In vitro genome editing activity of Cas9 in somatic cells after random and transposon-based genomic Cas9 integration

Jenny-Helena Söllner; Hendrik Johannes Sake; Antje Frenzel; Rita Lechler; Doris Herrmann; Walter Fuchs; Björn Petersen

doi:10.1371/journal.pone.0279123

. 2022 Dec 30;17(12):e0279123. doi: 10.1371/journal.pone.0279123

In vitro genome editing activity of Cas9 in somatic cells after random and transposon-based genomic Cas9 integration

Jenny-Helena Söllner ¹, Hendrik Johannes Sake ¹, Antje Frenzel ¹, Rita Lechler ¹, Doris Herrmann ¹, Walter Fuchs ², Björn Petersen ^1,^*

Editor: Irina Polejaeva³

PMCID: PMC9803249 PMID: 36584049

Abstract

Due to its close resemblance, the domesticated pig has proven to be a diverse animal model for biomedical research and genome editing tools have contributed to developing porcine models for several human diseases. By employing the CRISPR-Cas9 system, porcine embryos or somatic cells can be genetically modified to generate the desired genotype. However, somatic cell nuclear transfer (SCNT) of modified somatic cells and embryo manipulation are challenging, especially if the desired genotype is detrimental to the embryo. Direct in vivo edits may facilitate the production of genetically engineered pigs by integrating Cas9 into the porcine genome. Cas9 expressing cells were generated by either random integration or transposon-based integration of Cas9 and used as donor cells in SCNT. In total, 15 animals were generated that carried a transposon-based Cas9 integration and two pigs a randomly integrated Cas9. Cas9 expression was confirmed in muscle, tonsil, spleen, kidney, lymph nodes, oral mucosa, and liver in two boars. Overall, Cas9 expression was higher for transposon-based integration, except in tonsils and liver. To verify Cas9 activity, fibroblasts were subjected to in vitro genome editing. Isolated fibroblasts were transfected with guide RNAs (gRNA) targeting different genes (GGTA1, B4GALNT2, B2M) relevant to xenotransplantation. Next generation sequencing revealed that the editing efficiencies varied (2–60%) between the different target genes. These results show that the integrated Cas9 remained functional, and that Cas9 expressing pigs may be used to induce desired genomic modifications to model human diseases or further evaluate in vivo gene therapy approaches.

Introduction

Over the years, the domesticated pig has shown to be invaluable as a protein source for human consumption and a diverse animal model for biomedical research. Pigs show a higher anatomical, physiological, and genetic resemblance to humans than rodents, which still represent the main human disease model [1–3]. Due to these similarities, certain disease progressions are more adequately mimicked in porcine models [4]. Pig models have been developed for a huge variety of human diseases such as cystic fibrosis [5–7], diabetes [8–10], cancer [11–13], X-linked severe combined immunodeficiency [14, 15], and Duchenne muscular dystrophy [16]. While pork production and biomedical research may require different genotypes or phenotypes, recent genetic engineering developments provide benefits for both industries. For example, specific genetic modifications are critical for xenotransplantation to avoid undesired immune reactions towards the porcine donor organ [17]. Recently, the U.S. Food and Drug Administration (FDA) approved pigs (GalSafe) with intentional genomic alteration for meat consumption which potentially can be used for biomedical products such as xenografts for humans [18].

Genome editing technologies such as CRISPR-Cas9 revolutionized targeted genetic engineering in livestock species by their simplicity and efficiency. CRISPR (clustered regularly interspaced short palindromic repeats) and its associated endonuclease protein Cas9 induce double-stranded breaks (DSBs) in the DNA [19] and have been frequently used to modify the genome of animals over the years. Cas9 is guided by a guide RNA (gRNA) recognizing complementary DNA strands. After binding, the Cas9 cleaves the DNA at the target site. However, while in vitro modification became more efficient, the production of genetically modified (GM) pigs remains challenging. GM pigs are either produced by somatic cell nuclear transfer (SCNT) or via micromanipulation or electroporation of zygotes, all are laborious, and require a high expertise. Hence, new means to increase the production efficiency of GM animals are sought. In vivo modifications can be achieved when the Cas9 is integrated into the pig’s genome and gRNAs are directly delivered into specific tissues of living animals. Thereby, germline modifications can be avoided to establish new disease models [20, 21], generate genotypes which are detrimental to embryos, or evaluate approaches for in vivo gene therapies.

In mice, several attempts of in vivo tissue modifications have already proven to be successful [22–24]. In vivo genome editing by injecting Cas9 and selected gRNAs into mice was applied to investigate for example Wolff-Parkinson-White syndrome [22] or lung cancer development [23, 24]. However, the delivery of Cas9 and gRNAs comes with challenges due to the size of the Cas9 expression cassette [25]. Hence, transgenic mice expressing Cas9 were developed to induce the desired genomic modification by only delivering the gRNAs in vivo [20]. To advance the development of pig models for human diseases, Cre-dependent Cas9 expressing pigs were first generated in 2017, showing successes of in vivo genome editing in pigs [21]. Several tumor-suppressing cells were targeted and inactivated by delivering specific gRNAs into the Cas9 expressing pigs, causing tumor formation in different organs [21]. Also, results of targeted Cas9 integration and its functionality in fibroblast, porcine adipose-derived mesenchymal stem cells, and porcine organoids were recently reported [26]. Maintaining breeding lines of Cas9 expressing animals provides opportunities to avoid SCNT or manipulation of early embryos. Therefore, we generated pigs carrying a Cas9 integration by two different approaches and assessed their functionality in vitro.

Material and methods

Ethics statement

All experiments involving animals were approved by the responsible authority (‘Landesamt für Verbraucherschutz und Lebensmittelsicherheit‘ in Lower Saxony, Germany, Animal Experiment No.: TVA 33.8-42502-04-18/2862 and TVA 33.8-42502-04-16/2343). Animals were housed and cared for according to German Animal Welfare regulations.

Generation of Cas9 expressing pigs

Establishment of donor cells

Fetal male fibroblasts were cultured as previously described [27, 28]. In short, culture media consisted of DMEM (Dulbecco´s modified Eagle’s medium) (Capricorn Scientific) supplemented with 2 mM L-glutamine (AppliChem), 0.1 mM mercaptoethanol, 1% 100x penicillin/streptomycin (Pen/Strep), 1% 100x non-essential amino acid, and 1% 100x sodium pyruvate (Sigma-Aldrich), and 10–30% Fetal bovine serum (FBS) (Capricorn-Scientific). The commonly used pX330-U6- Chimeric_BB-CBh-hSpCas9 (pX330) a gift from Feng Zhang (Addgene plasmid # 42230; http://n2t.net/addgene:42230; RRID:Addgene_42230) [29] was used for transfection of porcine fetal fibroblasts to establish a random integration (RI) of Cas9. The vector was previously modified to express a neomycin selection marker (Fig 1). For transposon integration of Cas9, a Sleeping Beauty (SB) transposon vector system was designed. The transgenes Cas9, the gRNA array, and neomycin were flanked by inverted repeats to bind the SB transposase. The SB transposase vector pCMV(CAT)T7-SB100 was a gift from Zsuzsanna Izsvak (Addgene plasmid # 34879; http://n2t.net/addgene:34879; RRID:Addgene_34879) [30]. The SB transposon construct (625 ng/μl) and the SB transposase (595 ng/μl) vector were co-transfected. Cultured cells (3x10⁶) were transfected with a total 5 μg circular plasmid solution. Fibroblast were electroporated with the Neon Transfection System (Invitrogen, Thermo Fisher Scientific) with settings set to 2 x 20ms pulses at 1350 V. Following transfection, cells were cultured in antibiotic-free media for 24 hours. After 24 hours, cells were cultured and selected for neomycin resistance with G418 (800 μg/ml) (Carl Roth) for 10 days.

Fig 1 — A neomycin selection marker driven by the S40 promoter was inserted into the vector to select for fibroblasts with desired vector integration. The gRNA array and Cas9 were driven by a U6 and CAG promoter, respectively.

Characterization of transfected fibroblasts

Selected fibroblasts were treated with lysis buffer (0.02% SDS, 20 mM Tris-HCL) containing proteinase K (50 μg/ml) (Thermo Fisher Scientific) to extract genomic DNA for polymerase chain reaction (PCR). Cas9 was amplified by the following primers: forward primer 5’ ACAAGCTGATCCGGGAAGTG 3’ and reverse primer 5’ ACAAGCTGATCCGGGAAGTG 3’. The selection marker neomycin was amplified with 5’ CAGGATGATCTGGACGAAGA 3‘ and 5‘ GATGCGCTGCGAATCGGGAG 3‘ and the gRNA cassette with 5’ ATGCTTACCGTAACTTGAAAG 3’ and 5’ ATTTGTCTGCAGAATTGGCG 3’ [31].

Somatic cell nuclear transfer

Porcine ovaries were collected at a local slaughterhouse. Aspiration of follicles and maturation of oocytes have been previously described [32]. Briefly, oocytes were matured for 40 hours in maturation media containing FGF2 (Peprotech), LIF (ESGRO Mouse LIF), and IGF1 (R&D Systems) [33]. Cas9 expressing cells were used as donor cells for SCNT. The SCNT protocol has been described in detail by Hölker et. al., (2005) and Petersen et. al., (2008). In short, the metaphase II oocytes were subjected to enucleation by removing the polar body and metaphase plate, followed by fusion of the donor cell and oocyte by an electric pulse and subsequent culture for 20 hours until transfer [27, 28]. Eight German Landrace gilts (7–9 month) were hormonally synchronized with a standard superovulation protocol [28]. Fifty-nine to eighty-five one-two-cell-stage embryos were transferred into gilts. Recipients were checked for pregnancy on day 25 post op by ultrasound scanning. Six gilts established and maintained a pregnancy.

