Isolation and functional characterization of novel isoprene synthase from Artocarpus heterophyllus (jackfruit)

Abstract

Isoprene, a Natural Volatile Organic Compound (NVOC) is one of the chief by-products of plant metabolism with important applications in the synthesis of rubber and pharmaceuticals as a platform molecule. Isoprene was obtained earlier from petroleum sources; however, to synthesise it new fermentation-based strategies are being adopted. Bioinformatics tools were utilised to isolate the Isoprene Synthase (IspS) gene which converts the precursors Isopentenyl Diphosphate (IPP) and Dimethylallyl Diphosphate (DMAPP) into isoprene. Metabolic engineering strategies were to synthesise an isoprene-producing recombinant clone derived from Artocarpus heterophyllus (jackfruit). The functional characterization was done using the overexpression of the isoprene synthase gene in an Escherichia coli BL21 host. The recombinant clone, ISPS_GBL_001 (submitted to GenBank, National Centre for Biotechnology Information or NCBI) was used for fermentation in the batch and fed-batch mode to produce isoprene. Isoprene productivity of 0.08 g/g dextrose was obtained via the fed-batch mode maintaining the process parameters at optimum. The quantification and confirmation of isoprene was done using gas chromatography (GC) and GC-mass spectrometry (GC–MS) of the extracted sample, respectively. This study makes significant contribution to the ongoing research on bio-isoprene synthesis by highlighting a novel plant source of the IspS gene followed by, its successful expression in a recombinant host, validated by fermentation.

Supplementary Information

The online version contains supplementary material available at 10.1007/s13205-022-03441-7.

Introduction

Less known as 2-methyl-1,3-butadiene, isoprene (C₅H₈) is a five carbon hydrocarbon which is a colourless and volatile liquid at room temperature (Sanadze 2004; Sharkey and Monson 2017; Himmelberger et al. 2018; Lantz et al. 2019). Since then, an assortment of trees were found capable of producing this volatile compound (Jing et al. 2020). Isoprene, a terpenoid compound, occurs extensively in nature in very low concentrations and is metabolized by several organisms, such as animals, plants including macro- and micro-algae, fungi, and bacteria. Isoprene is a commodity chemical used in a spectrum of manufacturing processes (Morais et al. 2015; Singh and Sharma 2015) of a wide range of industrial products, including various elastomers used in surgical gloves, motor mounts, rubber bands, golf balls, condoms and shoes (Wittmann and Liao 2017). Isoprene is an important feedstock in the industry and broadly used in the production of synthetic rubber and for aviation fuel (Harvey and Sharkey 2016). In fact, 5% of the global isoprene production is devoted to the manufacture of chemicals, usually used as intermediates for pharmaceuticals, vitamins, flavourings, perfumes, and epoxy hardeners (Ye et al. 2016). Isoprene is primarily produced via the petrochemical route, such as C5 cracking. Fossil-based approaches for isoprene production are generally either through extraction followed by the distillation method or the catalytic conversion of itaconic acid over a noble metal-based heterogeneous catalyst (Alam et al. 2015; Stadler et al. 2019).

The consensus reached indicated that the petroleum-derived isoprene will not be sufficient to meet global demands and that the price of isoprene will escalate rapidly to unprecedented heights. The isoprene market is expected to touch 2.95 billion US dollars by 2023 with a Compound annual growth rate (CAGR) of 7.4% between 2016 and 2021. Some of the major players in the isoprene market include Nizhnekamskneftekhim (Russia), SIBUR (Russia), The Goodyear Tire & Rubber Company (U.S.), Royal Dutch Shell PLC (Netherlands), Kuraray Co. Ltd. (Japan), ZEON Corporation (Japan), and Lyondell Basell Industries N.V. (U.S) (Batten et al. 2021). Compared to the other bio-based chemicals, isoprene production through fermentation is distinguished by the recovery of the product as a gas rather than as a liquid, due to its low boiling point (34 °C) and low solubility in water. During fermentation, isoprene can be continuously recovered from the off-gas outside the production vessel, resulting in several potential benefits (14). Isoprene is synthesized by the transformation of the subunits of Dimethyl-allyl diphosphate (DMAPP) and isopentenyl diphosphate (IPP) by isoprene synthase. There were the two known potential pathways for isoprene synthesis; the mevalonate (MVA) pathway (Abdul Rahman et al. 2019; Martin et. al. 2003) and the 1-deoxy-D-xylulose-5-phosphate (DXP) pathway. However, a recently discovered non mevalonate or 3-C-methyl-D-erythritol 4-phosphate (MEP) pathway has been discovered (Yang et al. 2016; Volke et al. 2019) as shown in Fig. 1. Plants would be unsuitable for large-scale generation of isoprene, due to the difficulty in harvesting and the low conversion efficiency of solar energy (Koppolu and Vasigala 2016). To address the progressively severe energy and environmental crises, biochemical generated from renewable resources could serve as a promising solution. With respect to isoprene as a platform molecule, fermentation has been a very nominally explored pathway for its production. In addition, isoprene capture from its largest reserve, i.e., the environment, is not feasible because it is extremely volatile. Numerous efforts are being made to decode the biochemistry underlying isoprene synthesis, to understand the fermentative routes, yields, and organisms which produce isoprene. This work aims at isolating the genes responsible for the isoprene production from the potential plant candidates and synthesise a genetically engineered species capable of producing isoprene through fermentation.

