214. 10.1080/10158782.2011.11441454 [DOI] [Google Scholar]
- 23.Tu W, Li Y-Y, Kuang Y-Q, et al. High prevalence of sexually transmitted infections and risk factors among HIV-positive individuals in Yunnan, China. Eur J Med Res. 2022;27(1):9. 10.1186/s40001-022-00635-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Stinn T, Kuntz S, Varon D, et al. Subclinical genital herpes shedding in HIV/herpes simplex virus 2-coinfected women during antiretroviral therapy is associated with an increase in HIV tissue reservoirs and potentially promotes HIV evolution. J Virol. 2020;95(1):e01606–e01620. 10.1128/jvi.01606-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Obisesan OS, Sithebe NP, Mufhandu HT. Seroprevalence and characterisation of herpes simplex virus from human immunodeficiency virus in samples collected from the North-West and KwaZulu-Natal Provinces: A retrospective study. F1000Research. 2021;10(105):1–15. 10.12688/f1000research.28105.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Government of Canada . Section 4-4: Canadian guidelines on sexually transmitted Infections – Management and treatment of specific syndromes – Genital Ulcer Disease (GUD). Public Health Agency of Canada PH, editor; 2013. [Google Scholar]
- 27.Mokgatle MM, Madiba S, Cele L. A comparative analysis of risky sexual behaviors, self-reported sexually transmitted infections, knowledge of symptoms and partner notification practices among male and female university students in Pretoria, South Africa. Int J Environ Res Public Health. 2021;18(11):5660. 10.3390/ijerph18115660 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Workowski KA, Bachmann LH, Chan PA, et al. Sexually transmitted infections treatment guidelines, 2021. MMWR Recomme Rep. 2021;70(4):1–187. 10.15585/mmwr.rr7004a1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Tolmay J, Knight L, Muvhango L, Polzer-Ngwato T, Stöckl H, Ranganathan M. Women’s economic contribution, relationship status and risky sexual behaviours: A cross-sectional analysis from a microfinance-plus programme in rural South Africa. AIDS and Behav. 2022;(7):2349–2362. 10.1007/s10461-021-03566-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Onoya D, Manjengwa P, Nattey C, et al. Incidence and predictors of sexually transmitted infections among adult HIV-positive patients receiving antiretroviral therapy at eThmba Lethu HIV clinic in Johannesburg, South Africa. SA Med J. 2021;111(1):80–86. 10.7196/SAMJ.2020.v111i1.14672 [DOI] [PubMed] [Google Scholar]
- 31.Van Gemert C, Hellard M, Bradshaw CS, et al. Syndromic management of sexually transmissible infections in resource-poor settings: A systematic review with meta-analysis of the abnormal vaginal discharge flowchart for Neisseria gonorrhoea and Chlamydia trachomatis. Sex Health. 2017;15(1):1–12. 10.1071/SH17070 [DOI] [PubMed] [Google Scholar]
- 32.Carter JS, Bowden FJ, Bastian I, Myers GM, Sriprakash K, Kemp DJ. Phylogenetic evidence for reclassification of Calymmatobacterium granulomatis as Klebsiella granulomatis comb. nov. Int J Syst Evol Microbiol. 1999;49(4):1695–1700. 10.1099/00207713-49-4-1695 [DOI] [PubMed] [Google Scholar]
- 33.Guan X, Zhang M, Fu M, Luo S, Hu Q. Herpes simplex virus type 2 immediate early protein ICP27 inhibits IFN-β production in mucosal epithelial cells by antagonising IRF3 activation. Front Immunol. 2019;10:290. 10.3389/fimmu.2019.00290 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Sahay S, Gupte N, Brahme RG, et al. Predictors of retention among men attending STI clinics in HIV prevention programs and research: A case control study in Pune, India. PLoS One. 2011;6(3):e17448. 10.1371/journal.pone.0017448 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Komitova RT, Chudomirova KN, Kalchev JV, Genova-Kalou P. From the skin to the brain: A hint to diagnose herpes simplex virus type 2 meningitis. Arch Balk Med Union. 2022;57(1):112–116. 10.31688/ABMU.2022.57.1.14 [DOI] [Google Scholar]
- 36.Denes E, Labach C, Durox H, et al. Intrathecal synthesis of specific antibodies as a marker of herpes simplex encephalitis in patients with negative PCR. Swiss Medical Weekly. 2010;140(3940):w13107. 10.4414/smw.2010.13107 [DOI] [PubMed] [Google Scholar]
- 37.Kalichman SC, Pellowski J, Turner C. Prevalence of sexually transmitted co-infections in people living with HIV/AIDS: Systematic review with implications for using HIV treatments for prevention. Sex Transm Infect. 2011;87(3):183–190. 10.1136/sti.2010.047514 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Holt M, Zerden MJJoP. Adolescent primary genital herpes simplex virus type 1 infection with sepsis secondary to streptococcus pyogenes Bacteremia. J Pediatr Adolesc Gynecol. 2022;35(1):91–93. 10.1016/j.jpag.2021.07.001 [DOI] [PubMed] [Google Scholar]
- 39.Muller EE, Kularatne R. The changing epidemiology of genital ulcer disease in South Africa: Has donovanosis been eliminated? Sex Transm Infect. 2020;96(8):596–600. 10.1136/sextrans-2019-054316 [DOI] [PubMed] [Google Scholar]
- 40.Daniels B, Wand H, Ramjee GJ. Prevalence of herpes simplex virus 2 (HSV-2) infection and associated risk factors in a cohort of HIV negative women in Durban, South Africa. BMC Res Notes. 2016;9(1):1–8. 10.1186/s13104-016-2319-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Huda MN, Ahmed MU, Uddin MB, Hasan MK, Uddin J, Dune TM. Prevalence and demographic, socioeconomic, and behavioral risk factors of self-reported symptoms of sexually transmitted infections (STIs) among ever-married women: Evidence from Nationally representative surveys in Bangladesh. Int J Environ Res Public Health. 2022;19(3):1906. 10.3390/ijerph19031906 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Nieuwenburg S, Zondag H, Bruisten S, et al. Detection of Treponema pallidum DNA during early syphilis stages in peripheral blood, oropharynx, ano-rectum and urine as a proxy for transmissibility. Clin Infect Dis. 2022:ciac056. 10.1093/cid/ciac056 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Glatz M, Juricevic N, Altwegg M, et al. A multicenter prospective trial to asses a new real-time polymerase chain reaction for detection of Treponema pallidum, herpes simplex-1/2 and Haemophilus ducreyi in genital, anal and oropharyngeal ulcers. Clin Microbiol Infect. 2014;20(12):O1020-7. [DOI] [PubMed] [Google Scholar]
- 44.Knauf S, Batamuzi EK, Mlengeya T, et al. Treponema infection associated with genital ulceration in wild baboons. Vet Pathol. 2012;49(2):292–303. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available on request from the first author (T.R.T.) and corresponding author (Z.Z.A.M.).