Genotyping offspring

DNA of the piglets was extracted from tail samples. About 50 mg of tail tissue was lysed in tail lysis buffer (50 mM Tris-HCL, 100 mM NaCl, 100 mM EDTA, 1% SDS, and 40 μl 10 mg/ml proteinase K) overnight at 50°C, followed by ethanol precipitation. The samples were eluted in aqua bidest and diluted to a concentration of 20 ng/μl for PCR characterization. PCRs for Cas9, neomycin and gRNA integration were performed as described above. The Cas9 amplicon was purified for Sanger sequencing with Invisorb^® Fragment CleanUp (Invitek Molecular GmbH) diluted to 20 ng/μl and 5 μM of primer was added.

Reverse-transcription qPCR

To determine Cas9 expression in several organs, two boars were sacrificed, one boar with a SB transposon-based integration (SB pig) and one boar with a pX330 random integration (RI pig). Tissue from muscle, tonsil, spleen, kidney, lymph nodes, oral mucosa, and liver was homogenized (100mg) and RNA was isolated with TRIzol^™ Reagent (Invitrogen) according to manufactures’ protocol. Two technical replicates were prepared for RT-qPCR (reverse-transcription qPCR). Isolated RNA was digested with 2 U DNAse I for 30 min at 37°C prior to cDNA synthesis. Synthesis of cDNA was performed according to the protocol with GoScript^™ Reverse Transcriptase (Promega). Quantitative PCR was performed with SYBR^™ Green master mix (Life Technologies). Primer sequences for Cas9 expression were the following 5’ CCCAAGAGGAACAGCGATAAG 3’ and 5’ CTATTCTGTGCTGGTGGTGG 3’. Differential mRNA expression was calculated by the Relative Standard Curve Method. Cas9 expression was normalised to the reference gene GAPDH (Glyceraldehyde 3-phosphate dehydrogenase). A cDNA dilution from pooled muscle RNA was included on every plate to give standard curves for the calculation of relative expression values for Cas9 and GAPDH.

Heritability of vector integration

One cloned and transgenic offspring, boar 762–7 (RI pig), was kept for breeding purposes. After reaching sexual maturity, sperm was collected and frozen according to standard practice. In addition, morphology of the sperm was evaluated. A CASA (Computer Assisted Semen Analysis) analysis was run prior to freezing and after thawing. For in vitro fertilization (IVF), semen was washed with Androhep^® (Minitube) and centrifuged at 600 x g for 6 minutes. To confirm Cas9 integration in semen, sperm was lysed with tail lysis buffer (see above), 0.5% Trition X 100 (Merck), and 40 mM DTT (1,4-Dithiothreitol, Roth) following DNA ethanol precipitation. Cas9 DNA was amplified as described before. Oocyte collection and maturation was performed as describe above. Different sperm concentrations were evaluated for IVF varying from 100–1500 spermatozoa per oocyte. After fertilization, zygotes were cultured in porcine zygote media (PZM-3). Blastocysts were collected on day six, added to 15 μl cell lysis buffer (described previously), and incubated for one hour at 55°C, to evaluate Cas9 integration. For artificial insemination, semen was diluted 1:1 in Androhep^® and transferred twice within 24 hours into a superovulated gilt. The pregnant gilt was sacrificed at day 25 of gestation and fetuses were retrieved from the uterus. DNA was extracted from cephalic parts of the fetuses to detect Cas9 integration.

In vitro activity of Cas9 expression

Fibroblast isolation

Before weaning, fibroblasts were obtained by ear biopsy from transgenic Cas9 positive piglets. Fibroblasts were isolated as previously described [34]. When fibroblasts reached confluency, cells were either frozen or further processed. To obtain Cas9 expressing fetal fibroblasts, boar 762–7 was mated to a wild-type sow, which was slaughtered on day 25 of gestation to retrieve fetuses. Fibroblast cell lines were established from tissues after the removal of excess organs.

Guide RNA transfection

To evaluate Cas9 protein activity in vitro, two cell lines were retrieved from piglets 759–5 and 762–7 (RI pigs) and of piglet 731–1, 732–3, and 733–1 with transposon-based integration. The isolated fibroblasts were transfected with five gRNAs (Table 1). After 762–7 reached sexual maturity and was mated with a wild-type sow, two of the fetal cell lines, 102–12 and 102–14 were also submitted to gRNA transfection. The gRNAs were previously designed and their efficiency tested to induce genomic modifications [35, 36]. The following porcine genes were targeted; beta-2-microglobulin (B2M), Beta-1,4 N-acetylgalactosaminyltransferase 2 (B4GALNT2), and alpha-1,3-galactosyltransferase (GGTA1) to either create an indel (insert and deletion, GGTA1) or a deletion mutation (B2M, B4GALNT2). Guide RNAs were expressed from a plasmid, BPK1520 a gift from Keith Joung (Addgene plasmid # 65777; http://n2t.net/addgene:65777; RRID:Addgene_65777) [37]. Plasmid-based transfection occurred as described earlier.

Table 1. Guide RNA sequences to target B2M, GGTA1, and B4GalNT.

Gene	Sequence 5‘→3‘
B2M #2	`GAGTAAACCTGAACCTTCGG`
B2M #3	`TGAGTTCACTCCTAACGCTG`
B4GALNT2 #3	`ATTGTCTGGGACGTCAGCAA`
B4GALNT2 #4	`AGAGTACCACCTCCACAGAG`
GGTA1	`CTGACGAGTTCACCTACGAG`

Open in a new tab

Validation of edited cell lines

The edited cells were lysed, and target efficiency and specificity were assessed by flow cytometry and next generation sequencing (NGS).

Next generation sequencing

Knock-out efficiency of gRNA transfected Cas9 expressing fibroblasts was determined by next generation sequencing. The transfected cells were lysed (see above) and B2M, B4GALNT2, and GGTA1 products were amplified by PCR (20 cycles). PCR primers amplifying the target genes are given in S1 Table. Amplicons were purified as described before, and DNA concentrations were determined by the Invitrogen Qubit 4 Fluorometer (ThermoFisher Scientific). DNA of the products was pooled by fragment size to a total concentration of 5 nM and sent for MiSeq sequencing (Illumina). Genome editing efficiency of the generated reads was determined with Geneious Prime Version 2021.0.1. The reads were paired, merged and mapped to the reference gene (NCBI Sus scrofa 11.1).

Flow cytometry

Flow cytometry for B2M and GGTA1 was performed to evaluate the editing efficiency of the integrated Cas9. Flow cytometry to detect expression of B4GALNT2 with Dolichos biflorus agglutinin (DBA) in fibroblasts was unsuccessful.

Lectin -based flow cytometry was performed for GGTA1 edited cells to detect α-galactose expression [38]. In total 0.5 x 10⁶ modified and unmodified fibroblast of the same cell line were stained with GSL I-B₄ isolectin conjugated with DyLight 649 (Vector laboratories) for 5 minutes at 37°C. A previously isolated GGTA1 knock-out cell line [36] severed as negative control.

In total 0.5 x 10⁶ B2M modified and unmodified cells were incubated with an anti-swine MHC I monoclonal antibody (Kingfisher-Biotech Inc #WS0550S-100), a PE-Vio labelled IgG2ab secondary anti-mouse antibody (Miltenyi Biotec #130-123-498), and a mouse Ig2b kappa isotype (invitrogen #14-4732-85) as control. In addition, a B2M knock-out fibroblast cell line was stained [36].

Cas9 inhibitor

Anti-CRISPR proteins can inhibit DNA cleavage activities of the Cas9 protein [39]. An anti-CRISPR (acr) protein AcrIIA4 vector, a gift from Dominik Niopek (Addgene plasmid # 113037; http://n2t.net/addgene:113037; RRID:Addgene_113037) [40] was co-transfected (10 μl 280 ng/μl) with GGTA1 and B2M gRNA expressing BPK1520 vectors into fetal fibroblasts of 102–12 to prove that edits resulted from transgenic Cas9 expression. Inhibition of Cas9 genome editing was measured by flow cytometry for GGTA1 and B2M as described before.

Off-targets

In total 15 potential off-target regions were amplified. For each gRNA three of the most likely off-target sequences were selected with CRISPOR (http://crispor.tefor.net/) and validated by PCR (S3 Table) and Sanger sequencing. Sequences were aligned to reference sequences (NCBI sus scrofa 11.1).

Results

Generation of Cas9 expressing pigs

Fibroblasts modified with SB transposon-based Cas9 integration were used for SCNT and transferred into six gilts (Table 2). Out of the six gilts four established pregnancies and delivered 22 SB piglets. Of the 22 piglets 20 were born alive but nine had to be euthanized due to low birth weight and leg deformities related to the SCNT process.

Table 2. Quantitative result from somatic cell nuclear transfer with transposon-based integration (SB pigs).

	Transposon-based integration	Random integration
	Number of animals
Transfers	6	2
Pregnancies	4	2
Zygotes/sow (Total number of zygotes transferred)	59–85 (454)	80 (160)
Piglets (Cloning efficiency %)	22 (4.7–10%)	15 (8.8–10%)

Open in a new tab

Two gilts were subjected to embryo transfers with fibroblasts modified with random Cas9 integration (Table 2). In total, 15 RI piglets were born. One was born dead and two of the remaining piglets had to be euthanized due to SCNT related health issues (low birth weight and leg deformities). All others were healthy and developed normally.

Genotyping founder animals

Two SCNT recipients gave birth to 15 piglets (RI pigs) but surprisingly, only two (759–5 and 762–7) carried a Cas9 integration (Fig 2). In contrast, from the transposon integration of which four sows gave birth to 22 piglets (SB pigs) and 15 were positive for Cas9 integration. Purified PCR amplicons were sent for sequencing and aligned to Cas9 sequence (S1 Fig).