Fig. 1.

The MVA (mevalonate) and MEP (methylerythritol or non-mevalonate) pathways, commonly found in plants for the biosynthesis of isoprene

This work includes screening the isoprene synthase (IspS) gene drawn from different plants, as well as the transformation of this gene to produce an isoprene producing strain. It is motivated to study isoprene production using the isoprene synthase gene isolated from indigenous plant varieties in India. This will be the first report of the IspS gene isolation from Artocarpus heterophyllus, which will be instrumental in further research on isoprene production via the biological route.

Materials and methods

Materials

The leaves of Artocarpus heterophyllus (jackfruit), Acacia nilotica (Babool), Pithecellobium dulce (Manila tamarind), Thespesia populnea (portia tree), Terminalia catappa (almond), Ficus benghalensis (banyan), Bauhinia purpurea (mountain ebony), Citrus limon (Lemon), Syzygium cumini (java plum), Dalbergia sissoo (Indian rosewood), Ziziphus mauritiana (Indian jujube), Bauhinia racemosa (bidi leaf tree), Mangifera indica (mango), Eucalyptus globulus (eucalyptus), Ficus religiosa (sacred fig) were obtained from different areas in Mumbai, India. The Spectrum plant total RNA isolation kit was procured from Sigma-Aldrich, Missouri, USA. The AMV Reverse Transcription system, Wizard SV Gel and PCR Clean-up system, pGEM-T Easy Vector System kit, PureYield™ Plasmid Miniprep System and all vectors except pMevT and pMBI (Addgene, Massachusetts, USA) were procured from Promega, Wisconsin, USA. All the primers were designed by Eurofins, Bengaluru, India. Gene Racer Kit was procured from Thermo-Fisher Scientific Ltd., Massachusetts, USA. All fermentation culture media and antibiotics (kanamycin, tetracycline and chloramphenicol) were procured from Hi/Media Laboratories, Mumbai, India. All other reagents were procured from Merck, Darmstadt, Germany. The T4 DNA ligase was supplied by New England Biolabs, Massachusetts, USA.

Selection of plants for isoprene gene isolation

Isoprene emissions from plants have been studied extensively over the past few years. However, very few plants from the Indian subcontinent have been researched for their capacity to release isoprene. Varshney et al. studied the isoprene emission rates of forty tropical plants, indigenous to the Indian subcontinent, and found them comparable to those of other screened plant species (Varshney and Singh 2003; Chaliyakunnel et al. 2019). Rashmi et al. studied 80 Indian plant species and detected significant isoprene emissions in the majority of them (Singh et al. 2008). Therefore, in this study, fifteen Indian plant species were selected for screening to identify the presence of the IspS gene.

Messenger ribonucleic acid (mRNA) isolation

Using a mortar and pestle the plant leaves were macerated and liquid nitrogen was used during the grinding process to maintain chilled conditions, thus preventing the activity of the proteases. Diethyl Pyrocarbonate (DEPC) was used to wipe down the working surfaces and equipment to ensure RNAse-free conditions during the isolation of the mRNA. The plants selected for the study were screened adopting a transcriptomic approach Moe et al. (2011). For this, the mRNA isolation was performed using the RNA isolation kit (Chang et al. 2016).

Complementary deoxyribonucleic acid (cDNA) synthesis

The isolated mRNAs were used for cDNA synthesis (Liu et al. 2018), which was done using the Reverse Transcription System. The synthesized cDNAs was confirmed by Polymerase chain reaction (PCR) and subsequent gel electrophoresis.