Reverse-transcription qPCR of organ tissue

Cas9 transcription was confirmed by RT-qPCR in muscle, tonsil, spleen, kidney, lymph nodes, oral mucosa, and liver. Cas9 expression was normalised to GAPDH and fold changes were calculated. Tissue with random integration of Cas9 showed lower Cas9 expression compared to transposon-based integration, except in liver and tonsils (Table 3).

Table 3. Cas9 transcription of isolated organ tissue.

Organ	Integration approach	Normalised Cas9 expression¹	Fold change (RI:SB)^*
Muscle	Transposon integration	1.23	0.60
Muscle	Random integration	0.74	0.60
Tonsil	Transposon integration	0.36	1.18
Tonsil	Random integration	0.42	1.18
Spleen	Transposon integration	0.28	0.12
Spleen	Random integration	0.03	0.12
Kidney	Transposon integration	1.53	0.22
Kidney	Random integration	0.34	0.22
Lymph nodes	Transposon integration	0.33	0.22
Lymph nodes	Random integration	0.07	0.22
Oral mucosa	Transposon integration	2.14	0.36
Oral mucosa	Random integration	0.78	0.36
Liver	Transposon integration	0.89	3.87
Liver	Random integration	3.43	3.87

Open in a new tab

¹ $\frac{r e l a t i v e e x p r e s s i o n l e v e l s v a l u e C a s 9}{C t v a l u e G A P D H}$

* Fold changes were compared between tissues isolated from the same organs e.g., liver tissue from random integration (RI) against Sleeping Beauty (SB) transposon-based integration.

Heritability of vector integration

Boar 762–7 (RI pigs) was kept for breeding purposes. After IVF, twelve blastocysts were analyzed to investigate transmission of the Cas9 transgene to the next generation. Ten out of 12 blastocysts revealed a Cas9 integration (Fig 2). One superovulated gilt was artificially inseminated with semen from boar 762–7, (CASA results and Cas9 integration of semen are shown in S2 Fig and S2 Table. On day 25 of gestation, 21 fetuses were retrieved. Genomic analysis revealed Cas9 integration in 11 fetuses (Fig 2).

In vitro activity of Cas9 expression

Isolated fibroblasts of pig 759–5, 762–7, 731–1, 732–3, and 733–1 were transfected with gRNA expressing vectors targeting B2M, B4GalNT, and GGTA1.

Next generation sequencing

Pooled samples of PCR amplicons were sequenced with MiSeq and editing efficiencies were calculated. Sequences for B2M were most abundantly represented in the samples (Table 4). NGS data for B2M revealed an editing efficiency of 7.2% and 3.2% for cells isolated from pigs 759–5 and 762–7, respectively. B2M editing efficiency for transposon-based Cas9 integration from isolated cells from pigs 731–1, 732–3, and 733–1 ranged from 2.7–27.6%. Sufficient coverage for GGTA1sequences was obtained for the cells retrieved from pigs 759–5 and 762–7 with editing efficiencies between 2.7 and 2.9%. GGTA1 reads from isolates of 731–1, 732–3, and 733–1 were underrepresented. Sufficient reads were generated for B4GALNT2 in cells isolated from pigs 731–1, 732–3, and 733–1, with editing efficiency of 36.9%, 60.2%, and 51.2%, respectively.

Table 4. Next generation sequencing editing efficiency and coverage mean.

Transfected cells	Integration approach	Target gene	Editing efficiency %	Coverage mean
759–5	Random integration	B2M	7.2	17322
		GGTA1	2.7	1855
		B4GALNT2	30.7	499
762–7		B2M	3.2	25469
		GGTA1	2.9	3280
		B4GALNT2	19.4	719
731–1	Transposon-based integration	B2M	27.6	7358
		GGTA1	0.1	209
		B4GALNT2	36.9	1390
732–3		B2M	2.7	13039
		GGTA1	0.3	947
		B4GALNT2	60.2	6298
733–1		B2M	3.4	18097
		GGTA1	na^*	na^*
		B4GALNT2	51.2	3209

Open in a new tab

* No reads were generated

Flow cytometry GGTA1

Phenotypic modifications of transgenic Cas9 fibroblasts were assessed after transfection of gRNAs targeting GGTA1 by measuring expression of α-galactose. A GGTA1 knock-out cell line served as negative control. MFI (Median fluorescent intensity) for SB pig cell lines 731–1, 732–3, and 733–1 declined by 5.44, 18.59, and 45.59%, respectively (Table 5 and Fig 3A). As shown in Table 5 and Fig 3B the GGTA1 gRNA transfected cells of RI pigs 759–5 and 762–7 had a decreased MFI of 9.45% and 9.34% compared to untreated cells. Transgenic fetal fibroblasts (102–12 and 102–14) sired by 762–7 (RI pig) were also transfected with a gRNAs targeting GGTA1. Compared to the untreated controls the MFI decreased by 43.87% from cells retrieved from 102–12 and by 56.34% in 102–14 cells (Table 5 and Fig 3C).

Table 5. Median fluorescent intensity (MFI) of GGTA1 gRNA transfected cells.

Cell line	MFI GGTA1 knock-out^* cells	MFI untreated cells¹	MFI gRNA transfection cells	MFI reduction (%)⁺
759–5	4.17	13.23	10.01	1.25 (9.45)
762–7	4.17	9.42	8.54	0.88 (9.34)
731–1	4.17	13.42	12.69	0.73 (5.44)
732–3	4.17	19.37	15.77	3.6 (18.59)
733–1	4.17	20.64	11.23	9.41 (45.59)
102–12	3.98	37.18	20.87	16.31 (43.87)
102–14	3.98	35.02	15.29	19.73 (56.34)

Open in a new tab

* Negative control

¹ Positive control

⁺ Reduction between untreated and gRNA transfection

Fig 3 — **(A)** Fibroblasts isolated from transposon-based Cas9 integration founder animals 731–1,732–3, and 733–1 and transfected with GGTA1 gRNA. **(B)** Fibroblasts isolated from random integration founder animals 759–9 and 762–7 and transfected with GGTA1 gRNA **(C)** Isolated Cas9 expressing fetal fibroblasts transfected with GGTA1 gRNA.

Flow cytometry B2M

Similar measurements were made for the expression of MHC-I. Cas9 expressing cells transfected with two gRNAs targeting B2M were stained with a swine MHC-I antibody (Fig 4 and Table 6). A B2M knock-out cell line served as negative control Fibroblasts of RI pig 759–5 showed a reduction of 52.44% in MFI and cells from RI pig 762–7 were reduced by 46.81%. MFI of cells from pigs 731–1, 732–3, and 733–1 (SB pigs) decreased by 17.09, 55.79, and 40.85%, respectively. MFI of fetal fibroblast of 102–12 decreased by 47.43% and of 102–14 by 24.30%.

Fig 4 — **(A)** Fibroblasts isolated from transposon-based Cas9 integration founder animals 731–1,732–3, and 733–1. **(B)** Fibroblasts isolated from random integration founder animals 759–9 and 762–7 **(C)** Isolated Cas9 expressing fetal fibroblasts transfected with B2M gRNAs.

Table 6. Median fluorescent intensity (MFI) of B2M gRNA transfected cells.

Cell line	MFI B2M knock-out cells^*	MFI untreated cells¹	MFI gRNA transfection cells	MFI reduction (%)⁺
759–5	10.74	65.66	31.23	34.43 (52.44)
762–7	10.74	64.48	34.30	30.18 (46.81)
731–1	11.32	15.68	13.00	2.68 (17.09)
732–3	16.23	63.90	28.25	35.65 (55.79)
733–1	11.32	67.86	40.14	27.72 (40.85)
102–12	16.72	32.74	22.22	10.52 (47.43)
102–14	16.72	30.87	23.23	7.5 (24.30)

Open in a new tab

* Negative control

¹ Positive control

⁺ Reduction between untreated and gRNA transfection

Flow cytometry Cas9 inhibitor

Fetal Cas9 expressing fibroblasts were transfected with the anti-CRISPR AcrIIA4 to inhibit transgenic Cas9 activity and to prove that genome edits resulted from the transgenic Cas9 expression. It was expected that in transgenic Cas9 cells transfected with AcrIIA4 and gRNAs, genome editing of the transgenic Cas9 would be inhibited to a certain extent by AcrIIA4. Fetal fibroblasts from 102–12 were transfected with AcrIIA4and gRNAs (AcrIIA4 inhibitor) or gRNA only (gRNA transfection) Untreated cells served as positive control. Inhibition of Cas9 activity was indicated by a higher MFI for cells treated with gRNA for GGTA1 and AcrIIA4 (64.34) compared to gRNA only treated cells (49.66) (Table 7 and Fig 5). Cas9 activity was inhibited by AcrIIA4 in B2M gRNA treated cells with an MFI of 26.20 compared to 16.44 MFI in only gRNA treated cells.

Table 7. Median fluorescent intensity (MFI) after Cas9 inhibition.

Cell line	MFI knock-out cells^*	MFI untreated cells¹	MFI gRNA transfection cells	MFI reduction (%)⁺	MFI AcrIIA4 inhibitor and gRNA	MFI reduction after inhibition (%)^±
102–12 GGTA1	21.86	82.25	49.66	32.59 (39.55)	64.34	17.91 (21.78)
102–12 B2M	15.74	33.59	16.44	17.15 (51.06)	26.20	7.39 (22.00)

Open in a new tab

* Negative control (Isolated fibroblasts from GGTA1 and B2M knock-out pig)

¹ Positive control

⁺ MFI reduction between untreated cells and gRNA transfection cells

^± MFI reduction between untreated cells and after inhibition

Fig 5 — Isolated Cas9 expressing fetal fibroblasts were transfected with expression constructs for AcrIIA4, a Cas9 inhibitor and with gRNA targeting B2M or GGTA1.

Off-targets

Sanger sequencing and alignment to reference sequence after PCR revealed no off-target mutations in the Cas9 expressing cell lines (S3–S7 Figs).

Discussion

Genetically modified pigs pose great opportunities for biomedical research. Due to their close resemblance in physiology and anatomy to humans, pigs are more suitable for human disease modeling compared to rodent models. However, the generation of genetically modified pigs to model diseases human-like require great efforts compared to rodent models. Mainly due to the lack of adequate porcine pluripotent stem cells [41], the production of modified pigs relies on SCNT, microinjection or electroporation of zygotes. Somatic cell nuclear transfer remains inefficient and laborious [42] with only 1–3% success rates [43]. By developing Cas9 expressing breeding lines, germline modifications may be avoided, and the pigs can be used to establish diverse disease models. In this study, we generated Cas9 expressing founder animals based on transposon and random integration. Fibroblasts isolated from the transgenic founder animals were subjected to in vitro gRNA transfection and one RI boar was bred to a wild-type sow. RNA isolated from muscle, tonsil, spleen, kidney, lymph nodes, oral mucosa, and liver confirmed Cas9 transcription in organs. As in previously generated Cas9 expressing pigs [21, 26], our pigs showed Cas9 genome editing events upon transfection with gRNAs. NGS results revealed editing efficiencies ranging from 0.1 to 2.9% for GGTA1, 3.2 to 27.6% for B2M, and 19.4 to 60.2% for B4GALNT2. It is well established that editing efficiency varies among target loci, as it was also shown in Cre-dependent Cas9 expressing pigs. The study experienced editing efficiencies of 8.1%, 20.2%, and 78.8% for the APC, BRCA1, and BRCA2 loci, respectively, after in vivo transfections of gRNAs [21]. Transposon integration is associated with multicopy integration of transgenes [44–46]. Therefore, a multiple Cas9 integration by a SB transposon system was expected to result in higher Cas9 expression. As it was shown in organ tissue, Cas9 expression was overall higher in tissue isolated from the sacrificed SB pig compared to the RI pig. We tried to define copy number and integrations site, to determine copy number differences of transposon-based and random integrations. Nanopore sequencing was performed but with the generated data it was not possible to determine genomic location or copy number of the transgenes.

In addition, we investigated potential off-target mutations which could have been induced by the transfected gRNAs. Due to the constant Cas9 expression in the fibroblasts, there is an increased risk for off-target cleavage. Off-targets could have unwanted effects on the genotype of the pigs which could jeopardize the reliability of the disease model. For each gRNA, the three most potential off-target sites in the genome were selected, none of the 15 targets indicated illegitimate cleavage activity.

Furthermore, transgenic Cas9 expression may led to activation of the adaptive immune system. Studies which investigated Cas protein as therapeutics have observed specific immune responses towards Cas9 in mice [47–49]. However, besides SCNT related health issues our animals grew up healthy. Also, in line with previously generated Cas9 expressing pigs [21, 26] the integration and expression of Cas9 had no negative consequences on fertility [21, 26]. Similar results were obtained from a Cas9 expressing mouse model to study a variety of diseases and biological functions [20]. In addition, random integration of Cas9 in chickens based on transposon integration [50] or phiC31 integrase [26] did not result in any negative side effects.

Conclusion

In conclusion, we generated functional Cas9 expressing pigs which remained fertile and healthy and therefore are suitable for establishing a Cas9 breeding line. Genome editing of isolated Cas9 expressing fibroblast was feasible, paving the way to generate porcine genotypes for biomedical inquiries. In first investigations on off-target mutations caused by transfected gRNAs were not detected. However, a more detailed investigation of off-target mutations in Cas9 expressing pigs would be necessary when developing human disease models.

Supporting information

S1 Fig. Sanger sequence of amplified DNA isolated from 759–5,762–7 (RI pigs), 731–1, 732–3, 733–1 (SB pigs) and aligned to Cas9 reference sequence.

Amplified DNA products can be found in Fig 2(A) and 2(B).

(TIF)

Click here for additional data file.^{(76KB, tif)}

S2 Fig. Cas9 integration of semen: Cas9 amplification of semen DNA retrieved from boar 762–7, positive control (PC), wild-type DNA, and negative control (NC).

(TIF)

Click here for additional data file.^{(404.9KB, tif)}

S3 Fig. GGTA1 gRNA off-target alignments.

(TIF)

Click here for additional data file.^{(477.7KB, tif)}

S4 Fig. B2M gRNA #2 off-target alignments.

(TIF)

Click here for additional data file.^{(380KB, tif)}

S5 Fig. B2M gRNA #3 off-target alignments.

(TIF)

Click here for additional data file.^{(375.3KB, tif)}

S6 Fig. B4GALNT2 #3 off-target alignments.

(TIF)

Click here for additional data file.^{(336.1KB, tif)}

S7 Fig. B4GALNT2 #4 off-target alignments.

(TIF)

Click here for additional data file.^{(438.8KB, tif)}

S1 Table. Primers for detecting genome edits.

(DOCX)

Click here for additional data file.^{(13.7KB, docx)}

S2 Table. Results from computer assisted sperm morphology for boar 762–7.

(DOCX)

Click here for additional data file.^{(13.5KB, docx)}

S3 Table. Primer for off-target regions.

(DOCX)

Click here for additional data file.^{(20.8KB, docx)}

Acknowledgments

We would like to acknowledge the Research Core Unit Genomics (RCUG) at the Hannover Medical School for generating the next generation sequencing data. We are grateful for the competent SCNT and IVF team Andrea Lucas-Hahn, Petra Hassel, Roswitha Becker, and Maren Ziegler. Also, we would like to thank the team of the German Gene bank and the staff of the experimental piggery. Jenny-Helena Söllner was funded within the framework of an intrainstitutional African Swine Fever research consortium.

Data Availability

All additional data for NGS, qPCR, and Flow Cytometry have been made available under: https://osf.io/sxft2/.

Funding Statement

JHS was funded within the framework of an intrainstitutional African Swine Fever research consortium.