Screening of plants for gene isolation

The cDNA sequence of the fifteen plant species obtained were compared with the available transcriptome data (Mcgenity et al. 2018) and those which showed the greatest similarity to the transcriptome data were selected as plants with the potential for the isolation of the IspS gene.

Isolation of isoprene synthase (IspS) gene

Primers were designed and synthesized to amplify the IspS gene using the synthesized cDNA. The isoprene synthase gene was partially amplified and confirmed by gel electrophoresis. Further, Rapid Amplification of the cDNA Ends (RACE) was performed using the Gene Racer Kit to obtain the first strand cDNA and using the same, the 5′ and 3′ ends of the IspS gene were obtained (Pade et al. 2016). The amplified products were purified using the PCR Clean-up system and cloned with the pGEM-T Easy Vector System kit (Abraham et al. 2017). The purified vector and amplified product were both restrictions that were digested using, successively, the BamHI HF and NotI HF restriction enzymes. The restriction digested product was purified and ligated with the T4 DNA ligase. The ligated product was then transformed into an E. coli TOP10 host. Further confirmation was provided by restriction digestion and gene sequencing, using the M13 T7 primer (Eurofins, Bengaluru, India). Sequencing data were used to identify the entire gene sequence by employing the bioinformatics tools The Expert Protein Analysis System (ExPasy) and Basic Local Alignment Search Tool (BLAST). Primers were synthesized for the newly identified gene sequence. The entire IspS gene was amplified using the first strand cDNA as the template and newly synthesized primers. This was established through gel electrophoresis. The pMevT, pMBI and pET28(a) vectors were procured and isolated from their respective host cells. The cells containing each of the vectors were grown in the Luria Bertani (LB) media containing selective markers (chloramphenicol for pMBI, tetracycline for pMevT and kanamycin for pET28a) and the vectors were finally isolated using the PureYield™ Plasmid Miniprep System. In the pET28(a) vector, the cloning region selected was between the BamHI and NotI, found between the T7 promoter and histidine Tag (HisTag) region, at the multiple cloning sites. The amplified isoprene synthase gene and pET28a vector were restriction-digested using NotI HF and BamHI HF, and ligated with T4 DNA ligase. Confirmation of successful restriction digestion and ligation was done by gel electrophoresis and PCR (Makam et al. 2018). Successful insertion of the IspS gene was confirmed by gene sequencing.

Transformation cloning and preparation of recombinant expression host for isoprene production

The pMevT vector was transformed into competent E. coli BL21 cells and selected using LB media plates supplemented with 25 µg/mL chloramphenicol. The vector pMBI was then incorporated into the transformed clone. It was selected using LB media supplemented with 25 µg/mL chloramphenicol and 10 µg/ml tetracycline. The clone containing both pMeVT and pMBI vectors was then transformed using the recombinant vector, i.e., pET28(a) with IspS gene and the resultant clones were selected based on antibiotic resistance, using 25 µg/mL chloramphenicol, 10 µg/mL tetracycline and 50 µg/ml kanamycin (Fels et al. 2020).

Optimization of fermentation parameters

The ISPS_GBL_001 clone was used to prepare the isoprene in flask batch in a 250 ml screw-capped Erlenmeyer flask, under anaerobic conditions, by shaking in a REMI CIS-24 PLUS TFT shaking incubator at 30℃ and pH 7 using the Luria Bertani (LB) broth supplemented with 1% dextrose as the fermentation media. During the inoculum development as well as fermentation, kanamycin 50 mg/L, tetracycline 10 mg/L and chloramphenicol 25 mg/L were added to the medium. Isoprene synthesis was induced by the addition of isopropyl β-D-1-thiogalactopyranoside (IPTG). After batch fermentation was completed, the flasks were immediately transferred to 4 °C to prevent isoprene loss through evaporation during extraction. Isoprene synthesis was confirmed by GC–MS analysis. Microbial growth was determined by measuring the optical density at 600 nm wavelength. The Fed-batch mode of fermentation was also performed under the same parameters, during which dextrose was periodically fed to the fermentation to maximise the isoprene yield.