References

1.Niemann H, Kues WA. Transgenic livestock: premises and promises. Anim Reprod Sci. 2000;60–61: 277–293. doi: 10.1016/s0378-4320(00)00091-9 [DOI] [PubMed] [Google Scholar]
2.Niemann H, Kues WA, Petersen B, Carnwath JW. Transgenesis. Compr Biotechnol Second Ed. 2011;4: 457–467. doi: 10.1016/B978-0-08-088504-9.00299-3 [DOI] [Google Scholar]
3.Whyte JJ, Prather RS. Genetic modifications of pigs for medicine and agriculture. Molecular Reproduction and Development. John Wiley & Sons, Ltd; 2011. pp. 879–891. doi: 10.1002/mrd.21333 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Rogers CS. Genetically engineered livestock for biomedical models. Transgenic Res. 2016;25: 345–359. doi: 10.1007/s11248-016-9928-6 [DOI] [PubMed] [Google Scholar]
5.Rogers CS, Abraham WM, Brogden KA, Engelhardt JF, Fisher JT, McCray PB, et al. The porcine lung as a potential model for cystic fibrosis. Am J Physiol Cell Mol Physiol. 2008;295: L240–L263. doi: 10.1152/ajplung.90203.2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Rogers CS, Stoltz DA, Meyerholz DK, Ostedgaard LS, Rokhlina T. Disruption of the CFTR Gene Produces a Model of Cystic Fibrosis in Newborn pigs. Science (80-). 2008;321: 1837–1842. doi: 10.1126/science.1163600 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Klymiuk N, Mundhenk L, Kraehe K, Wuensch A. Sequential targeting of CFTR by BAC vectors generates a novel pig model of cystic fibrosis. 2012; 597–608. doi: 10.1007/s00109-011-0839-y [DOI] [PubMed] [Google Scholar]
8.Renner S, Braun-Reichhart C, Blutke A, Herbach N, Emrich D, Streckel E, et al. Permanent Neonatal Diabetes in INSC94Y Transgenic Pigs. Diabetes. 2013;62: 1505–1511. doi: 10.2337/db12-1065 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Renner S, Fehlings C, Herbach N, Hofmann A, Von Waldthausen DC, Kessler B, et al. Glucose Intolerance and Reduced Proliferation of Pancreatic β-Cells in Transgenic Pigs With Impaired Glucose-Dependent Insulinotropic Polypeptide Function. Diabetes. 2010;59: 1228–1238. doi: 10.2337/DB09-0519 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Umeyama K, Watanabe M, Saito H, Kurome M, Tohi S, Matsunari H, et al. Dominant-negative mutant hepatocyte nuclear factor 1α induces diabetes in transgenic-cloned pigs. Transgenic Res. 2009;18: 697–706. doi: 10.1007/s11248-009-9262-3 [DOI] [PubMed] [Google Scholar]
11.Leuchs S, Saalfrank A, Merkl C, Flisikowska T, Edlinger M, Durkovic M, et al. Inactivation and Inducible Oncogenic Mutation of p53 in Gene Targeted Pigs. PLoS One. 2012;7: e43323. doi: 10.1371/journal.pone.0043323 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Li S, Edlinger M, Saalfrank A, Flisikowski K, Tschukes A, Kurome M, et al. Viable pigs with a conditionally-activated oncogenic KRAS mutation. Transgenic Res. 2015;24: 509–517. doi: 10.1007/s11248-015-9866-8 [DOI] [PubMed] [Google Scholar]
13.Flisikowska T, Merkl C, Landmann M, Eser S, Rezaei N, Cui X, et al. A Porcine Model of Familial Adenomatous Polyposis. Gastroenterology. 2012;143: 1173–1175.e7. doi: 10.1053/j.gastro.2012.07.110 [DOI] [PubMed] [Google Scholar]
14.Suzuki S, Iwamoto M, Saito Y, Fuchimoto D, Sembon S, Suzuki M, et al. Il2rg gene-targeted severe combined immunodeficiency pigs. Cell Stem Cell. 2012;10: 753–758. doi: 10.1016/j.stem.2012.04.021 [DOI] [PubMed] [Google Scholar]
15.Watanabe M, Nakano K, Matsunari H, Matsuda T, Maehara M, Kanai T, et al. Generation of Interleukin-2 Receptor Gamma Gene Knockout Pigs from Somatic Cells Genetically Modified by Zinc Finger Nuclease-Encoding mRNA. PLoS One. 2013;8: e76478. doi: 10.1371/journal.pone.0076478 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Klymiuk N, Blutke A, Graf A, Krause S, Burkhardt K, Wuensch A, et al. Dystrophin-deficient pigs provide new insights into the hierarchy of physiological derangements of dystrophic muscle. Hum Mol Genet. 2013;22: 4368–4382. doi: 10.1093/hmg/ddt287 [DOI] [PubMed] [Google Scholar]
17.Hryhorowicz M, Zeyland J, Słomski R, Lipiński D. Genetically Modified Pigs as Organ Donors for Xenotransplantation. Mol Biotechnol. 2017;59: 435–444. doi: 10.1007/s12033-017-0024-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Dolgin E. First GM pigs for allergies. Could xenotransplants be next? Nat Biotechnol. 2021;39: 397–400. doi: 10.1038/s41587-021-00885-9 [DOI] [PubMed] [Google Scholar]
19.Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012;337: 816–21. doi: 10.1126/science.1225829 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, et al. CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell. 2014;159: 440–455. doi: 10.1016/j.cell.2014.09.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Wang K, Jin Q, Ruan D, Yang Y, Liu Q, Wu H, et al. Cre-dependent Cas9-expressing pigs enable efficient in vivo genome editing. Genome Res. 2017;27: 2061–2071. doi: 10.1101/gr.222521.117 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Xie C, Zhang YP, Song L, Luo J, Qi W, Hu J, et al. Genome editing with CRISPR/Cas9 in postnatal mice corrects PRKAG2 cardiac syndrome. Cell Res. 2016;26: 1099–1111. doi: 10.1038/cr.2016.101 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Maddalo D, Manchado E, Concepcion CP, Bonetti C, Vidigal JA, Han YC, et al. In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature. 2014;516: 423–428. doi: 10.1038/nature13902 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Sanchez-Rivera FJ, Papagiannakopoulos T, Romero R, Tammela T, Bauer MR, Bhutkar A, et al. Rapid modelling of cooperating genetic events in cancer through somatic genome editing. Nature. 2014;516: 428–431. doi: 10.1038/nature13906 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Wu Z, Yang H, Colosi P. Effect of Genome Size on AAV Vector Packaging. Mol Ther. 2010;18: 80–86. doi: 10.1038/mt.2009.255 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Rieblinger B, Sid H, Duda D, Bozoglu T, Klinger R, Schlickenrieder A, et al. Cas9-expressing chickens and pigs as resources for genome editing in livestock. PNAS. 2021;118: e2022562118. doi: 10.1073/pnas.2022562118 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Hölker M, Petersen B, Hassel P, Kues WA, Lemme E, Lucas-Hahn A, et al. Duration of In Vitro Maturation of Recipient Oocytes Affects Blastocyst Development of Cloned Porcine Embryos. Cloning Stem Cells. 2005. www.liebertpub.com [DOI] [PubMed] [Google Scholar]
28.Petersen B, Lucas-Hahn A, Oropeza M, Hornen N, Lemme E, Hassel P, et al. Development and Validation of a Highly Efficient Protocol of Porcine Somatic Cloning Using Preovulatory Embryo Transfer in Peripubertal Gilts. Cloning Stem Cells. 2008;10. [DOI] [PubMed] [Google Scholar]
29.Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, et al. Multiplex Genome Engineering Using CRISPR/Cas Systems. Science (80-). 2013;25: 778–785. doi: 10.1126/science.1231143 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Mátés L, Chuah MKL, Belay E, Jerchow B, Manoj N, Acosta-Sanchez A, et al. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet. 2009;41: 753–761. doi: 10.1038/ng.343 [DOI] [PubMed] [Google Scholar]
31.Hübner A, Petersen B, Keil GM, Niemann H, Mettenleiter TC, Fuchs W. Efficient inhibition of African swine fever virus replication by CRISPR/Cas9 targeting of the viral p30 gene (CP204L). Sci Rep. 2018;8: 1449. doi: 10.1038/s41598-018-19626-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Lucas-Hahn A, Petersen B, Nowak-Imialek M, Baulain U, Becker R, Eylers H-M, et al. 122 A New Maturation Medium Improves Porcine Embryo Production In Vitro. Reprod Fertil Dev. 2018;30: 200. doi: 10.1071/rdv30n1ab122 [DOI] [Google Scholar]
33.Yuan Y, Spate LD, Redel BK, Tian Y, Zhou J, Prather RS, et al. Quadrupling efficiency in production of genetically modified pigs through improved oocyte maturation. Proc Natl Acad Sci U S A. 2017;114: E5796–E5804. doi: 10.1073/pnas.1703998114 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Kurtz S, Lucas-Hahn A, Schlegelberger B, Göhring G, Niemann H, Mettenleiter DTC, et al. Knockout of the HMG domain of the porcine SRY gene causes sex reversal in gene-edited pigs. Proc Natl Acad Sci. 2021;118: 2008743118. doi: 10.1073/pnas.2008743118 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Sake HJ, Frenzel A, Lucas-Hahn A, Nowak-Imialek M, Hassel P, Hadeler K, et al. Possible detrimental effects of beta-2-microglobulin knockout in pigs. Xenotransplantation. 2019;26. doi: 10.1111/xen.12525 [DOI] [PubMed] [Google Scholar]
36.Hein R, Sake HJ, Pokoyski C, Hundrieser J, Brinkmann A, Baars W, et al. Triple (GGTA1, CMAH, B2M) modified pigs expressing an SLA class Ilow phenotype—Effects on immune status and susceptibility to human immune responses. Am J Transplant. 2020;20: 988–998. doi: 10.1111/ajt.15710 [DOI] [PubMed] [Google Scholar]
37.Kleinstiver BP, Prew MS, Tsai SQ, Topkar VV., Nguyen NT, Zheng Z, et al. Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015;523: 481–485. doi: 10.1038/nature14592 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Sharma A, Naziruddin B, Cui C, Martin MJ, Xu H, Wan H, et al. Pig cells that lack the gene for α1–3 galactosyltransferase express low levels of the gal antigen. Transplantation. 2003;75: 430–436. doi: 10.1097/01.TP.0000053615.98201.77 [DOI] [PubMed] [Google Scholar]
39.Pawluk A, Davidson AR, Maxwell KL. Anti-CRISPR: Discovery, mechanism and function. Nat Rev Microbiol. 2018;16: 12–17. doi: 10.1038/nrmicro.2017.120 [DOI] [PubMed] [Google Scholar]
40.Bubeck F, Hoffmann MD, Harteveld Z, Aschenbrenner S, Bietz A, Waldhauer MC, et al. Engineered anti-CRISPR proteins for optogenetic control of CRISPR–Cas9. Nat Methods. 2018;15: 924–927. doi: 10.1038/s41592-018-0178-9 [DOI] [PubMed] [Google Scholar]
41.Ezashi T, Yuan Y, Roberts RM. Pluripotent stem cells from domesticated mammals. Annu Rev Anim Biosci. 2016;4: 223–253. doi: 10.1146/annurev-animal-021815-111202 [DOI] [PubMed] [Google Scholar]
42.Czernik M, Anzalone DA, Palazzese L, Oikawa M, Loi P. Somatic cell nuclear transfer: Failures, successes and the challenges ahead. Int J Dev Biol. 2019;63: 123–130. doi: 10.1387/ijdb.180324mc [DOI] [PubMed] [Google Scholar]
43.Whitworth KM, Prather RS. Somatic cell nuclear transfer efficiency: How can it be improved through nuclear remodeling and reprogramming? Mol Reprod Dev. 2010;77: 1001–1015. doi: 10.1002/mrd.21242 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Ivics Z, Li MA, Mátés L, Boeke JD, Bradley A, Izsvák Z. Transposon-mediated Genome Manipulations in Vertebrates. Nat Methods. 2009;6: 415. doi: 10.1038/NMETH.1332 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Garrels W, Mátés L, Holler S, Dalda A, Taylor U, Petersen B, et al. Germline Transgenic Pigs by Sleeping Beauty Transposition in Porcine Zygotes and Targeted Integration in the Pig Genome. PLoS One. 2011;6: e23573. doi: 10.1371/journal.pone.0023573 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Jakobsen JE, Li J, Kragh PM, Moldt B, Lin L, Liu Y, et al. Pig transgenesis by Sleeping Beauty DNA transposition. Transgenic Res. 2011;20: 533–545. doi: 10.1007/s11248-010-9438-x [DOI] [PubMed] [Google Scholar]
47.Chew WL, Tabebordbar M, Cheng JKW, Mali P, Wu EY, Ng AHM, et al. A multi-functional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016;13: 868. doi: 10.1038/nmeth.3993 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Chew WL. Immunity to CRISPR Cas9 and Cas12a therapeutics. Wiley Interdiscip Rev Syst Biol Med. 2018;10: 1–23. doi: 10.1002/wsbm.1408 [DOI] [PubMed] [Google Scholar]
49.Wang D, Mou H, Li S, Li Y, Hough S, Tran K, et al. Adenovirus-Mediated Somatic Genome Editing of Pten by CRISPR/Cas9 in Mouse Liver in Spite of Cas9-Specific Immune Responses. Hum Gene Ther. 2015;26: 432–442. doi: 10.1089/hum.2015.087 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Challagulla A, Jenkins KA, O’Neil TE, Shi S, Morris KR, Wise TG, et al. In vivo inhibition of marek’s disease virus in transgenic chickens expressing Cas9 and gRNA against ICP4. Microorganisms. 2021;9: 1–17. doi: 10.3390/microorganisms9010164 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0279123.r001

Decision Letter 0

Irina Polejaeva

8 Aug 2022

PONE-D-22-03392In vitro genome editing activity of Cas9 in somatic cells after random and transposon-based genomic Cas9 integrationPLOS ONE

Dear Dr. Soellner,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Sep 22 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Irina Polejaeva, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This manuscript focused on the production of transgenic pig cells and animals by using random and transposon-based integration of a constitutive expression of Cas9 protein for in vitro evaluation. They envision that these animals will serve for the production of various animal models of human disease by in vivo therapy with the sgRNA to induce the disease. Their approach aims to overcome the limitations of the SCNT efficiency and unforeseen abnormalities caused by the same procedure. They also expect that Cas9 expressing animals could be further expanded by breeding.