Analytical method

The isoprene was analyzed using gas chromatography on an Agilent 7890 system equipped with a Flame Ionization Detector (FID), the auto-sampler (Autoinjector G4513A) and Agilent DB 624 capillary column (30 m × 530 μm × 3 μm) having phase composition 6% cyanopropyl phenyl and 94% polydimethyl siloxane polymer (Zhou et al. 2020). Nitrogen was used as the carrier gas with a gas flow rate of 1.5 mL/min. The sample was injected at 35 °C, held for 8 min, the temperature was increased by 15 °C/min up to 60 °C and held for 0 min; it was finally increased by 30 °C/min to 250 °C maintaining a hold time of 4 min. Detector temperature is 260 °C. A 0.2 μL sample was injected with a split ratio of 50:1.

Results and discussion

A major concern encountered with isoprene synthesis was that the gene encoding the isoprene synthase (IspS) enzyme, which is responsible for the conversion of the precursors DMAPP and IPP to isoprene, has not yet been identified in bacteria. Therefore, the isolation of the gene from a plant source is the only possible route, as of now, for the development of the isoprene producing strains. However, this approach involves codon optimization. In the non-mevalonate pathway, which has been identified in bacteria, no transcriptional activator or repressors have been discovered as of now (Xue and Ahring 2011). The library of plants used for the isolation of the IspS gene is very small. Newer plant sources, specifically from the Indian subcontinent, are potentially an area of interest. This study includes the screening of several plants, indigenous to the Indian subcontinent, for the presence of the IspS gene, and its further isolation for genetic engineering. From the existing literature on isoprene emissions in Indian plant species, a collection of a variety of eight plants were selected for this study. Conscious efforts were taken to include plants from different genera to broaden the scope of this study.

First, the mRNA was isolated from the leaves of the test plants by an earlier established procedure (Chang et al. 2016). Successful mRNA isolation from the selected indigenous plant species was confirmed by gel electrophoresis (Fig. 2) of the samples. The cDNA was synthesized from the isolated total RNA using the Reverse Transcription System. As it is not feasible to qualitatively estimate the synthesized cDNA using gel electrophoresis, the actin gene sequence, which is a common gene found in the plants included in this study, was used as an indicator of successful cDNA synthesis. Samples from two plants, Artocarpus heterophyllus and Mangifera indica were run on an agarose gel after amplification with the primers for the actin gene sequence, and showed bright bands at 0.5 kb (Fig. 3). This led to the conclusion that the cDNA isolation was successfully completed for all the test plants. A transcriptomic approach (Padmanabhan et al. 2018; Patel et al. 2020; Guo et al. 2021) was undertaken for the identification of the isoprene synthase (IspS) gene sequence. The NCBI search engine was scoured for sequence fragments like the isoprene synthase gene sequence. The GBL_26FW/RW and GBL_27FW/RW primers were then designed based on the search results, complementary to the sequences obtained from the NCBI site (Table 1). The PCR amplification was done (Makam et al. 2018) employing the designed primers and synthesized cDNA and the 0.5 kb band was observed (Fig. 3). The size of the entire isoprene synthase gene is approximately 1.7 kb (Gomaa et al. 2017b). This implied that the partial sequence of the isoprene synthase gene was amplified. Rapid Amplification of cDNA ends (RACE) was done to identify the entire gene sequence (Pade et al. 2016; Freeman 2013). The primers synthesized from the transcriptome data and primers from the RACE kit were used together to obtain the 5ʹ and 3ʹ ends of the isoprene synthase gene. After the PCR amplification was optimized, two bands were observed, one at 1.5 kb for the 5ʹ end and the other at 0.7 kb for the 3ʹ end. The amplified bands were cloned using the pGEM-T vector kit (Abraham et al. 2017) and sequenced. Sequencing data revealed that by aligning both the ends of the gene sequence using BLAST, the entire gene sequence could be identified. Further, new primers (GBL_33FW/RW) were designed (Table 1) for the entire isoprene synthase gene identified and amplification was performed. The amplification was confirmed by gel electrophoresis (Fig. 3). The total sequenced gene was submitted to NCBI GenBank using the BankIT submission tool (Accession number: MZ493337). The DMAPP and IPP, the precursors essential for the isoprene synthesis via the MVA pathway, and present in the pMeVT and pMBI vectors, were used for this study. The pMevT vector was cloned into the BL21 cells and the positive colonies were screened using chloramphenicol-supplemented LB agar plates (Fels et al. 2020). In like manner, the pMBI vector was cloned into the pMevT containing the BL21 cells and screened using tetracycline-containing LB agar plates. For conversion of the DMAPP and IPP to isoprene, the isoprene synthase gene presents in the pET28(a) vector was cloned into the BL21 cells containing the pMevT and pMBI vectors. The positive colonies of the pET28(a) were screened using kanamycin. The final host cells containing all the three vectors were screened using kanamycin, tetracycline and chloramphenicol-supplemented LB agar plates. Further, glycerol stocks were prepared to store the positive colonies. This isolated recombinant strain was designated as ISPS_GBL_001. The positive colonies were grown in an LB broth and the cells were separated through centrifugation (8000 × g). Using the lysis method, extraction of the intracellular protein was done (Silver and Fall 1995; Yeom et al. 2018). The purified protein was then collected by passing the crude extract through the Nickel Nitriloacetic Acid (Ni–NTA) resin column. The Ni–NTA resin column specifically binds the 6xHis TAG, normally found in recombinant proteins. The unbound crude extract is removed, and the desired protein is eluted using an elution buffer. The qualitative analysis of the recombinant protein was performed using Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE). The SDS-PAGE showed prominent bands at 62 and 58 KDa, which can be ascribed to the isoprene synthase enzyme subunits.

Fig. 2.

Gel electrophoresis of mRNA isolated from different indigenous India plant species. The figure shows: 1 Ladder, 2 Artocarpus heterophyllus, 3 Dalbergia sisso, 4 Mangifera indica, 5 Acacia nilotica, 6 Citrus limon, 7 Pithecellobium dulce, 8 Ficus benghalensis

Fig. 3.

a Amplified band of actin gene of Artocarpus heterophyllus and Mangifera indica, in well 2 and well 3 respectively. b Partially amplified band of IspS gene from Artocarpus heterophyllus. c Amplified band of 1.5 kb of the complete IspS gene from Artocarpus heterophyllus

Table 1.

List of sequences of the primers used for PCR

Primer name	Primer sequence
GBL_24 FW	ATGGCCGACGCAGAAGATAT
GBL_24 RW	TTAGAAGCACTTCCTGTGGA
GBL_25 FW	ATGGCCGATTCTGAGGAGAT
GBL_25 RW	TTAGAAGCACTTCCTGTGCA
GBL_26 FW	TGGGACATCAAAGCAGTGCAAAC
GBL_26 RW	GGTTTTCTAAGCTCTCAAGTCCC
GBL_27 FW	CATCATGCGTGAAAGCGGGG
GBL_27 RW	GTTCTTTGATCTGGTATCCG
GBL_33 FW	GATCGGATCCATGGCAGAAGCTTTCTTCTTATCTC
GBL_33 RW	GATCGCGGCCGCTTAACTAATGGGATCTACAATCAAA

Overall, this study encompasses the screening of numerous indigenous Indian plants to identify the isoprene synthase gene and their genetic modification using molecular biology techniques for overexpression of the gene. Artocarpus heterophyllus has not been reported earlier as one among the top-ranking producers of environmental isoprene. However, it has shown promising scope when approached from the perspective of molecular biology. The validation of successful genetic modification and gene overexpression was done using fermentation studies.

Fermentation studies

The isoprene production by the newly prepared recombinant expression host was validated by fermentation studies (Zhao et al. 2018). The reaction parameters such as temperature, pH, etc., were optimized by running simultaneous fermentation batches with the pH in the 5–9 range and temperature in the 25–40 °C range. Experiments demonstrated that the maximum biomass production was observed at pH 7 and 25 °C. During optimization, the cell growth of the transformed cells was measured using optical density measurements at 600 nm (OD₆₀₀). The highest cell density achieved was identified at pH 9, with slightly lower values at pH 7 and 8 (Fig. 4). However, the lag phase of the growth curve at pH 9 was relatively longer than that at pH 7 and 8, which is why pH 7 was found to be the optimal for fermentation. The highest optical density was achieved at 25 ℃ (Fig. 4). Hence, these conditions were ideal for the organism growth, and therefore for isoprene production. The optimization of the temperature was also done by simultaneous flask fermentations with temperature variations in the range of 25–40 ℃. A pH value of 7 and stirring speed of 120 rpm were maintained for all the flasks. The OD at 600 nm was periodically measured, which was the optimal temperature for fermentation. Under optimized culture conditions, the maximum isoprene production was observed to occur during the initial 10 h of fermentation, after which a plateauing of the rate of isoprene synthesis was observed. Therefore, it can be hypothesized that the synthesized isoprene present in the headspace, after 10 h, causes a disruption in the MEP pathway, as reported in prior studies, resulting in the low isoprene yields. Due to this bottleneck, an open system fermentation of isoprene is more efficient than a closed system and can produce higher isoprene yields that are nearer to the theoretical isoprene yield of 0.252 g/g of dextrose (Li et al. 2018). Analysis of the glucose and isoprene concentrations was done by gas chromatography. An isoprene yield of 1.092 g/L was obtained in the 30-h batch fermentation (Fig. 4). In the fed-batch technique, dextrose was continuously fed into the system, producing a final yield of 4.2 g/L (Fig. 4). The isoprene synthesis was confirmed by gas chromatography-mass spectrometry (Fig. 5).