Major: There is no major objection to this manuscript. The manuscript is overall well written and easy to follow.

Minor: Some sentences could be improved such as:

Line 53. Instead of ‘Humans show a higher anatomical…’, use ‘Pigs show a higher anatomical… resemblance to human than rodents, which still…’. When we talk about animal models, we refer to them as references/models for humans. The way how it is written seems a bit the opposite.

Missing reference in Line 82. ‘In mice, several attempts of in vivo tissue modifications… successful (Reference).’

Some typos also need to be addressed, such as Buffer instead of ‘puffer’; ‘Promoter instead of promotor’; ‘SYBR instead of SYBER’.

Also, some sentence clarifications, such as Line 317: ‘GGTA1 reads from isolates of 731…’ to ‘GGTA1 reads isolated from 731…’ or ‘ GGTA1 reads from 731…’

Line 366: ‘Inhibition of Cas9 activity was inhibited which was indicated…’ to ‘Inhibition of Cas9 activity was indicated…’

Technical clarifications: Line 409: ‘results were inconclusive.’ Due to? I think the authors may clarify the reason why these results were inconclusive.

Note that off-targets do not imply off-target mutations. Please, the authors should clarify when they refer to off-target sites and when they refer to off-target mutations.

Improve the conclusion to cover their major accomplishments and clarify the lines below as it was a side experiment to search for most likely, but not all, off-target mutations.

Clarify/modify Line 430 – 432: This off-target conclusion seems a premature answer given that their analysis only searched the three most likely off-target sites and does not present a deep unbiased method of genomic search of off-targets, although I agree that Cas9 expressing animals are suitable for in vivo genome editing.

Reviewer #2: General comments:

In this study, the authors generated Cas9 expression boars by using somatic cell nuclear transfer (SCNT) and random integration/transposon approaches. Cas9 expression was confirmed in different organs of Cas9 transgenic animals. In addition, the authors proved that the integrated Cas9 remained functional. They detected in vitro gene editing, at varied efficiencies of 2-60% using next generation sequencing, in fibroblasts isolated from transgenic founders after transfection with guide RNAs targeting three different genes.

To develop Cas9 expression breeding pigs avoids germline modifications during the generation of animal models using SCNT or embryonic injection methods, especially when KO of certain genes is detrimental to the development of embryos. The strategy reported in this paper enables direct in vivo gene modifications and/or evaluation of in vivo gene therapies. Undeniably, similar Cas9-expressing pigs have been reported in Journals of Genome Res in 2017 and in PNAS, 2021 (Ref. 21 and 26) by other labs. However, the present study enriches data and knowledges in this direction and facilitates further work for in vivo gene editing in animals or humans.

Other comments:

1. L32: ‘such as diabetes’ seems unrelated to the present study, I suggest deleting it.

2. L268 and L274: Table 2 and 3 could be combined to facilitate direct comparison between two transgenic methods, random integration and transposon.

3. L299-301: The sentence, ‘After IVF … to the next generation’, needs to be improved.

4. L316: Should ‘ranged from 3.4 – 27.6 %’ be ‘ranged from 2.7 - 27.6 %?

5. L281: In my view, it is unnecessary to present all sequencing results of 5 founders in Fig 2, since all the sequencing results are the same as that of Cas9. Basically, the authors inclined to report the PCR identification results in this figure. The gel electrophoresis picture could be enough to prove Cas9 integration in F0 animals in Fig 2, and the Cas9 sequencing results could be placed in the supplements. Also, Fig 1, 2, and 3 could be combined to systematically present the PCR identification results for embryos/animals at different generations.

6. L345: Typo. ‘control’ should be ‘control.’

7. L348: Typo. ‘decrease’ should be ‘decreased’

8. L364 – 365: The sentence is confusing to me and could be improved.

9. L407: Is ‘scarified’ correct here?

10. L410: ‘off all gRNAs’ should be ‘of all gRNAs’

11. S2 Table: Typo. ‘S1 Table’ should be ‘S2 Table’

12. Combine the Tables S3, S4, and S5.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Iuri Viotti Perisse

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: Review Plos One.docx

Click here for additional data file.^{(14.8KB, docx)}

PLoS One. 2022 Dec 30;17(12):e0279123. doi: 10.1371/journal.pone.0279123.r002

Author response to Decision Letter 0

31 Oct 2022

Dear Editor and Reviewers,

We gratefully acknowledge your reviewing comments on our manuscript ‘In vitro genome editing activity of Cas9 in somatic cells after random and transposon-based genomic Cas9 integration’ by Soellner et.al. Please find enclosed our revised version of the manuscript.

We thank you for your valuable and helpful comments and remarks regarding our manuscript. We have accepted and acted on your suggestions and provided point-by-point explanations below. We are confident we have addressed the issues raised by you and thereby increased the quality of the revised manuscript to make it acceptable for publication in PLOS ONE.

Here is our point-by-point explanation to your comments and suggestions.

Editors suggestions:

• Comment 1: We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

Response: Thank you for pointing out the mismatch in the ‘Funding information’ and ‘Funding disclosure’. JHS was funded within the framework of an intrainstitutional African Swine Fever research consortium as stated in the ‘Funding information’.

• Comment 2: We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you.

Response: We would like to change the data availability statement to ‘All data is fully available upon request’. Contact for all available data would be bjoern.petersen@fli.de.

• Comment 3: In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available.

Response: All raw gel images are available in the ‘Supporting information’ section.

• Comment 4: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and include a citation and full reference for the retraction notice.

Response: One additional reference was added to the reference list. Pawluk A, Davidson AR, Maxwell KL. Anti-CRISPR: Discovery, mechanism and function, (39).

Reviewer #1 minor suggestions:

• Comment 1: Some sentences could be improved such as:

Response: Thank you for suggesting that some sentences should be rewritten to avoid any confusions. We have rewritten the sentence in line 53 and went through the manuscript again to improve clarity.

• Comment 2: Missing reference in Line 82. ‘In mice, several attempts of in vivo tissue modifications… successful (Reference).

Response: The references for in vivo issue modification in mice were included in the sentence (Reference list 22-24).

• Comment 3: Some typos also need to be addressed, such as Buffer instead of ‘puffer’; ‘Promoter instead of promotor’; ‘SYBR instead of SYBER’.

Response: Thank you for highlighting the typos. We went through the manuscript and corrected the mistakes.

• Comment 4: Also, some sentence clarifications, such as Line 317: ‘GGTA1 reads from isolates of 731…’ to ‘GGTA1 reads isolated from 731…’ or ‘GGTA1 reads from 731…’

Response 4: We agree that the paragraph could have been written clearer. We improved the paragraph and hope it is now clearer to the reader.

• Comment 5: Line 366: ‘Inhibition of Cas9 activity was inhibited which was indicated…’ to ‘Inhibition of Cas9 activity was indicated…’

Response: The line was rewritten.

• Comment 6: Technical clarifications: Line 409: ‘results were inconclusive.’ Due to? I think the authors may clarify the reason why these results were inconclusive.

Response: An explanation why the Nanopore results were inconclusive has been added. ‘Nanopore sequencing was performed but with the generated data it was not possible to determine genomic location or copy number of the transgenes.’

• Comment 7: Note that off-targets do not imply off-target mutations. Please, the authors should clarify when they refer to off-target sites and when they refer to off-target mutations.

o Improve the conclusion to cover their major accomplishments and clarify the lines below as it was a side experiment to search for most likely, but not all, off-target mutations.

o Clarify/modify Line 430 – 432: This off-target conclusion seems a premature answer given that their analysis only searched the three most likely off-target sites and does not present a deep unbiased method of genomic search of off-targets, although I agree that Cas9 expressing animals are suitable for in vivo genome editing.

Response: Thank you for clarifying the impact of the off-target mutations in this paper. We have now improved the terminology and concluded that more detailed investigations are required to rule out any off-target mutations.

Reviewer #2 minor suggestions:

• Comment 1: L32: ‘such as diabetes’ seems unrelated to the present study, I suggest deleting it.

Response: We have deleted the phrase ‘such as diabetes’.

• Comment 2: L268 and L274: Table 2 and 3 could be combined to facilitate direct comparison between two transgenic methods, random integration and transposon.

Response: Thank you for the useful suggestion. We have combined the two tables to one.

• Comment 3: L299-301: The sentence, ‘After IVF … to the next generation’, needs to be improved.

Response: The sentence was rewritten and improved.

• Comment 4: L316: Should ‘ranged from 3.4 – 27.6%’ be ‘ranged from 2.7 - 27.6%?

Response: Thank you for pointing out the mistake, we have corrected it.

• Comment 5: L281: In my view, it is unnecessary to present all sequencing results of 5 founders in Fig 2, since all the sequencing results are the same as that of Cas9. Basically, the authors inclined to report the PCR identification results in this figure. The gel electrophoresis picture could be enough to prove Cas9 integration in F0 animals in Fig 2, and the Cas9 sequencing results could be placed in the supplements. Also, Fig 1, 2, and 3 could be combined to systematically present the PCR identification results for embryos/animals at different generations.

Response: Thank you for your suggestions. The gel electrophoresis images of the founder animals have now been added and the Sanger sequencing alignments moved to the supplement section. Also, the figures of the gel electrophoresis were combined to one figure.

• Comment 6+7: Typos in L345 and L348

Response: The typos have been corrected

• Comment 8: L364 – 365: The sentence is confusing to me and could be improved.

Response: The sentence was improved and is hopefully clearer for the reader now.

• Comment 9: L407: Is ‘scarified’ correct here?

Response: Thank you for highlighting the word ‘scarified’, we of course meant ‘sacrificed’.

• Comment 10: L410: ‘off all gRNAs’ should be ‘of all gRNAs’

Response: The mistake has been corrected.

• Comment 11: S2 Table: Typo. ‘S1 Table’ should be ‘S2 Table’

Response: ‘S1 Table’ has been changed to ‘S2 Table’

• Comment 12: Combine the Tables S3, S4, and S5

Response: The tables for the off-target mutation detection have been combined into one table.

We are looking forward to hearing from you regarding our new submission and to respond to any further comments or questions you may have.

Sincerely yours,

Jenny Söllner

Attachment

Submitted filename: response_to_reviewer.pdf

Click here for additional data file.^{(356.8KB, pdf)}

PLoS One. doi: 10.1371/journal.pone.0279123.r003

Decision Letter 1

Irina Polejaeva

1 Dec 2022

In vitro genome editing activity of Cas9 in somatic cells after random and transposon-based genomic Cas9 integration

PONE-D-22-03392R1

Dear Dr. Soellner,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Irina Polejaeva, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0279123.r004

Acceptance letter

Irina Polejaeva

19 Dec 2022

PONE-D-22-03392R1

In vitro genome editing activity of Cas9 in somatic cells after random and transposon-based genomic Cas9 integration

Dear Dr. Söllner:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr Irina Polejaeva

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Sanger sequence of amplified DNA isolated from 759–5,762–7 (RI pigs), 731–1, 732–3, 733–1 (SB pigs) and aligned to Cas9 reference sequence.

Amplified DNA products can be found in Fig 2(A) and 2(B).

(TIF)

Click here for additional data file.^{(76KB, tif)}

S2 Fig. Cas9 integration of semen: Cas9 amplification of semen DNA retrieved from boar 762–7, positive control (PC), wild-type DNA, and negative control (NC).

(TIF)

Click here for additional data file.^{(404.9KB, tif)}

S3 Fig. GGTA1 gRNA off-target alignments.

(TIF)

Click here for additional data file.^{(477.7KB, tif)}

S4 Fig. B2M gRNA #2 off-target alignments.

(TIF)

Click here for additional data file.^{(380KB, tif)}

S5 Fig. B2M gRNA #3 off-target alignments.

(TIF)

Click here for additional data file.^{(375.3KB, tif)}

S6 Fig. B4GALNT2 #3 off-target alignments.

(TIF)

Click here for additional data file.^{(336.1KB, tif)}

S7 Fig. B4GALNT2 #4 off-target alignments.

(TIF)

Click here for additional data file.^{(438.8KB, tif)}

S1 Table. Primers for detecting genome edits.

(DOCX)

Click here for additional data file.^{(13.7KB, docx)}

S2 Table. Results from computer assisted sperm morphology for boar 762–7.

(DOCX)

Click here for additional data file.^{(13.5KB, docx)}

S3 Table. Primer for off-target regions.

(DOCX)

Click here for additional data file.^{(20.8KB, docx)}

Attachment

Submitted filename: Review Plos One.docx

Click here for additional data file.^{(14.8KB, docx)}

Attachment

Submitted filename: response_to_reviewer.pdf

Click here for additional data file.^{(356.8KB, pdf)}

Data Availability Statement

All additional data for NGS, qPCR, and Flow Cytometry have been made available under: https://osf.io/sxft2/.

[pone.0279123.ref001] 1.Niemann H, Kues WA. Transgenic livestock: premises and promises. Anim Reprod Sci. 2000;60–61: 277–293. doi: 10.1016/s0378-4320(00)00091-9 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref002] 2.Niemann H, Kues WA, Petersen B, Carnwath JW. Transgenesis. Compr Biotechnol Second Ed. 2011;4: 457–467. doi: 10.1016/B978-0-08-088504-9.00299-3 [DOI] [Google Scholar]

[pone.0279123.ref003] 3.Whyte JJ, Prather RS. Genetic modifications of pigs for medicine and agriculture. Molecular Reproduction and Development. John Wiley & Sons, Ltd; 2011. pp. 879–891. doi: 10.1002/mrd.21333 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref004] 4.Rogers CS. Genetically engineered livestock for biomedical models. Transgenic Res. 2016;25: 345–359. doi: 10.1007/s11248-016-9928-6 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref005] 5.Rogers CS, Abraham WM, Brogden KA, Engelhardt JF, Fisher JT, McCray PB, et al. The porcine lung as a potential model for cystic fibrosis. Am J Physiol Cell Mol Physiol. 2008;295: L240–L263. doi: 10.1152/ajplung.90203.2008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref006] 6.Rogers CS, Stoltz DA, Meyerholz DK, Ostedgaard LS, Rokhlina T. Disruption of the CFTR Gene Produces a Model of Cystic Fibrosis in Newborn pigs. Science (80-). 2008;321: 1837–1842. doi: 10.1126/science.1163600 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref007] 7.Klymiuk N, Mundhenk L, Kraehe K, Wuensch A. Sequential targeting of CFTR by BAC vectors generates a novel pig model of cystic fibrosis. 2012; 597–608. doi: 10.1007/s00109-011-0839-y [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref008] 8.Renner S, Braun-Reichhart C, Blutke A, Herbach N, Emrich D, Streckel E, et al. Permanent Neonatal Diabetes in INSC94Y Transgenic Pigs. Diabetes. 2013;62: 1505–1511. doi: 10.2337/db12-1065 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref009] 9.Renner S, Fehlings C, Herbach N, Hofmann A, Von Waldthausen DC, Kessler B, et al. Glucose Intolerance and Reduced Proliferation of Pancreatic β-Cells in Transgenic Pigs With Impaired Glucose-Dependent Insulinotropic Polypeptide Function. Diabetes. 2010;59: 1228–1238. doi: 10.2337/DB09-0519 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref010] 10.Umeyama K, Watanabe M, Saito H, Kurome M, Tohi S, Matsunari H, et al. Dominant-negative mutant hepatocyte nuclear factor 1α induces diabetes in transgenic-cloned pigs. Transgenic Res. 2009;18: 697–706. doi: 10.1007/s11248-009-9262-3 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref011] 11.Leuchs S, Saalfrank A, Merkl C, Flisikowska T, Edlinger M, Durkovic M, et al. Inactivation and Inducible Oncogenic Mutation of p53 in Gene Targeted Pigs. PLoS One. 2012;7: e43323. doi: 10.1371/journal.pone.0043323 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref012] 12.Li S, Edlinger M, Saalfrank A, Flisikowski K, Tschukes A, Kurome M, et al. Viable pigs with a conditionally-activated oncogenic KRAS mutation. Transgenic Res. 2015;24: 509–517. doi: 10.1007/s11248-015-9866-8 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref013] 13.Flisikowska T, Merkl C, Landmann M, Eser S, Rezaei N, Cui X, et al. A Porcine Model of Familial Adenomatous Polyposis. Gastroenterology. 2012;143: 1173–1175.e7. doi: 10.1053/j.gastro.2012.07.110 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref014] 14.Suzuki S, Iwamoto M, Saito Y, Fuchimoto D, Sembon S, Suzuki M, et al. Il2rg gene-targeted severe combined immunodeficiency pigs. Cell Stem Cell. 2012;10: 753–758. doi: 10.1016/j.stem.2012.04.021 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref015] 15.Watanabe M, Nakano K, Matsunari H, Matsuda T, Maehara M, Kanai T, et al. Generation of Interleukin-2 Receptor Gamma Gene Knockout Pigs from Somatic Cells Genetically Modified by Zinc Finger Nuclease-Encoding mRNA. PLoS One. 2013;8: e76478. doi: 10.1371/journal.pone.0076478 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref016] 16.Klymiuk N, Blutke A, Graf A, Krause S, Burkhardt K, Wuensch A, et al. Dystrophin-deficient pigs provide new insights into the hierarchy of physiological derangements of dystrophic muscle. Hum Mol Genet. 2013;22: 4368–4382. doi: 10.1093/hmg/ddt287 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref017] 17.Hryhorowicz M, Zeyland J, Słomski R, Lipiński D. Genetically Modified Pigs as Organ Donors for Xenotransplantation. Mol Biotechnol. 2017;59: 435–444. doi: 10.1007/s12033-017-0024-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref018] 18.Dolgin E. First GM pigs for allergies. Could xenotransplants be next? Nat Biotechnol. 2021;39: 397–400. doi: 10.1038/s41587-021-00885-9 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref019] 19.Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012;337: 816–21. doi: 10.1126/science.1225829 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref020] 20.Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, et al. CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell. 2014;159: 440–455. doi: 10.1016/j.cell.2014.09.014 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref021] 21.Wang K, Jin Q, Ruan D, Yang Y, Liu Q, Wu H, et al. Cre-dependent Cas9-expressing pigs enable efficient in vivo genome editing. Genome Res. 2017;27: 2061–2071. doi: 10.1101/gr.222521.117 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref022] 22.Xie C, Zhang YP, Song L, Luo J, Qi W, Hu J, et al. Genome editing with CRISPR/Cas9 in postnatal mice corrects PRKAG2 cardiac syndrome. Cell Res. 2016;26: 1099–1111. doi: 10.1038/cr.2016.101 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref023] 23.Maddalo D, Manchado E, Concepcion CP, Bonetti C, Vidigal JA, Han YC, et al. In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature. 2014;516: 423–428. doi: 10.1038/nature13902 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref024] 24.Sanchez-Rivera FJ, Papagiannakopoulos T, Romero R, Tammela T, Bauer MR, Bhutkar A, et al. Rapid modelling of cooperating genetic events in cancer through somatic genome editing. Nature. 2014;516: 428–431. doi: 10.1038/nature13906 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref025] 25.Wu Z, Yang H, Colosi P. Effect of Genome Size on AAV Vector Packaging. Mol Ther. 2010;18: 80–86. doi: 10.1038/mt.2009.255 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref026] 26.Rieblinger B, Sid H, Duda D, Bozoglu T, Klinger R, Schlickenrieder A, et al. Cas9-expressing chickens and pigs as resources for genome editing in livestock. PNAS. 2021;118: e2022562118. doi: 10.1073/pnas.2022562118 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref027] 27.Hölker M, Petersen B, Hassel P, Kues WA, Lemme E, Lucas-Hahn A, et al. Duration of In Vitro Maturation of Recipient Oocytes Affects Blastocyst Development of Cloned Porcine Embryos. Cloning Stem Cells. 2005. www.liebertpub.com [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref028] 28.Petersen B, Lucas-Hahn A, Oropeza M, Hornen N, Lemme E, Hassel P, et al. Development and Validation of a Highly Efficient Protocol of Porcine Somatic Cloning Using Preovulatory Embryo Transfer in Peripubertal Gilts. Cloning Stem Cells. 2008;10. [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref029] 29.Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, et al. Multiplex Genome Engineering Using CRISPR/Cas Systems. Science (80-). 2013;25: 778–785. doi: 10.1126/science.1231143 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref030] 30.Mátés L, Chuah MKL, Belay E, Jerchow B, Manoj N, Acosta-Sanchez A, et al. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet. 2009;41: 753–761. doi: 10.1038/ng.343 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref031] 31.Hübner A, Petersen B, Keil GM, Niemann H, Mettenleiter TC, Fuchs W. Efficient inhibition of African swine fever virus replication by CRISPR/Cas9 targeting of the viral p30 gene (CP204L). Sci Rep. 2018;8: 1449. doi: 10.1038/s41598-018-19626-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref032] 32.Lucas-Hahn A, Petersen B, Nowak-Imialek M, Baulain U, Becker R, Eylers H-M, et al. 122 A New Maturation Medium Improves Porcine Embryo Production In Vitro. Reprod Fertil Dev. 2018;30: 200. doi: 10.1071/rdv30n1ab122 [DOI] [Google Scholar]