Fig. 4.

a Optimization of pH for maximum isoprene yield. b Optimization of temperature for isoprene fermentation. c Batch fermentation for isoprene production. d Fed-batch fermentation for isoprene production

Fig. 5.

GC–MS spectra showing major peaks at 53 m/z and 67 m/z corresponding to isoprene

Isoprene production has been explored by several researchers using genetically modified species. The most predominantly used organism used as host is E. coli. The Escherichia coli MG1655 with the isoprene synthase (PtispS) gene isolated from Populus trichocarpa produced 80 mg/L isoprene (Kim et al. 2016). Reports have described bio-based isoprene production using engineered Bacillus, cyanobacteria, and the Saccharomyces cerevisiae species. For example, the Bacillus DSM10 engineered strain produced 352 μg/L·optical density (OD)-1 of isoprene due to the overexpression of the 1-deoxy-D-xylulose-5-phosphate synthase (dxs) and 1-deoxy-D-xylulose-5-phosphate reductoisomerase (dxr) genes. Moreover, the isoprene titres of 0.32 g/L and 37 mg/L were also obtained through extensive engineering of Synechococcus elongatus and S. cerevisiae, respectively. Lee et al., reported impressive yields, achieving as much as 698 mg/L of isoprene, through the use of the engineered species of E. coli BL21 (Lee et al. 2020). In fact, Gomaa et al., reported isoprene yields of 1434.3 μg/L using recombinant B. subtilis containing the pHT01-kIspS plasmid (Gomaa et al. 2017a). Later, Nitta et al. constructed isoprene-producing strains of Pantoea ananatis (a member of the Enterobacteriaceae family) by integrating a heterologous mevalonate pathway and a metabolic switch that senses the external inorganic phosphate (Pi) levels and reported the highest isoprene yields of 2.5 g/L (Nitta et al. 2020). It was Lee et al., who employed engineered strains of R. eutropha H16 and produced an isoprene yield of 3.8 ± 0.18 μg/L (Lee et al. 2019).

The present study obtained relatively lower isoprene yields from those of the works cited above, which involved the use of genetically modified organisms. However, the isolation of the gene from the Artocarpus plant and its incorporation into a host organism for the fermentative production of isoprene has not been reported. This work is a step forward in the development of a realistic and scalable process for the production of bio-isoprene. There continues to be a huge scope for improvement in the isoprene yields by further metabolic engineering and fermentation optimization.

The isoprene yields achieved by the researchers in this work are comparable to a few other studies using genetically modified organisms. However, there is a scope for further improvement in yields by modification of media composition and process parameters. However, going a step further from this study, more indigenous plant species can be screened for the isoprene synthase gene which could possibly lead to higher yields. Process intensification of the fermentation by using ultrasound or microwave are also possible routes.

Conclusion

In this study, the isoprene synthase gene was isolated for the first time from Artocarpus heterophyllus and cloned successfully into the BL21 cells. Isoprene production was done using the recombinant organism via the MVA pathway. Fermentation was used to validate the presence of the isoprene synthase gene. An isoprene yield of 4.2 g/L was obtained by the fed-batch method with an output of 0.08 g/g dextrose. The identification and isolation of this gene has the scope to be used in an industrially viable process to produce isoprene at a sustainable level. There is immense scope for further work based on this investigation. The resultant isoprene from this study can be potentially used for applications in the aviation and rubber industries. This is a greener approach when seen in contrast to the conventional non-renewable source of isoprene production. The expression of the newly isolated IspS gene can be potentially optimized to achieve much higher yields during fermentation. Further manipulation of the isoprene producing metabolic pathway may lead to the development of a commercially viable process for isoprene synthesis.

Supplementary Information

Below is the link to the electronic supplementary material.

Data availability

The data that supports the findings of this study are available within the article and its supplementary material.

Declarations

Conflict of interest

The authors declare there were no conflicts of interest.