[pone.0279123.ref033] 33.Yuan Y, Spate LD, Redel BK, Tian Y, Zhou J, Prather RS, et al. Quadrupling efficiency in production of genetically modified pigs through improved oocyte maturation. Proc Natl Acad Sci U S A. 2017;114: E5796–E5804. doi: 10.1073/pnas.1703998114 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref034] 34.Kurtz S, Lucas-Hahn A, Schlegelberger B, Göhring G, Niemann H, Mettenleiter DTC, et al. Knockout of the HMG domain of the porcine SRY gene causes sex reversal in gene-edited pigs. Proc Natl Acad Sci. 2021;118: 2008743118. doi: 10.1073/pnas.2008743118 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref035] 35.Sake HJ, Frenzel A, Lucas-Hahn A, Nowak-Imialek M, Hassel P, Hadeler K, et al. Possible detrimental effects of beta-2-microglobulin knockout in pigs. Xenotransplantation. 2019;26. doi: 10.1111/xen.12525 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref036] 36.Hein R, Sake HJ, Pokoyski C, Hundrieser J, Brinkmann A, Baars W, et al. Triple (GGTA1, CMAH, B2M) modified pigs expressing an SLA class Ilow phenotype—Effects on immune status and susceptibility to human immune responses. Am J Transplant. 2020;20: 988–998. doi: 10.1111/ajt.15710 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref037] 37.Kleinstiver BP, Prew MS, Tsai SQ, Topkar VV., Nguyen NT, Zheng Z, et al. Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015;523: 481–485. doi: 10.1038/nature14592 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref038] 38.Sharma A, Naziruddin B, Cui C, Martin MJ, Xu H, Wan H, et al. Pig cells that lack the gene for α1–3 galactosyltransferase express low levels of the gal antigen. Transplantation. 2003;75: 430–436. doi: 10.1097/01.TP.0000053615.98201.77 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref039] 39.Pawluk A, Davidson AR, Maxwell KL. Anti-CRISPR: Discovery, mechanism and function. Nat Rev Microbiol. 2018;16: 12–17. doi: 10.1038/nrmicro.2017.120 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref040] 40.Bubeck F, Hoffmann MD, Harteveld Z, Aschenbrenner S, Bietz A, Waldhauer MC, et al. Engineered anti-CRISPR proteins for optogenetic control of CRISPR–Cas9. Nat Methods. 2018;15: 924–927. doi: 10.1038/s41592-018-0178-9 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref041] 41.Ezashi T, Yuan Y, Roberts RM. Pluripotent stem cells from domesticated mammals. Annu Rev Anim Biosci. 2016;4: 223–253. doi: 10.1146/annurev-animal-021815-111202 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref042] 42.Czernik M, Anzalone DA, Palazzese L, Oikawa M, Loi P. Somatic cell nuclear transfer: Failures, successes and the challenges ahead. Int J Dev Biol. 2019;63: 123–130. doi: 10.1387/ijdb.180324mc [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref043] 43.Whitworth KM, Prather RS. Somatic cell nuclear transfer efficiency: How can it be improved through nuclear remodeling and reprogramming? Mol Reprod Dev. 2010;77: 1001–1015. doi: 10.1002/mrd.21242 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref044] 44.Ivics Z, Li MA, Mátés L, Boeke JD, Bradley A, Izsvák Z. Transposon-mediated Genome Manipulations in Vertebrates. Nat Methods. 2009;6: 415. doi: 10.1038/NMETH.1332 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref045] 45.Garrels W, Mátés L, Holler S, Dalda A, Taylor U, Petersen B, et al. Germline Transgenic Pigs by Sleeping Beauty Transposition in Porcine Zygotes and Targeted Integration in the Pig Genome. PLoS One. 2011;6: e23573. doi: 10.1371/journal.pone.0023573 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref046] 46.Jakobsen JE, Li J, Kragh PM, Moldt B, Lin L, Liu Y, et al. Pig transgenesis by Sleeping Beauty DNA transposition. Transgenic Res. 2011;20: 533–545. doi: 10.1007/s11248-010-9438-x [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref047] 47.Chew WL, Tabebordbar M, Cheng JKW, Mali P, Wu EY, Ng AHM, et al. A multi-functional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016;13: 868. doi: 10.1038/nmeth.3993 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref048] 48.Chew WL. Immunity to CRISPR Cas9 and Cas12a therapeutics. Wiley Interdiscip Rev Syst Biol Med. 2018;10: 1–23. doi: 10.1002/wsbm.1408 [DOI] [PubMed] [Google Scholar]

[pone.0279123.ref049] 49.Wang D, Mou H, Li S, Li Y, Hough S, Tran K, et al. Adenovirus-Mediated Somatic Genome Editing of Pten by CRISPR/Cas9 in Mouse Liver in Spite of Cas9-Specific Immune Responses. Hum Gene Ther. 2015;26: 432–442. doi: 10.1089/hum.2015.087 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279123.ref050] 50.Challagulla A, Jenkins KA, O’Neil TE, Shi S, Morris KR, Wise TG, et al. In vivo inhibition of marek’s disease virus in transgenic chickens expressing Cas9 and gRNA against ICP4. Microorganisms. 2021;9: 1–17. doi: 10.3390/microorganisms9010164 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

In vitro genome editing activity of Cas9 in somatic cells after random and transposon-based genomic Cas9 integration

Jenny-Helena Söllner

Hendrik Johannes Sake

Antje Frenzel

Rita Lechler

Doris Herrmann

Walter Fuchs

Björn Petersen

Roles

Abstract

Introduction

Material and methods

Ethics statement

Generation of Cas9 expressing pigs

Establishment of donor cells

Fig 1. Transgenes inserted into the porcine genome.

Characterization of transfected fibroblasts

Somatic cell nuclear transfer

Genotyping offspring

Reverse-transcription qPCR

Heritability of vector integration

In vitro activity of Cas9 expression

Fibroblast isolation

Guide RNA transfection

Table 1. Guide RNA sequences to target B2M, GGTA1, and B4GalNT.

Validation of edited cell lines

Next generation sequencing

Flow cytometry

Cas9 inhibitor

Off-targets

Results

Generation of Cas9 expressing pigs

Table 2. Quantitative result from somatic cell nuclear transfer with transposon-based integration (SB pigs).

Genotyping founder animals

Fig 2.

Reverse-transcription qPCR of organ tissue

Table 3. Cas9 transcription of isolated organ tissue.

Heritability of vector integration

In vitro activity of Cas9 expression

Next generation sequencing

Table 4. Next generation sequencing editing efficiency and coverage mean.

Flow cytometry GGTA1

Table 5. Median fluorescent intensity (MFI) of GGTA1 gRNA transfected cells.

Fig 3. Flow cytometry of GGTA1 gRNA transfected Cas9 expressing fibroblasts.

Flow cytometry B2M

Fig 4. Flow cytometry of B2M gRNAs transfected Cas9 expressing fibroblasts.

Table 6. Median fluorescent intensity (MFI) of B2M gRNA transfected cells.

Flow cytometry Cas9 inhibitor

Table 7. Median fluorescent intensity (MFI) after Cas9 inhibition.

Fig 5. Flow cytometry of Cas9 inhibitor transfected fibroblasts.

Off-targets

Discussion

Conclusion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Irina Polejaeva

Roles

Author response to Decision Letter 0

Decision Letter 1

Irina Polejaeva

Roles

Acceptance letter

Irina Polejaeva

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases